Literature DB >> 33909041

Acute and chronic tirasemtiv treatment improves in vivo and in vitro muscle performance in actin-based nemaline myopathy mice.

Josine M de Winter1, Charlotte Gineste2, Elisa Minardi3, Lorenza Brocca3, Maira Rossi3, Tamara Borsboom1, Alan H Beggs4, Monique Bernard2, David Bendahan2, Darren T Hwee5, Fady I Malik5, Maria Antonietta Pellegrino3,6, Roberto Bottinelli3,7, Julien Gondin2,8, Coen A C Ottenheijm1.   

Abstract

Nemaline myopathy, a disease of the actin-based thin filament, is one of the most frequent congenital myopathies. To date, no specific therapy is available to treat muscle weakness in nemaline myopathy. We tested the ability of tirasemtiv, a fast skeletal troponin activator that targets the thin filament, to augment muscle force-both in vivo and in vitro-in a nemaline myopathy mouse model with a mutation (H40Y) in Acta1. In Acta1H40Y mice, treatment with tirasemtiv increased the force response of muscles to submaximal stimulation frequencies. This resulted in a reduced energetic cost of force generation, which increases the force production during a fatigue protocol. The inotropic effects of tirasemtiv were present in locomotor muscles and, albeit to a lesser extent, in respiratory muscles, and they persisted during chronic treatment, an important finding as respiratory failure is the main cause of death in patients with congenital myopathy. Finally, translational studies on permeabilized muscle fibers isolated from a biopsy of a patient with the ACTA1H40Y mutation revealed that at physiological Ca2+ concentrations, tirasemtiv increased force generation to values that were close to those generated in muscle fibers of healthy subjects. These findings indicate the therapeutic potential of fast skeletal muscle troponin activators to improve muscle function in nemaline myopathy due to the ACTA1H40Y mutation, and future studies should assess their merit for other forms of nemaline myopathy and for other congenital myopathies.
© The Author(s) 2021. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 33909041      PMCID: PMC8255131          DOI: 10.1093/hmg/ddab112

Source DB:  PubMed          Journal:  Hum Mol Genet        ISSN: 0964-6906            Impact factor:   6.150


Introduction

Congenital myopathies are a genetically heterogeneous group of early onset neuromuscular disorders characterized by distinct structural abnormalities in muscle fibers and by contractile weakness (1). The majority of these disorders are caused by defects either in the process of excitation–contraction coupling or in the assembly and interaction of proteins that make up the sarcomeres, the smallest contractile units in muscle. To date, no therapy is available to treat muscle weakness in congenital myopathies. One of the most frequent congenital myopathies is nemaline myopathy (NEM; incidence ~1:50 000 (2,3)). Currently, 12 genes have been implicated in NEM: alpha-actin 1 (ACTA1) (4), alpha- and beta-tropomyosin (TPM3 and TPM2) (5,6), nebulin (NEB) (7), leiomodin-3 (LMOD3) (8), troponin T (TNNT1 (9) and TNNT3) (10), cofilin 2 (CFL2) (11), myopalladin (MYPN) (12), kelch family members 40 (KLHL40) and −41 (KLHL41) (13,14), and kelch repeat and BTB (POZ) domain containing 13 (KBTBD13) (15). All of these genes encode proteins that are associated with the actin-based thin filament. Recent studies revealed that thin filament dysfunction is a major contributor to muscle weakness in NEM patients (16–23). Thus, thin-filament dysfunction is a therapeutic target in NEM. Here, we aimed to test the ability of the small molecule, fast skeletal muscle troponin activator, tirasemtiv, to augment thin filament function in NEM. Tirasemtiv amplifies the response of the thin filament to calcium (Ca2+) in fast skeletal muscle fibers, leading to increased muscle force at submaximal rates of nerve stimulation (24). Thus, troponin activation is an appealing therapeutic approach in NEM. In our studies, we took advantage of an NEM mouse model with the heterozygous NM_009606.3(Acta1):p.His42Tyr mutation in Acta1 (25), one of the most frequently affected genes in NEM patients. Note that throughout the manuscript, this mutation is referred to as Acta1 to be consistent with existing literature utilizing an older numbering scheme. We studied the acute and chronic in vitro and in vivo effects of tirasemtiv on skeletal muscle contractility and metabolism that included respiratory muscle, as respiratory failure is the main cause of death in NEM (1). We found that acute and chronic treatment with tirasemtiv resulted in a profound increase in the force response to submaximal stimulation frequencies in Acta1 mice. The energetic cost of force generation was reduced in muscle of tirasemtiv-treated Acta1 mice. An interesting finding was that chronic treatment of Acta1 mice with tirasemtiv also increased the force response to maximal stimulation, with no muscle mass increase. This suggests that muscle remodeling had occurred to improve contractility. Finally, studies on permeabilized muscle fibers isolated from a biopsy of a patient with the ACTA1 mutation revealed that at physiological Ca2+ concentrations, tirasemtiv increased force generation to values that were close to those generated in muscle fibers of healthy subjects. Together, these findings indicate the therapeutic potential of fast skeletal troponin activators to alleviate muscle weakness in NEM.

