Genetic markers for preeclampsia in Peruvian women.

BACKGROUND: Preeclampsia is a multiorgan disorder associated with maternal and perinatal morbi-mortality. In Peru, incidence is 10% and accounts for 22% of maternal deaths. Genome and genetic epidemiological studies have found an association between preeclampsia and genetic polymorphisms.
OBJECTIVE: To determine the association of the vascular endothelial growth factor (VEGF) +936 C/T and +405 G/C, interleukine-6 (IL-6) -174 G/C, IL-1β-511 C/T, Apo A-1-75 G/A, Apo B-100 2488 C/T (Xbal) polymorphisms with preeclampsia in pregnant Peruvian women.
METHODS: Were included preeclamptic and healthy (control) pregnant women. Maternal blood samples were subjected to DNA extraction, and molecular genetic analysis was conducted using the PCR-RFLP technique and following a specific protocol for each gene. Allele and genotypic frequencies in the cases and controls were compared.
RESULTS: No association was found between the VEGF+936C/T and VEGF+405 polymorphisms and preeclampsia. The frequencies of the GG genotypes and the G allele of the -174 G/C polymorphism in the IL6 gene in preeclamptic and controls showed significant differences, with higher frequencies in cases. For the -511 C/T polymorphism of the IL-1β gene, no significant differences were found in the frequencies of TT genotypes compared with CT+CC. The genotypes and alleles of the Apo-A1-75 G/A and Apo-B100 Xbal variants showed no significant differences between cases and controls.
CONCLUSION: No association was found between the studied genetic markers and preeclampsia. However, in the -174G/C polymorphism of the IL-6 gene, significant differences were found mainly in the GG genotype and G allele.

Remark

Introduction

Hypertension is the most frequent medical complication of pregnancy , and the most severe clinical presentation of hypertensive disorders of pregnancy is preeclampsia, a condition that is significantly associated with maternal and perinatal morbidity and mortality.

Preeclampsia is the leading cause of maternal death in the western world. It is a multiorgan disorder involving new-onset hypertension (>140/90 mm Hg) and proteinuria in women who are at least 20 weeks pregnant . The clinical presentation and dynamics of preeclampsia are variable; for instance, hypertension and proteinuria may not always be present . In the absence of proteinuria, preeclampsia diagnosis is based on the occurrence of hypertension accompanied by low platelet count (below 100,000/mL), abnormal liver function (indicated by serum transaminase levels that are twice the normal concentrations), kidney failure (indicated by serum creatinine level exceeding 1.1 mg/dL or by serum creatinine levels that are twice the levels in the absence of other renal diseases), pulmonary edema, or de novo presentation of cerebral or visual alterations .

Preeclampsia affects 3% to 8% of pregnant women, depending on the population and region being studied and on the definition of preeclampsia being used ,. In Peru, preeclampsia incidence is greater than 10% in various regions ), and it accounts for 22% of all maternal deaths.

The common factors associated with preeclampsia development in developed countries are obesity, insulin resistance and hyperlipidemia, whereas in developing countries, the associated factors are ethnicity, poor nutritional habits, subclinical infections, and other socioeconomic characteristics .

The etiology of preeclampsia remains unknown. However, it has been found that genetic factors cause a defective immune adaptation , which in turn leads to inadequate trophoblast invasion and inappropriate placenta development. Abnormal endometrial cytotrophoblast infiltration generates arterial disorders, such as loss of elasticity that affects vascular remodeling and impairs the fetus’s blood supply ,. Placental ischemia and hypoxia as well as oxidative stress and endotheliosis then develop , compromising the placenta and important maternal organs and systems. Oxidative stress stimulates the syncytiotrophoblast to release proinflammatory cytokines, exosomes, antiangiogenic factors, and cell-free fetal DNA into the maternal circulation ,.

Complications can emerge at any point during pregnancy, frequently surreptitiously and severely. Prior to the development of a clinical disease, vasospasm, activation of the coagulation cascade, and reduction in plasma volume occur. There are more harmful effects when preeclampsia appears early, including intrauterine growth retardation (IUGR) and prematurity . Moreover, placental senescence is accelerated , the concentration of pro-inflammatory cytokines, cell-free DNA, leptin, placental apoptotic debris and soluble fms-like tyrosine kinase 1 (sFLT1) in maternal blood increases, and placental growth factor (PlGF) levels decrease .

There is no method that can predict the onset of preeclampsia, and there is no cure for this condition other than the delivery of the fetus and the placenta. Preeclampsia usually resolves soon after delivery. However, epidemiological studies have associated preeclampsia with metabolic, cardiovascular and cerebral disorders ,- that will appear later in the mother and child, and this association has a great impact on disability and heathcare expenditure eventually -.

Genome and genetic epidemiology studies have found an association between preeclampsia and certain genes ,, polymorphisms and other molecular and inflammatory markers ,,,. Thus, detecting these biomarkers early in gestation will allow us to predict and manage preeclampsia properly.

Several pro- and anti-angiogenic proteins are produced in the placenta from the beginning of pregnancy; these substances play a role in endothelial dysfunction and the risk of preeclampsia ,. The most important angiogenic factors , include the vascular endothelial growth factor (VEGF) and the placental growth factor (PGF) . Antiangiogenic substances are abundantly expressed in preeclampsia and cause maternal endothelial cell dysfunction and damage ,,, which have negative consequences to a mother and her fetus. The genes encoding for the important antiangiogenic factors include the soluble tyrosinase-like factor (sFLT-1) gene, the VEGF soluble Fms-like tyrosine kinase -1 (VEGFR-1) gene, and the endothelin-1 gene polymorphisms ,.

Due to the high prevalence of preeclampsia in Peru and considering that oxidative stress induces the syncytiotrophoblast to release pro-inflammatory cytokines, exosomes, anti-angiogenic factors, and cell-free fetal DNA into maternal circulation ,, we decided to characterize some of these biomarkers in preeclamptic Peruvian women and verify whether these biomarkers can be applied to predict, prevent and manage preeclampsia among Peruvian women. We studied some genes and polymorphisms involved in preeclampsia, including the VEGF +936C/T and +405G/C polymorphisms, interleukin-6 (IL-6) gene polymorphisms, IL-1β gene -511C/T polymorphism , and polymorphisms of both the Apo A-1 and Apo B-100 genes, in preeclamptic and healthy Peruvian pregnant women. Our findings increase our knowledge of the genetic factors associated with preeclampsia, an emergent research topic in Peru.

Materials and Methods

This study is an observational associative case-control study performed between 2012 and 2018. The participating institutions were the Institute of Clinical Investigations and the Biochemistry and Nutrition Research Center of the Faculty of Medicine, National University of San Marcos, Lima, Peru. Subjects were recruited from the Hospital Docente Madre-Niño San Bartolomé, a public institution that is managed by the Peruvian Ministry of Health.

A preeclamptic woman was defined as a pregnant woman with a blood pressure of >140/90 mm Hg and proteinuria of ≥300 mg/24 h (>1+ dipstick) according to the International Federation of Gynecology and Obstetrics classification, which was updated in the year 2000 .

The sampling method was non-probabilistic (for convenience). The inclusion criteria for the preeclampsia group were as follows: pregnant women aged ≥18 years who had been diagnosed with severe preeclampsia in the second half of pregnancy as confirmed by clinical and laboratory data and who had signed an informed consent. Pregnant women without proteinuria or those with chronic hypertension, diabetes, and other medical conditions as well as those with incomplete information were excluded. For the control group, the inclusion criteria were as follows: pregnant women aged ≥18 years who were apparently healthy without preeclampsia and without relevant diseases and who signed the informed consent. Table 1 presents the number of cases and controls studied for each gene polymorphism.

Table 1

Number of preeclamptic women and controls included in the study.

