Atieh Shemshadian1, Hassan Vatandoost1,2, Mohammad Ali Oshaghi1, Mohammad Reza Abai1, Navid Dinparast Djadid3, Fateh Karimian1. 1. Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran. 2. Department of Chemical Pollutants and Pesticides, Institute for Environmental Research, Tehran University of Medical Sciences, Tehran, Iran. 3. Malaria and Vector Research Group, Biotechnology Research Center (BRC), Pasteur Institute of Iran, Tehran, Iran.
Abstract
Many studies have been done on the various factors affecting resistance to insecticides. The relationship between Wolbachia bacteria and resistance to insecticides is one of the factors that has attracted a lot of attentions. Wolbachia are obligatory intracellular endosymbionts that naturally occur in a wide range of arthropods and nematodes, including the mosquito Culex quinquefasciatus. Initially, the presence of bacteria was proved by molecular assays. Then the resistance level of this species was evaluated in adults against DDT 4.0% and deltamethrin 0.05% using the standard WHO guideline. After elimination of Wolbachia by tetracycline and its proof by molecular assays, the susceptibility tests were conducted again on uninfected line. Finally, the two lines were compared in terms of responding to insecticides. The findings indicated that there is no significant correlation between susceptibility of two lines in response to DDT 4.0% while they represented a significant correlation for deltamethrin (P =0.00). We propose that Wolbachia bacteria increase the susceptibility to deltamethrin but they show neutral effect on DDT susceptibility in Cx. quinquefasciatus. However, more studies on other vectors and insecticides still need to be done.
Many studies have been done on the various factors affecting resistance to insecticides. The relationship between Wolbachia bacteria and resistance to insecticides is one of the factors that has attracted a lot of attentions. Wolbachia are obligatory intracellular endosymbionts that naturally occur in a wide range of arthropods and nematodes, including the mosquito Culex quinquefasciatus. Initially, the presence of bacteria was proved by molecular assays. Then the resistance level of this species was evaluated in adults against DDT 4.0% and deltamethrin 0.05% using the standard WHO guideline. After elimination of Wolbachia by tetracycline and its proof by molecular assays, the susceptibility tests were conducted again on uninfected line. Finally, the two lines were compared in terms of responding to insecticides. The findings indicated that there is no significant correlation between susceptibility of two lines in response to DDT 4.0% while they represented a significant correlation for deltamethrin (P =0.00). We propose that Wolbachia bacteria increase the susceptibility to deltamethrin but they show neutral effect on DDT susceptibility in Cx. quinquefasciatus. However, more studies on other vectors and insecticides still need to be done.
Resistance to insecticides has become an important public health hazard and has increased in all the medically important insects (Rivero et al., 2010). This issue has caused a major problem to the control of mosquito vectors, specially Cx. quinquefasciatus which is born in wastewaters and is exposed to different kinds of insecticides (Liu et al., 2013). It is expected that insecticide resistance will directly contribute to the reemergence of vector-borne diseases (Brogdon and McAllister, 1998). Due to these issues, interests in biological control methods have been raised. One of the alternative method is using Wolbachia bacteria. The widespread bacteria Wolbachia have been detected in all classes of arthropods, as well as in the nematode family (Zug and Hammerstein, 2012). These bacteria are intracellular, which are inherited maternally (Zhu et al., 2012). Wolbachia can influence their hosts by reproductive manipulations including cytoplasmic incompatibility, feminization, male killing, and parthenogenesis (Wang et al., 2016; Turley et al., 2009; Werren, 1997). Furthermore, Wolbachia affect other parameters in their host like fitness, blood feeding, pathogen interference, disease transmission, immune system, probing behavior, host temperature preference, and insecticide resistance (Hague et al., 