Results

Baseline characteristics of the mouse model

Acta1 mice had lower body weights and lower muscle mass, except for the soleus muscle which had significantly increased muscle weight (Fig. 1A). According to previous studies (24), tirasemtiv specifically affects the contractility of fast-twitch muscle fibers with fast skeletal muscle troponin, which express type 2 MHC isoforms. Therefore, we evaluated the MHC isoform composition of EDL and gastrocnemius muscles, the muscles selected for our contractility assays. As shown in Figure 1B, both EDL and gastrocnemius muscles contain mainly type 2B MHC isoforms, with EDL muscle also significant amounts of type 2X MHC isoforms. Minor differences in MHC isoform proportions were observed between Acta1(WT) and Acta1 mice. The magnitude of the effect of tirasemtiv by type 2 MHC isoform is unknown. Therefore, we isolated permeabilized single muscle fibers from a WT mouse muscle, determined their calcium sensitivity of force in the presence and absence of tirasemtiv, and determined the MHC isoform in the fibers. As shown in Figure 1C, tirasemtiv increased the calcium sensitivity of force with a comparable magnitude in both type 2AX and 2B fibers (with, as expected, no effect in type 1 fibers). Thus, both EDL and gastrocnemius muscles are appropriate for testing the efficacy of tirasemtiv to improve muscle function in the Acta1 mouse model. Further characterization of both muscles showed that the cross-sectional area (CSA) of individual muscle fibers was smaller in EDL and gastrocnemius of Acta1 mice compared to WT mice (Fig. 1D). Similarly, the maximal force generating capacity was lower in EDL and gastrocnemius of Acta1 mice compared to WT mice (Fig. 1E).
Figure 1

Characterization of the Acta1 mouse model. (A) Body and wet muscle weights, normalized over tibia length. (B) MHC isoform composition of extensor digitorum longus (EDL, top) and gastrocnemius (GAS, bottom) muscles. (C) The effect of 10 μmtirasemtiv on the calcium sensitivity of force of single muscle fibers of EDL. Left panel shows a typical example of the effect of tirasemtiv on the force-pCa relation of a type 2B muscle fiber before exposure to tirasemtiv and during exposure to tirasemtiv. Right panel shows the results per fiber type. (D) Fiber CSA of EDL (top) and gastrocnemius (bottom) muscle. Right panels show representative cryosections stained with wheat germ agglutinin to demarcate muscle fibers. (E) Top: the maximal tension (in vitro force normalized to muscle CSA at 200 Hz stimulation) of EDL muscle. Bottom: the in vivo maximal force of gastrocnemius muscle at 20 and 150 Hz stimulation.