Gene	Polymorphism	Preeclampsia	Control	Total
VEGF	+936 C/T	45	49	94
	+405 G/C	39	45	84
IL-6	-174 G/C	20	39	59
IL1β	-511 C/T	49	50	99
Apo A-1	-75 G/A	47	45	92
Apo B-100	2 488 C/T (Xbal)	47	45	92

We obtained approval for our study protocol from the Ethics Committee of the Faculty of Medicine of the National University of San Marcos and from the ethics committee of the participating hospital. An ad hoc clinical file was filled with mother and newborn data. Written informed consent was obtained from all participants. Blood samples (5 mL) were drawn from the participants’ antecubital vein, and the samples were kept in a refrigerator and then transported to the laboratory. The blood samples were subjected to DNA extraction with the commercial kits used for genotype and allele determination for the investigated genes.

The maternal data entered in the ad hoc file were as follows: age, marital status, height, weight, personal medical history (hypertension, previous preeclampsia, diabetes mellitus, neuropathy, cardiopathy, and metabolic syndrome), family medical history (hypertension, diabetes mellitus, obesity, metabolic syndrome, and other conditions), number of pregnancies, preterm deliveries, low-weight newborns, hemoglobin levels, type of delivery, gestational age at delivery, and hospital stay (in days). The newborn data obtained were as follows: weight, Apgar scores at 1 and 5 min, gestational age, complications (fetal distress, respiratory distress, and perinatal asphyxia), IUGR, prematurity, respiratory distress syndrome, jaundice, infection, fetal death, neonatal death, malformations, and hospital stay (in days).

In the genetic molecular analysis, the PCR-RFLP technique was used, specific protocols was employed for each gene, and adequate laboratory conditions were ensured. The genotypes of the polymorphisms were confirmed by automated Sanger sequencing.

VEGF gene +936C/T and +405G/C polymorphisms

The specific primers F: 5’AAGGAAGAGGAGACTCTGCGCAGAGC3’ and R: 5´TAAATGTATGTATGTGGGTGGGTGTGTCTACAGG3´ were used for the +936C/T amplification, and the NlaIII enzyme was used for digestion according to the protocol of Papazoglou . For +405G/C, the primers F: 5’CCGACGGCTTGGGGA GATTGCTC3’ and R: 5’CGGCGGTCACCCCCAAAAGCAG3’ were used for amplification, and the BsmFI enzyme was used for digestion according to the protocol of Banyasz and Garza-Veloz .

IL-6 gene -174G/C polymorphism

The specific primers F: 5´TGACTTCAGCTTTAC TCTTTGT’3 and R: 5’CTGATTGGAAACCTTATTAGG’3 were used for amplification, and the restriction enzyme SfaNI was used fo digestion according to Berthold . The GG and GC genotypes obtained by PCR-RFLP and Sanger sequencing are reported in Figure 1.

Figure 1

Determination of the genotypes of the -174 G/C polymorphism in IL6 gene. Left: Agarose gels with homozygous GG (140 and 58 bp) and heterozygous GC (198, 140 and 58 bp) genotypes as determined by PCR-RFLP with SfaNI as the restriction enzyme . Right: Chromatograms obtained by automated Sanger sequencing confirming the GG and CC genotypes (marked with arrows).

IL-1β gene -511C/T polymorphism

The specific primers F: 5′TGGCATTGATCTGGTTCATC3′ and R: 5′GTTTAGGAATCTTCCCACTT3´ were used for amplification, and the restriction enzyme Aval was used for digestion according to Acosta .

Apo A-1 gene -75G/A polymorphism

The specific primers F: 5′AGGGACAGAGCTGATCCTTGAACTCTTAAG3′ and R: 5′TTAGGGGACACCTACCCGTCAGGAAGAGCA3′ were used for amplification, and the restriction enzyme Mspl was used for digestion according to Ordovas .

Apo B-100 gene 2488C/T (XbaI) polymorphism

The specific primers F: 5′GGAGATATTCAGAAGCTAA3′ and R: 5′GAAGAGCCTGAAGACTGACT3′ were used for amplification, and the restriction enzyme XbaI was used for digestion according to Hu .

The data analysis involved the calculation of the allele and genotypic frequencies based on the assumption of the Hardy-Weinberg principle. Moreover, either the chi-square (Ji 2) or he Fisher’s exact test was applied to establish the association between genetic polymorphisms and preeclampsia based on p <0.05 and odds ratio (OR). We used IBM SPSS version 22.0, Arlequin version 3.5.2, and a genetic association software in our analysis.

Results

Adding all the participants of the preeclampsia projects between 2012 and 2017, 450 pregnant women were contacted, 22 of whom were excluded because of the following reasons: unmet inclusion criteria for either group, incomplete data, presence of a relevant disease, clotting of blood samples, unwillingness to participate, or failed sample amplification.

The results of allele and genotype frequencies, for the Hardy-Weinberg equilibrium, and for the association and statistical significance are presented in Table 2.

Table 2

Genetic variants in Peruvian pregnant women with preeclampsia and controls.

Gene	Genotypes and alleles	Preeclampsia	Controls	OR	95% CI	p a
		n (%)	n (%)
VEGF +936 C/T	CC	19 (42.2)	19 (38.8)	Reference		0.062
	CT	12 (26.7)	23 (46.9)	0.523	0.203-1.341
	TT	14 (31.1)	7 (14.3)	2.000	0.661-6.056
	C	50 (55.6)	61 (62.2)	Reference		0.434
	T	40 (44.4)	37 (37.8)	1.319	0.736-2.362
	GG	7 (17.0)	15 (33.3)	Reference		0.256
+405 G/C	GC	27 (69.2)	24 (53.4)	2.411	0.842-6.904
	CC	5 (12.8)	6 (13.3)	1.786	0.403-7.906
	G	41 (52.6)	54 (60.0)	Reference		0.356
	C	37 (47.4)	36 (40.0)	1.354	0.734-2.498
	CC	4 (20.0)	13 (33.3)	Reference		0.004
	CG	7 (35.0)	23 (59.0)	0.989	0.243-4.028
IL6 -174 G/C	GG	9 (45.0)	3 (7.7)	9.750	1.744- 54.525
	C	15 (37.5)	49 (62.8)	Reference		0.011
	G	25 (62.5)	29 (37.2)	2.816	1.281-6.191
	CC	30 (61.2)	29 (58.0)	Reference		0.946
	CT	18 (36.7)	20 (40.0)	0.870	0.385-1.968
IL1B -511 C/T	TT	1 (2.1)	1 (2.0)	0.967	0.058-16.192
	C	78 (79.6)	78 (78.0)	Reference		0.863
	T	20 (20.4)	22 (22.0)	0.909	0.460-1.798
	GG	13 (27.7)	12 (26.7)	Reference		0.832
	GA	23 (48.9)	20 (44.4)	1.062	0.396-2.849
APOA1 -75 G/A	AA	11 (23.4)	13 (28.9)	0.781	0.254-2.400
	G	49 (52.1)	44 (48.9)	Reference		0.768
	A	45 (47.9)	46 (51.1)	0.878	0.493-1.566
	X-X- (CC)	28 (59.6)	25 (55.6)	Reference		0.676
APOB100	X- X+ (CT)	12 (25.5)	15 (33.3)	0.714	0.282-1.813
2488 C/T (XbaI)	X+X+ (TT)	7 (14.9)	5 (11.1)	1.250	0.352-4.442
	X-	68 (72.3)	65 (72.2)	Reference		0.883
	X+	26 (27.7)	25 (27.8)	0.994	0.521-1.896

The genotype frequencies of the +936 C/T and +405 G/T variants of the VEGF gene and of the 2488 C/T (XbaI) polymorphism of the APOB100 gene in women with preeclampsia were in Hardy-Weinberg disequilibrium. a According to chi-square test or Fisher’s exact test.

The genotypic frequencies of the VEGF +936C/T and +405G/C polymorphisms in controls were found to be in Hardy-Weinberg equilibrium; however, in cases they were in disequilibrium, indicating the influence of other factors.