2020; Caragata et al., 2016; De Almeida et al., 2011; Glaser and Meola, 2010; Turley et al., 2009; Kambris et al., 2009; Moreira et al., 2009; Duron et al., 2006; Berticat et al., 2002). Several studies have been carried out to investigate the relationship between Wolbachia infection and insecticide resistance. The results of some of these studies illustrate that Wolbachia increase the host susceptibility to insecticides, while others show the opposite outcomes. Berticat et al. (2002) showed that the Wolbachia density was strongly influenced by the presence of resistance genes in Culex pipiens. Their results revealed that the resistant mosquitoes show higher levels of Wolbachia infection than susceptible species, despite having the same genetic background. Their major assumption was the disability of mosquito which controls the Wolbachia density due to presence of resistance genes. Similar results were shown in Duron et al. (2006). They compared the Cx. pipiens strains which shared a common genetic background but differed from the resistance alleles and Wolbachia loading. Subsequently, Kontsedalov et al. (2008) indicated that the presence of specific symbionts can be associated with resistance to insecticides in Bemisia tabaci. They reported that, more susceptibility was observed to some insecticides in Rickettsia positive population. In the same study, Ghanim and Kontsedalov (2009) reported the correlation between the bacterial densities and insecticide resistance level in Bemisia tabaci. Their result suggested that the more symbionts a pest population gains, the more susceptibe to insecticides they will be. The studies about interaction between symbiont presence and resistance to insticide continued by Echaubard et al. (2010). They studied the evolution of the Wolbachia densities in laboratory and field populations of Cx. pipiens over the course of 50 generations. Their results indicated that in the old population the Wolbachia densities were higher in insecticide-resistant individuals than insecticide-susceptible individuals for both sexes.Following these studies, concerns about the negative effects of Wolbachia on vector control were raised. In a study by Endersby and Hoffmann in 2012, the resistance levels in Aedes aegypti Wolbachia infected and uninfected lines to bifenthrin, Bacillus thuringiensis, temephos and s-methoprene were evaluated. Results showed that there was no adverse effect of Wolbachia infection on chemical control of Ae. aegypti. However, the recent studies have revealed contradictory results. Li et al. (2018) suggested that Serratia and Wolbachia infection might increase the resistance to buprofezin in Laodelphax striatellus. In another study, Li et al. (2020) indicated that Wolbachia are involved in insecticicide resistance in some genetic background of Laodelphax striatellus while having no effect in others. To help with having a clearer understanding towards the influence of Wolbachia bacteria on insecticide resistance, we studied the levels of resistance in two Wolbachia infected and uninfected lines of Cx. quinquefasciatus to DDT and deltamethrin. The result of this study may offer a prespective on the possible role of Wolbachia in insecticide resistance.
Materials and methods
Study area
A residential coastal area located on the edge of Bandar-Abbas, Hormozgan province near the Persian Gulf, was selected for mosquito collection (Suru, 27°10N-56°15E). Suru was a district location on the edge of the city (see Figure 1).
Figure 1
Sampling location in Suru, Bander-Abbas Port, Hormozgan province, southern Iran.
Sampling location in Suru, Bander-Abbas Port, Hormozgan province, southern Iran.
Mosquito collection and rearing
The samples were collected in stagnant contaminated water from both abandoned boats and holes. The larvae and pupae along with the water and plants of the breeding places, were transported to the insectary at Bandar-Abbas Training and Research Station. All mosquito larvae and adults were reared in an insectary at the temperature of 30 ± 5 °C, 70 ± 5% Relative Humidity and photoperiod of '12:12 [L: D].Larvae and adults were kept in 42 cm by 25 cm by 25 cm trays and 65 cm3 cages, respectively. Larvae were fed with fish flake and adults with sucrose solution and blood feeding on birds.