Characterization of the Acta1 mouse model. (A) Body and wet muscle weights, normalized over tibia length. (B) MHC isoform composition of extensor digitorum longus (EDL, top) and gastrocnemius (GAS, bottom) muscles. (C) The effect of 10 μmtirasemtiv on the calcium sensitivity of force of single muscle fibers of EDL. Left panel shows a typical example of the effect of tirasemtiv on the force-pCa relation of a type 2B muscle fiber before exposure to tirasemtiv and during exposure to tirasemtiv. Right panel shows the results per fiber type. (D) Fiber CSA of EDL (top) and gastrocnemius (bottom) muscle. Right panels show representative cryosections stained with wheat germ agglutinin to demarcate muscle fibers. (E) Top: the maximal tension (in vitro force normalized to muscle CSA at 200 Hz stimulation) of EDL muscle. Bottom: the in vivo maximal force of gastrocnemius muscle at 20 and 150 Hz stimulation. Thus, EDL and gastrocnemius muscles of Acta1 mice display contractile weakness. Both muscle types contain a high proportion of fast-twitch muscle fibers, providing a large treatment window for testing the efficacy of acute and chronic tirasemtiv administration.

Effect of acute tirasemtiv administration

First, we evaluated the effect of acute administration of 3 μmtirasemtiv on the in vitro contractility of EDL muscle in 9-month-old Acta1(WT) and Acta1 mice. This concentration was selected based on previous studies showing a maximal effect on contractility at 3 μm (without significantly slowing the rate of muscle relaxation) (26). Tirasemtiv induced a leftward shift of the force-stimulation frequency curve in both Acta1(WT) and Acta1 EDL muscle (Fig. 2A, left panels). Consequently, the force generated at 40 Hz (normalized to maximal force at 200 Hz) increased by ~50% in Acta1(WT) muscle and by ~100% in Acta1 mice (Fig. 2A, middle panels). Tirasemtiv did not affect the maximal force generated by EDL muscle (Fig. 2A, right panels). Absolute force values are shown in Table 1.
Figure 2

Effects of acute tirasemtiv (Tira) administration on in vitro (A) and in vivo (B) muscle function in Acta1(WT) and Acta1 mice. (A) Left panels: Force-stimulation frequency relation of EDL muscle. Middle panels: The force at 40 Hz stimulation relative to that at 200 Hz stimulation. Right panels: The force at maximal stimulation (200 Hz). (B) Left panels: The force at 20 Hz stimulation relative to that at 150 Hz stimulation in gastrocnemius muscle. Right panels: The force at maximal stimulation (150 Hz). Note that all data are presented relative to the vehicle (V) treated group.

Table 1

In vitro muscle mechanics—acute treatment

DiaphragmEDL
Frequency20 Hz150 Hz40 Hz200 Hz
Acta1(WT)—Vehicle
Absolute force (mN)--70 ± 10200 ± 20
Normalized force (mN/mm2)57 ± 8143 ± 13125 ± 10377 ± 18
Relative force (% of maximum)43 ± 4100 ± 0.132 ± 2100 ± 0
Acta1(WT)—Tirasemtiv
Absolute force (mN)--100 ± 10a180 ± 4
Normalized force (mN/mm2)76 ± 14a126 ± 14160 ± 23a385 ± 27
Relative force (% of maximum)64 ± 5a99 ± 0.447 ± 5a100 ± 0.2
Acta1 H40Y —Vehicle
Absolute force (mN)--4 ± 1b10 ± 10b
Normalized force (mN/mm2)37 ± 781 ± 10b13 ± 3b34 ± 7b
Relative force (% of maximum)41 ± 1100 ± 0.135 ± 894 ± 2b
Acta1 H40Y —Tirasemtiv
Absolute force (mN)--20 ± 3a22 ± 5
Normalized force (mN/mm2)54 ± 11a78 ± 1329 ± 5a39 ± 4
Relative force (% of maximum)63 ± 5a100 ± 0.266 ± 6a93 ± 3

aVehicle versus Tirasemtiv (P < 0.05)

b Acta1(WT) versus Acta1 (P < 0.05)