No association was found between genotypes and alleles of the VEGF +936 C/T polymorphism and preeclampsia (p= 0.062 and p= 0.434). The differences between genotypic and allelic frequencies of the VEGF +405 polymorphism in cases and controls were not significant (p= 0.256 and p= 0.356). However, we would like to highlight that the proportions of heterozygous GC (69.2%) and C allele (47.4%) were higher in the preeclamptic women than in the control.

As regards the allelic and genotypic frequencies of the IL-6 -174 G/C polymorphism, in Hardy-Weinberg equilibrium, showed different distribution patterns between the preeclamptic women and the controls. Under a codominant model, the GG genotype (OR= 9.750, IC 95%: 1.744-54.525, p= 0.004, with CC genotype as reference) and the G allele (OR= 2.816, IC 95%: 1.281-6.191, p= 0.011, with C allele as reference) are considered to be at risk and with significant differences, wherein the frequencies were higher in the cases than in the controls.

Regarding the -511C/T polymorphism of the IL-1β gene, no significant differences were found in the frequencies of the TT and CT+CC genotypes between the cases and the controls (p >0.946). The homozygous TT was the most frequent genotype (over 50%) in both groups. For the C and T alleles, the differences were not significant (p= 0.863).

The genotypic frequencies of the ApoA-1 -75G/A polymorphism in cases and controls were in Hardy-Weinberg equilibrium, as were the controls for the ApoB100 2488C/T (XbaI) polymorphism; however, preeclamptic pregnant women were in disequilibrium. Overall, genotype and allele frequencies for both ApoA-1 -75G/A and ApoB100 2488C/T (XbaI) polymorphisms, between cases and controls, did not show significant differences (p >0.05) and were not associated with preeclampsia.

Discussion

The cause of preeclampsia remains unknown, and no methods can prevent or treat this disease. Moreover, this obstetric complication may appear unexpectedly in any pregnant woman .

An association was observed between preeclampsia and family history of pregnant women, and a genetic factor is considered to be involved in its origin. Until 2012, 178 genes associated with preeclampsia had been described . In 2014, from among over 22 million PubMed records, 28,000 articles related to preeclampsia were found, including 729 articles about 535 genes and genetic variants with a “significant” association with preeclampsia .

Specific gene polymorphisms, including angiogenic and antiangiogenic factor genes, have been described in pregnant women with preeclampsia. One angiogenic factor is VEGF, which plays a crucial role in vasculogenesis and vascular permeability. It is usually expressed at optimal levels following an adequate blastocyst placentation ,. VEGF is genetically regulated; some allelic variations of which are possibly associated with preeclampsia, and some of its polymorphisms function as hypoxia-induced factors that play a role in preeclampsia . When placentation is defective, such as in preeclampsia and IUGR, VEGF levels are low . A decrease in VEGF levels may result in placental oxidative stress . Studies have attempted to determine the relationship between VEGF polymorphisms and preeclampsia ,, and some studies have associated these polymorphisms with endothelial dysfunction ,, preeclampsia severity , or HELLP syndrome . The association of some VEGF gene polymorphisms , such as +936C/T, with preeclampsia has also been reported ,.

However, no association of the VEGF +936C/T and +405G/C polymorphisms with preeclampsia was observed in the studied Peruvian pregnant women (p= 0.062 for +936C/T and p= 0.256 for +405G/C). In the +936C/T polymorphism, the mutant homozygous genotype TT was more frequent in the cases, whereas the heterozygous CT genotype was more frequent in the controls. The differences in the frequencies of C and T alleles in the cases and controls were not significant (p= 0,434), for the genotypes as well, but close to the limits of significance (p=0,062). In terms of the VEGF +405 polymorphism, the proportions of heterozygous GC (69.2%) and C allele (47.4%) were higher in the preeclamptic women than in the controls.

Some studies, such as those of Shim and Papazoglou , have reported an association between VEGF polymorphisms and preeclampsia. By contrast, other researchers have found no association of preeclampsia with VEGF +936C/T polymorphism ; with +813C allele ; with VEGF rs699947, rs1570360, rs2010963, and rs25648 minor alleles ; with eNOS and DDAH genes ; and with VEGF -2578C/A, -634G/C, and 936C/T alleles. The 936C/T allele has been associated only with severe preeclampsia . In Latin America, Sandrim et al., have found an association of the − C2578A, -1154G, and -634C haplotypes with preeclampsia prevention, and a similar association with the C-2578A allele was found by Cunha et al. ; both studies were conducted in Brazil. However, in Ecuador, Sandrim’s group has not found such an association with VEGF C2578A and G634C in the same way that Chedraui et al. , have not found the said association with the VEGF -2578 C/A, -1498 C/T, -1154 A/G, -634 C/G, and -936C/T polymorphisms .

Alterations in inflammatory cytokine and lipid profiles have been associated with the presence and severity of hypertensive disorders of pregnancy ,. Cytokines are proteins secreted by innate or adaptive immune cells, many of the functions of which are mediated by cytokines . The placenta expresses various pro- and anti-inflammatory cytokines, adipokines, and cytokine-like angiogenic growth factors. However, their production of these markers is altered in preeclampsia, at least partially due to hypoxia. It is postulated that endothelial dysfunction underlies the disease manifestations of preeclampsia . Endothelial cell activation seems related to impaired maternal immune response, placental ischemia , oxidative stress, and generation of inflammatory cytokines.

One class of cytokines are ILs, which modify biological responses. The cytokines involved in the pathophysiology of preeclampsia ,, include IL-6 , IL-1β -, IL-17, and IL-35 . Increased stress during pregnancy is a predictor of an elevated production of IL-1β and IL-6 pro-inflammatory cytokines by lymphocytes during the third trimester. This alteration in the cell function of the immune system increases the risk of preeclampsia and preterm delivery . Moreover, having a female fetus is associated with low levels of pro-inflammatory IFNγ and IL-12 cytokines in the first trimester and with increased levels of pro-inflammatory IL-1β and TNFβ, anti-inflammatory IL-4r, and regulatory IL-5 and IL-10 cytokines in the second trimester . Fetal sex is thus related to the variability in cytokine levels.

IL-6 is a cytokine produced by many innate immune cells, neutrophils, and monocytes/macrophages, and it is expressed during states of cellular stress, such as inflammation, infection, wound, and cancer . IL-6 is an important mediator of acute-phase immune response and of trophoblast proliferation, invasion, and differentiation ,. Studies have suggested that the IL-6 -174 promoter polymorphism is a major genetic regulator in the etiology of early-onset preeclampsia -. A systematic review that included 73 articles and analyzed 57 unique markers has found that the proinflammatory markers IL-6, IL-8, and tumor necrosis factor alpha have garnered the most support as the potential inflammatory markers for the clinical surveillance of preeclampsia, particularly during the second and third trimesters .

However, conflicting results in relation to the role of circulating IL-6 in preeclampsia have been found . In Latin America, the Brazilian study conducted by Pinheiro et al. , has found an association of the IL-6 -174G/C allele with protection for preeclampsia; however, another Brazilian study conducted by Daher et al. , and a Mexican study by Valencia et al. , have found no association of this allele with the risk of preeclampsia. Our study on the -174G/C polymorphism of the IL-6 gene showed an association of preeclampsia risk with the GG genotype and the G allele in the preeclamptic Peruvian women. However, these results must be verified in a larger population.