Detection of Wolbachia
DNA extraction was performed using Collins DNA extraction method (Collins et al., 1987) from the whole adult male and female bodies. In this study, Wolbachia surface protein gene (wsp) was detected based on the standard protocol (Braig et al., 1998; Zhou et al., 1998) to prove the presence of these bacteria using semi-nested PCR. At the beginning of the study, general wsp primers as formerly depicted in Braig et al., (1998), were used.General primers, wsp 81F: 5'–TGGTCCAATAAGTGATGAAGAAAC–3' and wsp 691R: 5'– AAAAATTAAACGCTACTCCA–3', which are able to amplify a DNA fragment in the range of 590–632 bp depending on the individual Wolbachia strain, were utilized. The first PCR product was used as a template for the second PCR. In second PCR, the of 501 bp fragment was amplified using a second set of primers, 183F:5'–AAGGAACCGAAGTTCATG–3' and 691R: 5'–AAAAATTAAACGCTACTCCA–3'. The amplifications were checked by agarose electrophoresis. wsp gene sequencing was performed by primers 183F and 691R, and the results were sent in the shape of Chromos curves. The similarity between the obtained sequences verified the effectiveness of using Clustal W2 software. The NCBI BLAST server was used to compare with GenBank sequences records.
Insecticide susceptibility test (before treatment)
The susceptibility tests were done using test papers treated with DDT 4.0% and deltamethrin 0.05% supplied by the Vector Control Research Unit, School of Biological Sciences, 11800 Minden, Penang, Malaysia.Adult susceptibility tests were performed according to WHO standard protocol (World Health Organization, WHO 2016). Twenty-five freshly emerged sugar fed females, 2–3 days old, were exposed to DDT 4.0% and deltamethrin 0.05% impregnated paper on the WHO standard test kit. Tests with insecticide free papers were conducted in parallel and served as the control. Ten replicates were conducted for each insecticide, and two replicates were conducted for the control. Once the exposure time ended, both mosquito groups were allowed to recover in holding tubes supplied with 10% sucrose solution. Mortality was verified after a 24-h insecticide exposure. The susceptibility tests were conducted separately on three different generations of Cx. quinquefasciatus, the field population, F3, and F6.
Tetracycline treatment
Three different protocols were used to remove Wolbachia from Cx. quinquefasciatus including treatment of eggs, adults, and larvae. The former two attempts failed due to high mortality but the larvae treatment showed desirable results. Tetracycline hydrochloride (Sigma-Aldrich) at the concentration of 0.05 mg/ml was usedhttps://www.powerthesaurus.org/applied/synonyms for the first larval stage treatment and was applied over three generations. The experiments were planned according to the previous studies (Yen and Barr, 1973; Rasgon and Scott, 2003). Tetracycline solution was buffered to pH 7 using 1 M solution of unbuffered Tris (pH 11). To avoid larval mortality, addition of the food at the beginning of rearing was essential. Additionally, the treated larvae were kept in the dark to prevent the oxidation of the antibiotic. Before the colony was used for the susceptibility tests, mosquitoes were reared for three generations under the standard condition (without antibiotics) to avoid any antibiotic side effects. Wolbachia PCR assay was done on some specimens of each generation after treatment.
Insecticide susceptibility test (after treatment)
The second stage susceptibility tests were performed using mosquitoes of the first, second, and third generations of the uninfected line according to the WHO standard protocol.
Statistics analysis
Mortality rates of Cx. quinquefasciatus after 24 h of recovery were calculated for each insecticide and strain. Then, they were corrected using Abbott's formula when the mortality rate in the control group is higher than 5%. The following criteria were used for interpretation of the resistance status of Cx. quinquefasciatus according to the WHO criteria. The resistance, tolerance, and susceptibility were ranked for groups where the mortality rates were less than 90 percent, between 90 and 98 percent, and higher than 98 percent respectively. Univariate analysis of variance (ANOVA) was conducted after an arcsin transformation of the mortality rate to determine differences in mosquito mortality rates among strains. The significant differences of the mean of mortality rates were compared using either Tukey or Games-Howell tests. the standard error (SE) was calculated using the following formula: where p is the mortality rate, q is 1 minus the mortality rate, and n is the sample size (Figures 4, 5, and 7, 8, 9, and 10).