Effects of acute tirasemtiv (Tira) administration on in vitro (A) and in vivo (B) muscle function in Acta1(WT) and Acta1 mice. (A) Left panels: Force-stimulation frequency relation of EDL muscle. Middle panels: The force at 40 Hz stimulation relative to that at 200 Hz stimulation. Right panels: The force at maximal stimulation (200 Hz). (B) Left panels: The force at 20 Hz stimulation relative to that at 150 Hz stimulation in gastrocnemius muscle. Right panels: The force at maximal stimulation (150 Hz). Note that all data are presented relative to the vehicle (V) treated group. In vitro muscle mechanics—acute treatment aVehicle versus Tirasemtiv (P < 0.05) b Acta1(WT) versus Acta1 (P < 0.05) Second, we evaluated the effect of acute administration of 3 mg/kg tirasemtiv on the in vivo contractility of gastrocnemius muscle in 9-month-old mice. This treatment resulted in comparable tirasemtiv plasma concentrations in Acta1(WT) and Acta1 mice (Acta1(WT): 11.7 ± 1.1 μm; Acta1: 9.8 ± 0.9 μm; assessed nocturnally, the time of day at which the contractility experiments were performed). Tirasemtiv increased the force generated at 20 Hz (normalized to maximal force at 150 Hz) by ~20% in Acta1(WT) muscle and by ~26% in Acta1 mice (Fig. 2B, left panels). Tirasemtiv did not affect the maximal force generated by gastrocnemius muscle (Fig. 2B, right panels). Absolute force values are shown in Table 2.
Table 2

In vivo muscle mechanics—acute treatment

Frequency20 Hz150 Hz
Absolute force (mN)
Acta1(WT)—Vehicle108 ± 3367 ± 16
Acta1(WT)—Tirasemtiv134 ± 5a377 ± 10
Acta1H40Y—Vehicle37 ± 3b127 ± 8b
Acta1H40Y—Tirasemtiv47 ± 4a,b127 ± 6b

aVehicle versus Tirasemtiv (P < 0.05)

b Acta1(WT) versus Acta1 (P < 0.05)

In vivo muscle mechanics—acute treatment aVehicle versus Tirasemtiv (P < 0.05) b Acta1(WT) versus Acta1 (P < 0.05) Thus, these findings show that acute administration of tirasemtiv increased in vitro and in vivo submaximal force generation of Acta1 EDL and gastrocnemius mouse muscles.

Effect of chronic tirasemtiv administration

Five-month-old Acta1(WT) and Acta1 mice were fed chow enriched with tirasemtiv for 4 weeks. This treatment resulted in comparable tirasemtiv plasma concentrations in Acta1(WT) and Acta1 mice (Acta1(WT): 29 ± 4 μm; Acta1: 22 ± 3 μm; assessed nocturnally, the time of day at which the contractility experiments were performed). After 4 weeks, no effect of tirasemtiv on muscle mass was observed in Acta1(WT) and in Acta1 mice (Fig. 3A). In line with this finding, no effect of chronic tirasemtiv administration on fiber CSA in gastrocnemius muscle was observed (Fig. 3B). Furthermore, chronic tirasemtiv administration did not affect the proportion of fast-twitch muscle fibers (Fig. 3C), an important finding as this indicates that the number of fibers sensitive to tirasemtiv was not affected by chronic administration.
Figure 3

Effects of chronic tirasemtiv (Tira) administration on muscle mass, fiber size and fiber type distribution. (A) Body and wet muscle weights, normalized over tibia length, in Acta1(WT) (left) and Acta1 (right) mice. Data are presented relative to the data from the vehicle (V) treated group. (B) Fiber cross-sectional area of gastrocnemius muscle. Right panel shows representative cryosections stained with wheat germ agglutinin to demarcate muscle fibers. Data are presented relative to the data from the vehicle (V) treated group. (C) The effect of chronic tirasemtiv administration on fiber type composition in gastrocnemius muscle.