IL-1 is secreted by macrophages, endothelial cells, and some epithelial cells, and it activates endothelial cell inflammation and coagulation. IL-1β gene polymorphisms have been associated with preeclampsia ,, preterm birth , and recurrent pregnancy loss . In their Brazilian study, Leme et al. , have found an association of preeclampsia risk with the IL-1β rs1143630 T allele, while Pontillo et al. , who also conducted their study in Brazil, have found no association of IL1β rs1143634 with preeclampsia risk, a finding similar to that of other studies . The -511 C/T polymorphism in the IL-1β gene promoter region is implicated in the differential production of cytokines. Moreover, it may be associated with the immune inflammatory response in obesity, dyslipidemia, cardiopathy, cancer, infections, and treatment with nutrients and drugs. The IL-1β gene -511C/T polymorphism has also been studied in Peruvian Mestizo, Amazonian, and Andean subpopulations , and the T mutant allele associated with an increased cytokine production was frequently observed in these subpopulations. In our study, no significant difference in frequency distribution of the IL-1β gene -511C/T polymorphism TT and CT+CC genotypes between cases (n= 49) and controls (n= 50) was found.

Plasma lipoprotein metabolism is regulated and controlled by the specific apolipoproteins (apo-), constituents of the various lipoprotein classes . Apolipoproteins regulate protein metabolism by transporting and redistributing lipids to cells and tissues. Lipoprotein A (LpA) is a low-density lipoprotein (LDL) particle modified with an apolipoprotein A (Apo A-1), the main component of the structural particles of high-density lipoprotein (HDL), which exhibits anti-inflammatory properties, inhibits LDL oxidation, and clears up excess cholesterol from macrophages ,. Apo A-1 also protects the trophoblast-endothelial cell integration in the presence of a pro-inflammatory stimulus. Women with preeclampsia have low Apo A-1 levels, which deter their ability to control LDL and inflammation ,. Apo B-100 represents the Apo B particles circulating in the body, and it is an LDL. The Apo B-100/Apo A-1 quotient has been proposed as a reliable parameter used to predict atherosclerosis and mortal events resulting from cardiovascular disease that is linked to lipid alterations .

Apo A-1 concentrations have been found to increase in normal pregnancy and to decrease in women with preeclampsia ; thus, Apo A-1 concentrations are an important risk factor for atherosclerosis among preeclamptic women . Other researchers have found lower levels of Apo A-1 only in patients with severe preeclampsia . Apo B is considered a measure of atherogenic lipoproteins, and it can be used to predict the risk of atherosclerotic cardiovascular disease . However, no difference in Apo A-1 and Apo B levels was observed between preeclamptic and normal pregnant women ,. In our study on Apo A-1 and Apo B-100 genes, no significant differences in genotypes and alleles were found between the women with severe preeclampsia and the controls.

A higher Apo B/Apo A-1 ratio has been associated with an increased risk of preeclampsia . Timur et al. , have reported that preeclamptic patients display significantly low Apo A-1 levels and a high Apo B-100/Apo A-1 ratio and that they consider these parameters as useful markers. By contrast, Kharb et al. , have found that the serum and cord blood Apo A-1 and Apo B levels were lower in preeclamptic women than in normotensive pregnant women. We have found controversies in the literature regarding the levels of Apo A-1 and Apo B-100 and regarding the possible association of the Apo A-1/Apo B-100 ratio with preeclampsia. Nevertheless, studies have found an association of these gene polymorphisms with cardiovascular disease , dyslipidemia , osteonecrosis , and other disorders.

In this study, the Hardy-Weinberg disequilibrium of the genotype frequencies of the two polymorphisms of the VEGF gene as well as of the Apo B-100 gene in preeclamptic women may indicate population admixture and/or specific characteristics of the patients. However, the lack of association with preeclampsia was corroborated by the Armitage trend test, the result of which is valid even when the frequencies depart from the Hardy-Weinberg equilibrium.

The search for susceptibility genes has led to a drastic increase in the number of published studies associating genetic factors with preeclampsia. However, attempts to replicate the findings of these studies have produced inconsistent results, except for the genes ACE, CTLA4, F2, FV, LPL, and SERPINE1 .

Conclusions

The present study analyzed polymorphisms related to endothelial function, angiogenesis, immunological and inflammatory processes, and metabolic syndrome in Peruvian preeclamptic women. No association was found between the genetic markers studied and preeclampsia. However, the -174G/C polymorphism in the IL-6 gene presented significant differences mainly for the GG genotype and the G allele, whose frequencies were higher in the cases with respect to the controls; according to OR calculations, they would be risk factors. The limitation of the study of this polymorphism is the number of case samples (n=20), which should be a stimulus for further studies.

The contradictory results of the work can be partially explained by the genetic composition of the Peruvian population. Lima, the Peruvian city where the study was carried out, has a mixed population, characterized by a high Amerindian component, around 70%, and by European, Asian and African ancestry . Therefore, genetic ancestry and other variables, such as the sex of the fetus, can be considered in future research.

The present study contributes to a better understanding of the genetics of preeclampsia in Peru. Further research is needed to include larger populations of pregnant women and other Peruvian regions, as well as to comprise additional genes related to preeclampsia, a polygenic disorder.

Contribución del estudio

Introducción

La hipertensión es la complicación médica más frecuente del embarazo , y la presentación clínica más grave de los trastornos hipertensivos del embarazo es la preeclampsia, una condición que se asocia de modo significativo con la morbilidad y mortalidad materna y perinatal.

La preeclampsia es la principal causa de muerte materna en el mundo occidental. Se trata de un trastorno multiorgánico que implica la ocurrencia de hipertensión de aparición de novo (>140/90 mmHg) y proteinuria en mujeres con al menos 20 semanas de embarazo . La presentación clínica y la dinámica de la preeclampsia son variables; por ejemplo, no siempre se encuentra la hipertensión y la proteinuria . Cuando no se presenta la proteinuria, el diagnóstico de preeclampsia se basa en la aparición de hipertensión acompañada de un recuento bajo de plaquetas (por debajo de 100,000/mL), alteración de la función hepática (indicada por niveles séricos de transaminasas del doble de las concentraciones normales), insuficiencia renal (señalada por niveles séricos de creatinina superiores a 1,1 mg/dL o por niveles séricos de creatinina del doble de los presentes en la función renal normal), edema pulmonar o presentación de novo de alteraciones cerebrales o visuales .

La preeclampsia afecta a 3 a 8% de las mujeres embarazadas, dependiendo de la población y la región en estudio y de la definición de preeclampsia que se utilice ,. En Perú, la incidencia de preeclampsia es más del 10% en varias regiones y causa el 22% de las muertes maternas.

Los factores comunes asociados al desarrollo de la preeclampsia en los países desarrollados son la obesidad, la resistencia a la insulina y la hiperlipidemia, mientras que en los países en vías de desarrollo los factores asociados son la procedencia étnica, los malos hábitos nutricionales, las infecciones subclínicas y otras características socioeconómicas .

La etiología de la preeclampsia todavía se desconoce. Sin embargo, se ha descubierto que factores genéticos provocan una adaptación inmunitaria defectuosa , que conduce a la invasión inadecuada del trofoblasto y al desarrollo inapropiado de la placenta. La infiltración anormal del citotrofoblasto endometrial genera trastornos arteriales, como la pérdida de elasticidad que afecta la remodelación vascular y perjudica el suministro de sangre al feto ,. Como resultado, se desarrollan isquemia e hipoxia placentarias, así como estrés oxidativo y endoteliosis , que comprometen la placenta e importantes órganos y sistemas maternos. El estrés oxidativo estimula al sincitiotrofoblasto a liberar citoquinas proinflamatorias, exosomas, factores antiangiogénicos y ADN fetal libre en la circulación materna ,.

Las complicaciones pueden surgir en cualquier momento del embarazo, con frecuencia de forma subrepticia y grave. Antes del desarrollo clínico de la enfermedad, se produce vasoespasmo, se activa la cascada de coagulación y se reduce el volumen plasmático. Los efectos son más perjudiciales cuando la preeclampsia aparece de forma precoz, y de esta forma se produce una restricción del crecimiento intrauterino (RCIU) y se puede ocasionar prematuridad .

Además, se acelera la senescencia de la placenta , aumenta en sangre materna la concentración de citoquinas proinflamatorias, ADN fetal libre, leptina, restos apoptóticos de la placenta y tirosina quinasa soluble tipo fms (sFLT1), mientras disminuyen los niveles del factor de crecimiento placentario (PlGF) .