Figure 5
Comparison of susceptibility levels of different Cx. quinquefasciatus populations to deltamethrin 0.05%.
Figure 8
Comparison of susceptibility levels of different Cx. quinquefasciatus populations to deltamethrin 0.05%.
Figure 9
Cx. quinquefasciatus resistance level against DDT 4.0 % in Wolbachia infected and uninfected populations.
Results
Wolbachia prevalence in wild population
Results of the current study showed the presence of Wolbachia bacteria in all males and females of each generations, selected from the Bandar Abbas population. The infection was detected by Semi-Nested–PCR assay using wsp gene. The amplicons of first and second runs of Semi-Nested–PCR assay were ~600 and 500 bp respectively (Figure 2).
Figure 2
First Semi-Nested PCR products (~630) of Wolbachia wsp gene of Cx. quinquefasciatus specimens. Lanes: M, 50bp molecular weight marker, 1: negative control, 2: positive control, 3–5: Bandar Abbas population of Cx. quinquefasciatus.
First Semi-Nested PCR products (~630) of Wolbachia wsp gene of Cx. quinquefasciatus specimens. Lanes: M, 50bp molecular weight marker, 1: negative control, 2: positive control, 3–5: Bandar Abbas population of Cx. quinquefasciatus.Semi-Nested–PCR product of the Wolbachia wsp gene, detected in Bandar Abbas population of Cx. quinquefasciatus, was sequenced and then submitted to Genbank (Accession Number: MK360157). The BLAST results of the sequences demonstrated 99% similarity to Wolbachia endosymbiont in Cx. pipiens with the Accession Number KT964228.1 which belongs to Turkey. All the wild specimens were found to shelter the Wolbachia strain belonging to the Pip group of B supergroup (wPipB).The Wolbachia strain, identified in this study, was subjected to a molecular phylogenetic analysis with available sequence data of 30 other Wolbachia strains from the Genbank database belonging to orders Diptera, Hymenoptera, Lepidoptera, Odonata, Hemiptera, and Arachnida. The results showed 99% similarity between Wolbachia bacteria in Cx. quinquefasciatus of the Bandar Abbas population, and wsp gene sequence in Cx. quinquefasciatus, and Cx. pipiens from the United Kingdom, China, India, Taiwan, Iran, and Turkey. A phylogenetic tree was made using the neighbor-joining method of MEGA7 software, based on the 500 bp of wsp sequences. The specimens were compared to other Wobachia strain sequences in the Genbank. These sequences belong to hosts such as mosquitoes (Culex), flies (Drosophila), nematodes (Litomosoides, Dirofilaria) and termites (Coptotermes) (Figure 2) (see Figure 3).
Figure 3
The phylogenetic tree derived from 554 bp of wsp sequences of Wolbachia pipientis hosts using the neighbor-joining method. The numbers on the branches are the bootstrap values. Scale below the tree is the amount of genetic differences between species.
The phylogenetic tree derived from 554 bp of wsp sequences of Wolbachia pipientis hosts using the neighbor-joining method. The numbers on the branches are the bootstrap values. Scale below the tree is the amount of genetic differences between species.In this stage of the research, three generations of Cx. quinquefasciatus were tested. The field population, the third generation, and the sixth generation were coded as Field strain-W+, Field strain-F3-W+ and Field strain-F6-W+ respectively. The mortality rate of female Cx. quinquefasciatus, exposed to the DDT of 4.0%, was 12.1% in the field strain, 9.5% in the third genetation (F3) and 10.5% in the sixth generations (F6) (Figure 4). Mortality rate comparison between different isolates indicated stability in the resistance level to DDT in the population, in spite of breeding six generations in insectary. For the deltamethrin of 0.05%, the rates in the field strain, F3, and F6 were 58.3, 52.7, and 33.8%, respectively (Figure 5). The results revealed that resistance increased the generations progressed. This data showed that the Cx. quinquefasciatus population was highly resistant to both studied insecticides (Table 1).
Figure 4
Comparison of susceptibility levels of different Cx. quinquefasciatus populations to DDT 4.0%.
Table 1
Susceptibility levels to DDT 4.0% and deltamethrin 0.05% in three generations of Wolbachia positive Cx. quinquefasciatus.
Generation
Insecticide
No dead
No tested
Mortality ± SE
Corrected Mortality
Field strain-W+
DDT 4.0%
23
96
7.3 ± 24
7.3 ± 12.1
deltamethrin 0.05%
62
97
6.8 ± 63.9
6.8 ± 58.3
Control
10
74
3.4 ± 13.5
-
Field strain-F3-W+
DDT 4.0%
23
243
3 ± 9.5
-
deltamethrin 0.05%
127
241
3.1 ± 52.7
-
Control
0
50
0
-
Field strain-F6-W+
DDT 4.0%
16
153
3.9 ± 10.5
-
deltamethrin 0.05%
45
133
3.5 ± 33.8
-
Control
0
64
0
-
Comparison of susceptibility levels of different Cx. quinquefasciatus populations to DDT 4.0%.Comparison of susceptibility levels of different Cx. quinquefasciatus populations to deltamethrin 0.05%.Susceptibility levels to DDT 4.0% and deltamethrin 0.05% in three generations of Wolbachia positive Cx. quinquefasciatus.
Wolbachia detection in treated population
To ensure bacteria were cleared after treating population with tetracycline, Wolbachia PCR assay was conducted using the same protocol and primers which were mentioned earlier (Braig et al., 1998; Zhou et al., 1998). According to our results, no bacteria were detected (Figure 6).
Figure 6
Second Semi-Nested PCR products (~500) of Wolbachia wsp gene of Cx. quinquefasciatus specimens. Lanes: M, 50bp molecular weight marker, 1: negative control, 2: positive control, 3–5: Bandar Abbas population of Cx. quinquefasciatus, 6–9: treated Bandar Abbas population of Cx. quinquefasciatus.
Second Semi-Nested PCR products (~500) of Wolbachia wsp gene of Cx. quinquefasciatus specimens. Lanes: M, 50bp molecular weight marker, 1: negative control, 2: positive control, 3–5: Bandar Abbas population of Cx. quinquefasciatus, 6–9: treated Bandar Abbas population of Cx. quinquefasciatus.After tetracycline treatment and bacteria clearing verification, the population was reared for three more generations under the standard condition to restore the normal bacterial flora and avoid antibiotic pressure. These generations were coded as F1 Lab W-, F2 Lab W-, and F3 Lab W-. The mortality rates of female Cx. quinquefasciatus exposed to DDT = 4.0% were 10.5 ± 3.9, 8.9 ± 2, and 6.5 ± 1.7 in F1 Lab W-, F2 Lab W-, and F3 Lab W-, respectively (Figure 7). Despite the elimination of bacteria, the results indicated no change in resistance level of Cx. quinquefasciatus against DDT. The mortality rate of female Cx. quinquefasciatus, exposed to deltamethrin, changed to 33.8 ± 3.5 in F1 Lab W-, 32.7 ± 6 in F2 Lab W- and, 38.8 ± 4.4 F3 in Lab W- (Figure 8). There was no alteration in the resistance level of the Wolbachia free population to deltamethrin (Table 2).
Figure 7
Comparison of susceptibility levels of different Cx. quinquefasciatus populations to DDT 4.0%.
Table 2
Susceptibility levels to DDT 4.0% and deltamethrin 0.05% in three generations of Wolbachia negative Cx. quinquefasciatus.