No existe método que pueda predecir la aparición de la preeclampsia, y no hay cura para esta afección, salvo el nacimiento del feto y la placenta. La preeclampsia suele resolverse poco después del parto. Sin embargo, los estudios epidemiológicos asocian a la preeclampsia con trastornos metabólicos, cardiovasculares y cerebrales ,- que aparecerán más tarde en la madre y el niño y, en perspectiva, pueden tener gran impacto en la discapacidad y el gasto en salud pública -.

Los estudios de epidemiología genómica y genética han encontrado una asociación entre la preeclampsia y ciertos genes ,, polimorfismos y otros marcadores moleculares e inflamatorios ,,,. Por lo tanto, la detección de estos biomarcadores en una fase temprana de la gestación nos permitirá predecir y manejar adecuadamente la preeclampsia.

En la placenta se producen varias proteínas pro y antiangiogénicas desde el inicio del embarazo; estas sustancias desempeñan un papel en la disfunción endotelial y el riesgo de presentación de la preeclampsia ,. Los factores angiogénicos más importantes , son el factor de crecimiento endotelial vascular (VEGF) y el factor de crecimiento placentario (PGF) . Las sustancias antiangiogénicas se expresan abundantemente en la preeclampsia y causan disfunción y daño en las células endoteliales maternas ,,, lo que tiene consecuencias negativas para la madre y el feto. Los genes que codifican los factores antiangiogénicos importantes incluyen el gen del factor soluble similar a la tirosinasa (sFLT-1), el gen del VEGF tirosina quinasa soluble similar al Fms -1 (VEGFR-1) y los polimorfismos del gen de la endotelina-1 ,.

Debido a la alta prevalencia de preeclampsia en el Perú y considerando que el estrés oxidativo induce al sincitiotrofoblasto a liberar citoquinas proinflamatorias, exosomas, factores antiangiogénicos y ADN fetal libre en la circulación materna ,, se consideró necesario investigar biomarcadores en mujeres peruanas preeclámpticas y determinar su utilidad para predecir, prevenir y manejar la preeclampsia. Esta investigación evalúa en mujeres peruanas preeclámpticas y gestantes sin preeclampsia, los polimorfismos genéticos VEGF +936 C/T y 405 +G/C, IL-6 -174 G/C, IL-1B -511C/T , ApoA-1 -75 G/A y ApoB-100 XbaI . Nuestros hallazgos aumentan nuestro conocimiento sobre los factores genéticos asociados a la preeclampsia, un tema de investigación emergente en el Perú.

Materiales y Métodos

Este estudio es observacional y asociativo tipo casos y controles, realizado entre 2012 y 2018. Las instituciones participantes fueron el Instituto de Investigaciones Clínicas y el Centro de Investigación en Bioquímica y Nutrición de la Facultad de Medicina y la Facultad de Farmacia y Bioquímica de la Universidad Nacional de San Marcos, Lima, Perú. Las gestantes fueron enroladas en el Hospital Docente Madre-Niño San Bartolomé, institución pública administrada por el Ministerio de Salud del Perú.

Se definió como preeclámptica a la gestante con presión arterial de >140/90 mmHg y proteinuria de ≥300 mg/24 h (>1+ con tira reactiva), según la clasificación de la Federación Internacional de Ginecología y Obstetricia, actualizada en el año 2000 .

El método de muestreo fue no probabilístico (por conveniencia). Los criterios de inclusión para el grupo de preeclampsia fueron los siguientes: gestantes de ≥18 años de edad con diagnóstico de preeclampsia grave en la segunda mitad del embarazo, confirmada por datos clínicos y de laboratorio, y que habían firmado un consentimiento informado. Se excluyeron las gestantes sin proteinuria o con hipertensión crónica, diabetes y otras condiciones médicas, así como las que tenían información incompleta. Para el grupo de control, los criterios de inclusión fueron los siguientes: gestantes de ≥18 años de edad, aparentemente sanas, sin preeclampsia y sin enfermedades relevantes y que firmaron el consentimiento informado. La Tabla 1 presenta el número de casos y controles estudiados para cada polimorfismo genético.

Tabla 1

Número de mujeres preeclámpticas y controles incluidas en el estudio.

Gen	Polimorfismo	Preeclampsia	Controles	Total
VEGF	+936 C/T	45	49	94
	+405 G/C	39	45	84
IL-6	-174 G/C	20	39	59
IL1β	-511 C/T	49	50	99
Apo A-1	-75 G/A	47	45	92
Apo B-100	2 488 C/T (Xbal)	47	45	92

Se obtuvo la aprobación del protocolo de investigación por parte del Comité de Ética de la Facultad de Medicina de la Universidad Nacional de San Marcos y del comité de ética del hospital participante. Se llenó una ficha clínica ad hoc con los datos de la madre y del recién nacido. Se obtuvo el consentimiento informado firmado por cada participante. Se extrajo muestras de sangre (5 mL) de la vena antecubital de las participantes, que fueron conservadas en un refrigerador y después transportadas al laboratorio. Se extrajo el ADN de las muestras de sangre usando kits comerciales y luego se determinaron los genotipos y alelos de los genes investigados.

Los datos maternos ingresados a la ficha ad hoc fueron los siguientes: edad, estado civil, estatura, peso, antecedentes médicos personales (hipertensión, preeclampsia previa, diabetes mellitus, neuropatía, cardiopatía y síndrome metabólico), antecedentes médicos familiares (hipertensión, diabetes mellitus, obesidad, síndrome metabólico y otras afecciones), número de embarazos, partos prematuros, recién nacidos de peso bajo, niveles de hemoglobina, tipo de parto, edad gestacional en el momento del parto y estancia hospitalaria (en días). Los datos de los recién nacidos fueron: peso, puntuaciones de Apgar a 1 y 5 minutos, edad gestacional, complicaciones (sufrimiento fetal, distrés respiratorio y asfixia perinatal), RCIU, prematuridad, síndrome de dificultad respiratoria, ictericia, infección, muerte fetal, muerte neonatal, malformaciones y estancia hospitalaria (en días).

Para el análisis genético molecular se utilizó la técnica PCR-RFLP, empleándose protocolos específicos para cada gen y garantizándose las condiciones óptimas de laboratorio. Los genotipos referenciales de los polimorfismos fueron confirmados por secuenciamiento automático de Sanger.

Polimorfismos VEGF +936C/T y +405G/C

Para la amplificación de +936C/T se utilizaron los cebadores específicos F: 5'AAGGAAGGAGACTCTGCGCAGAGC3' y R: 5'TAAATGTATGTATGTGGGTTCTAGG3', y para la digestión se usó la enzima NlaIII según el protocolo de Papazoglou . Para la amplificación de +405G/C se utilizaron los cebadores F: 5'CCGACGGCTTGGGA GATTGCTC3' y R: 5'CGGCGTCACCCAAAAGCAG3' y la enzima BsmFI para la digestión, según protocolos de Banyasz y Garza-Veloz .

Polimorfismo IL-6 -174G/C

Para la amplificación se usaron los cebadores específicos F: 5'TGACTTCAGCTTTAC TCTTTGT'3 y R: 5'CTGATTGGAAACCTTATTAGG'3 para la amplificación, y la enzima de restricción SfaNI para la digestión, según Berthold . En la Figura 1 se reportan los genotipos GG y GC obtenidos por PCR-RFLP y el secuenciamiento de Sanger.

Figura 1

Determinación de los genotipos del polimorfismo -174 G/C en el gen IL6. Izquierda: geles de agarosa con genotipos homocigotos GG (140 y 58 bp) y heterocigotos GC (198, 140 y 58 bp) determinados por PCR-RFLP con SfaNI como enzima de restricción . Derecha: cromatogramas obtenidos por secuenciamiento automático de Sanger que confirman los genotipos GG y CC (marcados con flechas).