Generation
Insecticide
No dead
No tested
Mortality ± SE
F1 Lab W-
DDT 4.0%
16
153
10.5 ± 3.9
deltamethrin 0.05%
45
133
33.8 ± 3.5
Control
0
64
0
F2 Lab W-
DDT 4.0%
15
168
8.9 ± 2
deltamethrin 0.05%
49
150
32.7 ± 6
Control
0
41
0
F3 Lab W-
DDT 4.0%
9
139
6.5 ± 1.7
deltamethrin 0.05%
54
139
38.8 ± 4.4
Control
0
43
0
Comparison of susceptibility levels of different Cx. quinquefasciatus populations to DDT 4.0%.Comparison of susceptibility levels of different Cx. quinquefasciatus populations to deltamethrin 0.05%.Susceptibility levels to DDT 4.0% and deltamethrin 0.05% in three generations of Wolbachia negative Cx. quinquefasciatus.
Comparison of mortality among treated and untreated populations
After conducting the susceptibility test on treated (F1 Lab W-, F2 Lab W-, and F3 Lab W-) and untreated (Field strain-W+, Field strain-F3-W+, and Field strain-F6-W+) populations, the cumulative results were compared (Table 3). The results showed no significant difference between the resistance levels of the two populations against DDT (P > 0.05, df = 37, t = 1.032) (Figure 9). However, the resistance ratio for the deltamethrin showed a significant difference between Wolbachia infected and uninfected populations (P < 0.05, df = 36, t = 3.950). The untreated population showed lower resistance compared to the population which was treated against deltamethrin (Figure 10).
Table 3
Comparison of susceptibility levels to DDT 4.0 % and deltamethrin 0.05% between treated and untreated populations of Cx. quinquefasciatus.
Insecticide
W+/W-
No dead
No tested
Mortality±SE
DDT
W+
59
491
12 ± 4.6
W-
66
460
14.3 ± 2.5
deltamethrin
W+
258
503
51.3 ± 4.6
W-
148
422
35.1 ± 4.6
Figure 10
Cx. quinquefasciatus resistance level against deltamethrin 0.05% in Wolbachia infected and uninfected populations.
Comparison of susceptibility levels to DDT 4.0 % and deltamethrin 0.05% between treated and untreated populations of Cx. quinquefasciatus.Cx. quinquefasciatus resistance level against DDT 4.0 % in Wolbachia infected and uninfected populations.Cx. quinquefasciatus resistance level against deltamethrin 0.05% in Wolbachia infected and uninfected populations.
Discussion
The relationship between insecticide resistance and the presence of Wolbachia bacteria in the host is one of the important issues in vector control, specially mosquitoes. In the context of parasitism and its relationship with the cost of resistance in mosquitoes to insecticides, Agnew et al. (2004) showed that Vavraia culicis can modify the costs of organophosphate insecticide resistance in Cx. quinquefasciatus. In this study, we hypothesized that the presence of Wolbachia alters the response of Cx. quinquefasciatus to DDT and deltamethrin. Although many research have been done in this regard, there are still many unanswered questions about this relationship. Until now, the studies have not shown a clear effect of Wolbachia on insecticide resistance in mosquitoes. Endersby and Hoffmann (2012) examined the susceptibility levels in Wolbachia infected and uninfected populations of Aedes aegypti against bifenthrin, Bacillus thuringiensis, temephos, and s-methoprene. According to the results, there was no significant difference between the presence and absence of bacteria and resistance level in Ae. aegypti to insecticides. This outcome is in agreement with the result of our study concerning the response of Cx. quinquefasciatus to DDT in Wolbachia infected and uninfected populations.Regarding other endosymbionts, the outcomes of studies have illustrated that, they usually cause higher susceptibility in their hosts rather than resistance (Li et al., 2020; Liu and Guo, 2019). In this respect, Kontsedalov et al. (2008) evaluated the resistance level in two Rickettsia infected and uninfected populations of Bemisia tabaci against six insecticides. They showed that although two populations did not differ in susceptibility to two of them, more susceptibility was observed in Rickettsia infected population against other insecticides. They concluded that in the presence of a symbiont the level of susceptibility to insecticides in B. tabaci increased. In 2009, Ghanim and Kontsedalov conducted another study on B. tabaci biotype Q. In this research, they evaluated the susceptibility level of three groups of B. tabaci, harboring different microorganisms against the insecticides mentioned in the previous study. The results suggested that the larger the bacterial density of the host, the more it is likely to