Polimorfismo IL1 -511C/T

Para la amplificación se utilizaron los cebadores específicos F: 5′TGGCATTGATCTGGTTCATC3′ y R: 5′GTTTAGGAATCTTCCCACTT3', y para la digestión, la enzima de restricción Aval según Acosta .

Polimorfismo Apo A-1 -75G/A

Para la amplificación se usaron los cebadores específicos F: 5′AGGGACAGCTGATCCTTGAACTCTTAAG3′ y R: 5′TTAGGGACCTACCCGTCAGGAAGCA3′, y para la digestión, la enzima de restricción Mspl según Ordovas .

Polimorfismo Apo B-100 2488C/T (XbaI)

Para la amplificación se utilizaron los cebadores específicos F: 5′GGAGATATTCAGAAGCTAA3′ y R: 5′GAAGCCTGAAGACTGACT3′, y para la digestión, la enzima de restricción XbaI según Hu .

Los datos fueron analizados mediante el cálculo de las frecuencias alélicas y genotípicas bajo el principio de equilibrio de Hardy-Weinberg. Después se aplicó la prueba de Ji 2 o la prueba exacta de Fisher para establecer la asociación entre los polimorfismos genéticos y la preeclampsia, considerando un p<0.05 y estableciendo el riesgo mediante el odds ratio (OR). Se utilizaron los programas IBM SPSS v22, Arlequín v3.5.2 y de asociación genética.

Resultados

Las participantes de los proyectos de preeclampsia entre los años 2012 y 2017 fueron en total 450, siendo excluidas 22 gestantes por las siguientes razones: criterios de inclusión no cumplidos para cualquiera de los dos grupos, datos incompletos, presencia de una enfermedad relevante, coagulación de las muestras de sangre, falta de voluntad para participar o falta de amplificación de la muestra.

Los resultados de las frecuencias alélicas y genotípicas, equilibrio de Hardy-Weinberg, asociación estadística y odds ratio se presentan en la Tabla 2.

Tabla 2

Variantes genéticas en gestantes peruanas con preeclampsia y controles.

Gen	Genotipos y alelos	Preeclampsia	Controles	OR	95% CI	p a
		n (%)	n (%)
VEGF +936 C/T	CC	19 (42.2)	19 (38.8)	Reference		0.062
	CT	12 (26.7)	23 (46.9)	0.523	0.203-1.341
	TT	14 (31.1)	7 (14.3)	2.000	0.661-6.056
	C	50 (55.6)	61 (62.2)	Reference		0.434
	T	40 (44.4)	37 (37.8)	1.319	0.736-2.362
	GG	7 (17.0)	15 (33.3)	Reference		0.256
+405 G/C	GC	27 (69.2)	24 (53.4)	2.411	0.842-6.904
	CC	5 (12.8)	6 (13.3)	1.786	0.403-7.906
	G	41 (52.6)	54 (60.0)	Reference		0.356
	C	37 (47.4)	36 (40.0)	1.354	0.734-2.498
	CC	4 (20.0)	13 (33.3)	Reference		0.004
	CG	7 (35.0)	23 (59.0)	0.989	0.243-4.028
IL6 -174 G/C	GG	9 (45.0)	3 (7.7)	9.750	1.744- 54.525
	C	15 (37.5)	49 (62.8)	Reference		0.011
	G	25 (62.5)	29 (37.2)	2.816	1.281-6.191
	CC	30 (61.2)	29 (58.0)	Reference		0.946
	CT	18 (36.7)	20 (40.0)	0.870	0.385-1.968
IL1B -511 C/T	TT	1 (2.1)	1 (2.0)	0.967	0.058-16.192
	C	78 (79.6)	78 (78.0)	Reference		0.863
	T	20 (20.4)	22 (22.0)	0.909	0.460-1.798
	GG	13 (27.7)	12 (26.7)	Reference		0.832
	GA	23 (48.9)	20 (44.4)	1.062	0.396-2.849
APOA1 -75 G/A	AA	11 (23.4)	13 (28.9)	0.781	0.254-2.400
	G	49 (52.1)	44 (48.9)	Reference		0.768
	A	45 (47.9)	46 (51.1)	0.878	0.493-1.566
	X-X- (CC)	28 (59.6)	25 (55.6)	Reference		0.676
APOB100	X- X+ (CT)	12 (25.5)	15 (33.3)	0.714	0.282-1.813
2488 C/T (XbaI)	X+X+ (TT)	7 (14.9)	5 (11.1)	1.250	0.352-4.442
	X-	68 (72.3)	65 (72.2)	Reference		0.883
	X+	26 (27.7)	25 (27.8)	0.994	0.521-1.896

Las frecuencias genotípicas de las variantes +936 C/T y +405 G/T del gen VEGF y del polimorfismo 2488 C/T (XbaI) en el gen APOB100 en gestantes preeclámpticas se encontraron en desequilibrio de Hardy-Weinberg. a Según la prueba de Ji 2 o la prueba exacta de Fisher

Las frecuencias genotípicas de los polimorfismos VEGF +936C/T y +405G/C en los controles se encontraron en equilibrio de Hardy-Weinberg; sin embargo, en los casos estuvieron en desequilibrio, lo que indica la influencia de otros factores.

No se halló asociación entre los genotipos y alelos del polimorfismo VEGF +936 C/T y la preeclampsia (p= 0.062 y p= 0.434). Las diferencias entre las frecuencias genotípicas y alélicas del polimorfismo VEGF +405 en los casos y controles, no fueron significativas (p= 0.256 y p= 0.356), Sin embargo, se destaca que las proporciones de heterocigotos GC (69.2%) y del alelo C (47.4%) fueron mayores en las mujeres preeclámpticas respecto a los controles.

Respecto al polimorfismo IL6 -174 G/C, las frecuencias alélicas y genotípicas, en equilibrio de Hardy-Weinberg, mostraron patrones de distribución diferentes entre las mujeres preeclámpticas y los controles. Bajo un modelo codominante, se consideran de riesgo y con diferencias significativas, el genotipo GG (OR= 9.750, IC 95%: 1.744-54.525, p= 0.004, con el genotipo CC como referencia) y el alelo G (OR= 2.816, IC 95%: 1.281-6.191, p= 0.011, con el alelo C como referencia), siendo las frecuencias mayores en los casos.

En lo referente al polimorfismo IL-1β -511C/T, no se encontraron diferencias significativas en las frecuencias de los genotipos TT y CT+CC entre los casos y los controles (p> 0.946). El CC homocigoto fue el genotipo más frecuente (más del 50%) en ambos grupos. Para los alelos C y T, igualmente, las diferencias no fueron significativas (p= 0.863).

Las frecuencias genotípicas del polimorfismo ApoA-1 -75G/A en los casos y controles se encuentran en equilibrio de Hardy-Weinberg, así como los controles para el polimorfismo ApoB100 2488C/T (XbaI); sin embargo, las gestantes preeclámpticas estuvieron en desequilibrio. En general, las frecuencias de los genotipos y alelos para ambos polimorfismos ApoA-1 -75G/A y ApoB100 2488C/T (XbaI), entre los casos y controles, no presentaron diferencias significativas (p >0.05) y no estuvieron asociados con la preeclampsia.

Discusión

La causa de la preeclampsia sigue siendo desconocida y no hay métodos para prevenir o tratar esta enfermedad. Además, esta complicación obstétrica puede aparecer de forma inesperada en cualquier mujer embarazada .

Se ha observado una asociación entre la preeclampsia y los antecedentes familiares de las embarazadas, y se considera que un factor genético está implicado en su origen. Hasta 2012 se habían descrito 178 genes asociados a la preeclampsia . En 2014, entre más de 22 millones de registros de PubMed se encontraron 28,000 artículos relacionados con la preeclampsia, incluyendo 729 artículos que se referían a 535 genes y variantes genéticas con asociación ‘significativa’ con la preeclampsia .