detoxify insecticides. The results of another study by Skaljac et al. (2018) demonstrated that Serratia infection increased the susceptibility of pea aphid to four out of five insecticides. We achieved similar outcome related to deltamethrin. Based on our result, the Wolbachia infected population showed less resistance to deltamethrin compared to treated population. The different function of a symbiont may be associated with host species, symbiont species, chemicals, symbionts' density and the gene expression. In 2002, a study was conducted by Berticat et al. to find out the association between the presence of Wolbachia bacteria in the host and resistance genes. The results showed a significant change in bacterial density in the presence of resistance genes. They assumed that mosquitoes with resistance genes were not able to control the bacterial load in their bodies. As a result, this high volume of bacteria have virulent effects for the host. As it was observed in this study, Wolbachia infected population showed less resistance against deltamethrin which could be due to the same negative effect of the bacteria mentioned in Berticat et al. (2002). The negative effect of symbionts on their host fitness may increase their susceptibility. Skaljac et al. (2018) stated that fitness costs including lower reproduction and body weight in Acyrthosiphon pisum is due to the presence of a symbiont, which leads to higher susceptibility to insecticides.In a study on Wolbachia density and its relationship with cost of infection in insecticide resistant Cx. pipiens, Duron et al. (2006) discovered that bacterial density was higher in resistant mosquitoes. In order to determine whether resistance costs are due to resistance genes or high volume of the bacteria, they compared some strains of mosquitoes with the same genetic background but with differences in resistance alleles and bacterial contamination status. The results showed that although Wolbachia bacteria are partly responsible for the fitness cost of insecticide resistance, there is still an association between fitness cost and resistance genes even in Wolbachia free population. Thus, for some uninfected resistant strains, the mortality rate remains high. Therefore, Wolbachia bacteria induce additional resistance costs for some specific traits. This result matches our finding regarding higher mortality in Wolbachia infected population against deltamethrin. In the case of insecticide resistant strain SA2, also, the authors did not observe any difference in resistance level in the presence and absence of bacteria. The outcome of the present study indicated that Cx. quinquefasciatus infected and uninfected populations showed no difference in the resistance level against DDT.Based on the results of the present study, we found that the presence of Wolbachia bacteria in Cx. quinquefasciatus may play a role in decrease resistance to deltamethrin while having no effect on resistance to DDT. This means that Wolbachia have no adverse effect on chemical control of Cx. quinquefasciatus and does not exacerbate the resistance caused by using DDT and deltamethrin against this species. The result of this study may help with better understanding of the possible role of endosymbionts in resistance to insecticides, although more experiments in this area are still required.
Declarations
Author contribution statement
Atieh Shemshadian: Conceived and designed the experiments; Performed the experiments; Wrote the paper.Hassan Vatandoost, Navid Dinparast Djadid: Conceived and designed the experiments.Mohammad Ali Oshaghi: Conceived and designed the experiments; Contributed reagents, materials, analysis tools or data.Mohammad Reza Abai: Conceived and designed the experiments; Analyzed and interpreted the data.Fateh Karimian: Analyzed and interpreted data.
Funding statement
This work was supported partially by the
under code number of 995633.
Data availability statement
Data will be made available on request.
Declaration of interests statement
The authors declare no conflict of interest.
Additional information
No additional information is available for this paper.
Authors: Jan Hubert; Marta Nesvorna; Marie Bostlova; Bruno Sopko; Stefan J Green; Thomas W Phillips Journal: Microb Ecol Date: 2022-07-16 Impact factor: 4.192
Authors: Muhammad Kamran; Sarfraz Ali Shad; Muhammad Binyameen; Naeem Abbas; Muhammad Anees; Rizwan Mustafa Shah; Abdulwahab M Hafez Journal: Insects Date: 2022-09-13 Impact factor: 3.139