Se han descrito polimorfismos genéticos específicos, incluyendo genes de factores angiogénicos y antiangiogénicos, en gestantes con preeclampsia. Un factor angiogénico es el VEGF, que desempeña un papel crucial en la vasculogénesis y la permeabilidad vascular. Suele expresarse en niveles óptimos tras una adecuada placentación del blastocisto ,. El VEGF está regulado genéticamente; algunas de sus variaciones alélicas están posiblemente asociadas a la preeclampsia y algunos de sus polimorfismos funcionan como factores inducidos por la hipoxia que desempeñan un papel en la preeclampsia . Cuando la placentación es defectuosa, como en la preeclampsia y el RCIU, los niveles de VEGF son bajos . La disminución de los niveles de VEGF puede provocar estrés oxidativo en la placenta . Los estudios han intentado determinar la relación entre los polimorfismos del VEGF y la preeclampsia ,, y algunos han asociado estos polimorfismos con la disfunción endotelial ,, la gravedad de la preeclampsia o el síndrome HELLP . También se ha informado de la asociación de algunos polimorfismos del gen VEGF , como el +936C/T, con la preeclampsia ,.

En el presente estudio, sin embargo, no se ha observado asociación de los polimorfismos del VEGF +936C/T y +405G/C con la preeclampsia en las embarazadas peruanas (p=0,062 para +936C/T y p= 0.256 para +405G/C). En el polimorfismo +936C/T, el genotipo homocigoto TT mutante fue más frecuente en los casos, mientras que el genotipo heterocigoto CT fue más frecuente en los controles. Las diferencias en las frecuencias de los alelos C y T en los casos y los controles no fueron significativas (p= 0.434), igualmente para los genotipos, pero cercano al límite de la significancia (p= 0.062). En cuanto al polimorfismo VEGF +405, las proporciones de heterocigotos GC (69.2%) y del alelo C (47.4%) fueron mayores en las mujeres preeclámpticas que en los controles.

Algunos estudios, como los de Shim y Papazoglou , han informado de una asociación entre los polimorfismos del VEGF y la preeclampsia. En cambio, otros investigadores no han encontrado asociación de la preeclampsia con el polimorfismo del VEGF +936C/T , con el alelo +813C , con los alelos menores del VEGF rs699947, rs1570360, rs2010963 y rs25648 , con los genes eNOS y DDAH , y con los alelos del VEGF -2578C/A, -634G/C y 936C/T. El alelo 936C/T se ha asociado únicamente con la preeclampsia grave . En América Latina, Sandrim et al. han encontrado asociación de los haplotipos - C2578A, -1154G y -634C con la prevención de la preeclampsia; una asociación similar con el alelo C-2578A fue hallada por Cunha et al. ; ambos estudios fueron realizados en Brasil. Sin embargo, en Ecuador, el grupo de Sandrim no ha encontrado dicha asociación con el VEGF C2578A y G634C, como tampoco Chedraui et al. han hallado dicha asociación con los polimorfismos VEGF -2578 C/A, -1498 C/T, -1154 A/G, -634 C/G, y -936C/T .

Las alteraciones en los perfiles de citoquinas inflamatorias y de lípidos han sido asociadas con la presencia y gravedad de los trastornos hipertensivos del embarazo ,. Las citocinas son proteínas secretadas por las células inmunitarias innatas o adaptativas, muchas de cuyas funciones están mediadas por citocinas . La placenta expresa varias citocinas pro y antiinflamatorias, adipoquinas y factores de crecimiento angiogénicos similares a las citocinas. Sin embargo, la producción de estos marcadores está alterada en la preeclampsia, al menos en parte debido a la hipoxia. Se postula que la disfunción endotelial subyace a las manifestaciones de la preeclampsia . La activación de las células endoteliales parece estar relacionada con el deterioro de la respuesta inmunitaria materna, la isquemia placentaria , el estrés oxidativo y la generación de citoquinas inflamatorias .

Una clase de citoquinas son las interleucinas (IL), que modifican las respuestas biológicas. Las ILs implicadas en la fisiopatología de la preeclampsia ,, incluyen la IL-6 , la IL-1 -, la IL-17 y la IL-35 . El aumento del estrés durante el embarazo es un factor predictivo de una elevada producción de citoquinas proinflamatorias IL-1 e IL-6 por parte de los linfocitos durante el tercer trimestre. Esta alteración de la función celular del sistema inmunitario aumenta el riesgo de preeclampsia y de parto prematuro . Además, tener un feto de sexo femenino se asocia con niveles bajos de citoquinas proinflamatorias IFNγ e IL-12 en el primer trimestre y con niveles mayores de citoquinas proinflamatorias IL-1β y TNFβ, antiinflamatorias IL-4r y reguladoras IL-5 e IL-10 en el segundo trimestre . Así pues, el sexo del feto está relacionado con la variabilidad de los niveles de citoquinas.

La IL-6 es una citocina producida por muchas células inmunitarias innatas, neutrófilos y monocitos/macrófagos, y se expresa durante estados de estrés celular, como la inflamación, la infección, la herida y el cáncer . La IL-6 es un importante mediador de la respuesta inmunitaria en fase aguda y de la proliferación, invasión y diferenciación de los trofoblastos ,. Los estudios han sugerido que el polimorfismo del promotor de la IL-6 -174 es un importante regulador genético en la etiología de la preeclampsia de inicio temprano -. Una revisión sistemática que incluyó 73 artículos y analizó 57 marcadores únicos ha encontrado que los marcadores proinflamatorios IL-6, IL-8 y el factor de necrosis tumoral alfa han obtenido el mayor respaldo como los potenciales marcadores inflamatorios para la vigilancia clínica de la preeclampsia, particularmente durante el segundo y tercer trimestre .

En las investigaciones, sin embargo, se han encontrado resultados contradictorios en relación con el papel de la IL-6 circulante en la preeclampsia . En América Latina, el estudio brasileño realizado por Pinheiro et al. , encuentra una asociación de protección del alelo IL-6 -174G/C del riesgo de preeclampsia; sin embargo, otro estudio brasileño realizado por Daher et al. , y un estudio mexicano de Valencia et al. , no hallan la asociación de este alelo con el riesgo de preeclampsia. Nuestro estudio sobre el polimorfismo -174G/C en el gen de la IL-6 mostró una asociación y riesgo para preeclampsia, específicamente para el genotipo GG y el alelo G en las preeclámpticas peruanas. Sin embargo, estos resultados deben ser verificados en una muestra más amplia.

La IL-1 es secretada por los macrófagos, las células endoteliales y algunas células epiteliales, y activa la inflamación de las células endoteliales y la coagulación. Los polimorfismos del gen de la IL-1 han sido asociados con la preeclampsia ,, el parto pretérmino y la pérdida recurrente del embarazo . En su estudio brasileño, Leme et al. , hallaron asociación y riesgo para preeclampsia con el alelo T del SNP rs1143630 del gen IL-1, mientras que Pontillo et al. , en el mismo país, no encontraron asociación del SNP rs1143634 en el gen IL1 con la preeclampsia, un hallazgo similar al de otros estudios . El polimorfismo -511 C/T en la región promotora del gen IL-1β está implicado en la producción diferenciada de citoquinas. Además, puede estar asociado con la respuesta inmune inflamatoria en la obesidad, dislipidemia, cardiopatía, cáncer, infecciones y el tratamiento con nutrientes y fármacos. El polimorfismo IL-1β -511C/T también se ha estudiado en subpoblaciones peruanas mestizas, amazónicas y andinas , observándose una alta frecuencia del alelo mutante T, asociado a una mayor producción de citoquinas. En nuestro estudio, no se encontraron diferencias significativas en la distribución de frecuencias del polimorfismo TT y CT+CC del gen IL-1β entre los casos y los controles.

El metabolismo de las lipoproteínas plasmáticas está regulado y controlado por las apolipoproteínas (apo-) específicas constituyentes de las distintas clases de lipoproteínas . Las apolipoproteínas regulan el metabolismo de las proteínas transportando y redistribuyendo los lípidos a las células y los tejidos. La lipoproteína A (LpA) es una partícula de lipoproteína de baja densidad (LDL) modificada con una apolipoproteína A (Apo A-1), principal componente de las partículas estructurales de la lipoproteína de alta densidad (HDL), que presenta propiedades antiinflamatorias, inhibe la oxidación de las LDL y elimina el exceso de colesterol de los macrófagos ,. La Apo A-1 también protege la integración trofoblasto-célula endotelial en presencia de un estímulo proinflamatorio. Las mujeres con preeclampsia tienen niveles bajos de Apo A-1, lo que disminuye su capacidad de controlar las LDL y la inflamación ,. La Apo B-100 representa las partículas Apo B que circulan en el cuerpo, y es una LDL. Se ha propuesto el cociente Apo B-100/Apo A-1 como un parámetro fiable para predecir la aterosclerosis y los acontecimientos mortales derivados de la enfermedad cardiovascular que se relaciona con alteraciones lipídicas .

Se ha descubierto que las concentraciones de Apo A-1 aumentan en el embarazo normal y disminuyen en las mujeres con preeclampsia ; por lo tanto, las concentraciones de Apo A-1 son un importante factor de riesgo de aterosclerosis entre las mujeres preeclámpticas . Otros investigadores han encontrado niveles más bajos de Apo A-1 solo en pacientes con preeclampsia grave . La Apo B se considera una medida de las lipoproteínas aterogénicas y puede utilizarse para predecir el riesgo de enfermedad cardiovascular aterosclerótica . Sin embargo, no se ha observado diferencias en los niveles de Apo A-1 y Apo B entre las gestantes preeclámpticas y las normales ,. En nuestro estudio sobre los genes Apo A-1 y Apo B-100, no se encontró diferencias significativas entre los genotipos y alelos de las preeclámpticas y los controles.

Una relación Apo B/Apo A-1 más elevada se ha asociado a mayor riesgo de preeclampsia . Timur et al. , han comunicado que las pacientes preeclámpticas presentan niveles de Apo A-1 significativamente bajos y una relación Apo B-100/Apo A-1 elevada, y consideran estos parámetros como marcadores útiles. Por el contrario, Kharb et al. , hallaron que los niveles de Apo A-1 y Apo B en sangre circulante y en sangre del cordón umbilical eran más bajos en las mujeres preeclámpticas que en las gestantes normotensas. Existen reportes contradictorios respecto a los niveles de Apo A-1 y Apo B-100 y la posible asociación de la razón ApoA-1/ApoB-100 con la preeclampsia. No obstante, los estudios han hallado asociación de estos polimorfismos genéticos con la enfermedad cardiovascular , la dislipidemia , osteonecrosis y otros trastornos.

En nuestro estudio, el desequilibrio de Hardy-Weinberg de las frecuencias genotípicas en los polimorfismos VEGF y ApoB-100 en las mujeres preeclámpticas puede indicar mixtura poblacional y/o características específicas de las pacientes. Sin embargo, la falta de asociación de estos polimorfismos con la preeclampsia fue corroborada por la prueba de tendencia de Armitage, cuyo resultado es válido incluso cuando las frecuencias se apartan del equilibrio de Hardy-Weinberg.

La búsqueda de genes de susceptibilidad ha llevado a un aumento drástico del número de estudios publicados que asocian los factores genéticos con la preeclampsia. Sin embargo, los intentos de replicar los hallazgos de estos trabajos han producido resultados inconsistentes, excepto para los genes ACE, CTLA4, F2, FV, LPL y SERPINE1 .

Conclusiones

En el presente estudio se ha analizado polimorfismos relacionados con la función endotelial, la angiogénesis, los procesos inmunológicos e inflamatorios y el síndrome metabólico en mujeres peruanas preeclámpticas. No se ha encontrado asociación entre los marcadores genéticos estudiados y la preeclampsia. Sin embargo, el polimorfismo -174G/C en el gen de la IL-6 presentó diferencias significativas principalmente para el genotipo GG y el alelo G, cuyas frecuencias fueron mayores en los casos respecto a los controles; según los cálculos del OR, serían factores de riesgo. La limitación del estudio de este polimorfismo es el número de muestras de casos (n= 20), lo que debe ser un estímulo para estudios posteriores.

Los resultados contradictorios del trabajo pueden explicarse parcialmente por la composición genética de la población peruana. Lima, la ciudad peruana donde se llevó a cabo el estudio, tiene una población mixta, caracterizada por un alto componente amerindio, en alrededor del 70%, y por ascendencia europea, asiática y africana . Por lo tanto, se puede considerar en futuras investigaciones la ancestría genética y otras variables, como el sexo del feto.

El presente estudio contribuye a una mejor comprensión de la genética de la preeclampsia en el Perú. Es necesario realizar más investigaciones que incluyan poblaciones más grandes de mujeres embarazadas y otras regiones peruanas, así como incluir genes adicionales relacionados con la preeclampsia, un trastorno poligénico.

1) Why was this study conducted?

Preeclampsia is a multiorgan disorder that is significantly associated with maternal and perinatal morbidity and mortality. Preeclampsia is defined by the presence of new-onset hypertension and proteinuria in women who are at least 20 weeks pregnant. The etiology of preeclampsia remains unknown; its clinical presentation and dynamics vary, and no method can predict its occurrence. In Peru, preeclampsia incidence is greater than 10%, and it accounts for 22% of maternal deaths. Genome and genetic epidemiologial studies have found an association of preeclampsia and certain gene polymorphisms and variants. In this study, we evaluated the susceptibility gene polymorphisms related to endothelial function, angiogenesis, immunologic and inflammatory processes, and metabolic syndrome in Peruvian preeclamptic women.

2) What were the most relevant results of the study?

No association was found between the studied genetic markers and preeclampsia. However, in the -174G/C polymorphism of the IL6 gene, significant differences mainly in the GG genotype and G allele were found, wherein the frequencies were higher in the cases than in the controls.

3) What do these results contribute?

This study contributes to our knowledge of the genetic factors associated with preeclampsia, an emergent research topic in Peru. High genetic mixing and other factors may partially explain the conflicting findings for the Peruvian population.

1) ¿Por qué se realizó este estudio?

La preeclampsia es un trastorno multiorgánico que se asocia de modo significativo con la morbimortalidad materna y perinatal. La preeclampsia se define como la presencia de hipertensión de novo y proteinuria en mujeres con al menos 20 semanas de embarazo. La etiología de la preeclampsia sigue siendo desconocida; su presentación clínica y su dinámica varían, y ningún método puede predecir su aparición. En Perú, la incidencia de la preeclampsia es alrededor del 10%, y causa el 22% de las muertes maternas. Los estudios epidemiológicos genómicos y genéticos han encontrado una asociación entre la preeclampsia y ciertos polimorfismos y variantes. En este estudio, se ha evaluado los polimorfismos en genes relacionados con la función endotelial, la angiogénesis, los procesos inmunológicos e inflamatorios y el síndrome metabólico en mujeres preeclámpticas peruanas.

2) ¿Cuáles fueron los resultados más relevantes del estudio?

No se encontró asociación entre los marcadores genéticos estudiados y la preeclampsia. Sin embargo, en el polimorfismo -174G/C en el gen IL6, se hallaron diferencias significativas principalmente en el genotipo GG y el alelo G, en los que las frecuencias fueron mayores en los casos que en los controles.

3¿Qué aportan estos resultados?

El presente estudio contribuye a nuestro conocimiento de los factores genéticos asociados a la preeclampsia, un tema de investigación emergente en el Perú. La ancestría genética y otros factores pueden explicar parcialmente los hallazgos para la población peruana.