Effects of chronic tirasemtiv (Tira) administration on muscle mass, fiber size and fiber type distribution. (A) Body and wet muscle weights, normalized over tibia length, in Acta1(WT) (left) and Acta1 (right) mice. Data are presented relative to the data from the vehicle (V) treated group. (B) Fiber cross-sectional area of gastrocnemius muscle. Right panel shows representative cryosections stained with wheat germ agglutinin to demarcate muscle fibers. Data are presented relative to the data from the vehicle (V) treated group. (C) The effect of chronic tirasemtiv administration on fiber type composition in gastrocnemius muscle. First, we evaluated the effect of chronic administration of tirasemtiv on the in vitro contractility of EDL of Acta1(WT) and Acta1 mice. Note that after excision of the muscles from the mouse leg and prior to the contractility assay, muscles were bathed for ~20 min in tirasemtiv-free Ringer solution. Previous work indicated that this time-frame is sufficient to completely remove tirasemtiv from the muscles. Interestingly, despite the removal of tirasemtiv, the chronic administration of tirasemtiv induced a small, but significant leftward shift of the force-stimulation frequency curve in both Acta1(WT) and Acta1 EDL muscle (Fig. 4A, left panel). However, post-hoc analysis showed that the force generated at 40 Hz (normalized to maximal force at 200 Hz) was not significantly different between tirasemtiv-treated and vehicle-treated Acta1(WT) mice (Fig. 4A, middle panel). Note that the absolute force at 40 Hz was higher in tirasemtiv-treated than in vehicle-treated Acta1(WT) mice (Table 3). The Acta1 mice had a similar response (Fig. 4A, left and middle panels). Interestingly, chronic administration of tirasemtiv significantly increased the maximal force generated by EDL muscle by ~15% in Acta1(WT) mice and by ~43% in Acta1 mice (Fig. 4A, right panels). Absolute force values are shown in Table 3.
Figure 4

Effects of chronic tirasemtiv (Tira) administration on in vitro (A) and in vivo (B) muscle function. (A) Left panels: Force-stimulation frequency relation of EDL muscle. Middle panels: The force at 40 Hz stimulation relative to that at 200 Hz stimulation. Right panels: The force at maximal stimulation (200 Hz). Note that data are presented relative to the vehicle (V) treated group. (B) Top left panel: The force at 20 Hz stimulation relative to that at 150 Hz stimulation in Acta1 muscle. Top right panel: The force at maximal stimulation (150 Hz) in Acta1 muscle. Note that data are presented relative to the vehicle (V) treated group. Bottom left panel: Force of gastrocnemius muscle in Acta1 mice during a fatigue protocol. Bottom right panel: Phosphocreatine (PCr) levels in gastrocnemius muscle in Acta1 mice during the fatigue protocol.

Table 3

In vitro muscle mechanics—chronic treatment

DiaphragmEDL
Frequency20 Hz150 Hz40 Hz200 Hz
Acta1(WT)—Vehicle
Absolute force (mN)--90 ± 10270 ± 10
Normalized force (mN/mm2)116 ± 13212 ± 11136 ± 9409 ± 20
Relative force (% of maximum)53 ± 4100 ± 0.433 ± 1100 ± 0
Acta1(WT)—Tirasemtiv
Absolute force (mN)--130 ± 10a310 ± 10a
Normalized force (mN/mm2)113 ± 11216 ± 15199 ± 14a482 ± 10a
Relative force (% of maximum)54 ± 2100 ± 0.141 ± 3a100 ± 0
Acta1 H40Y —Vehicle
Absolute force (mN)--30 ± 4b80 ± 10b
Normalized force (mN/mm2)63 ± 12b119 ± 1660 ± 8b164 ± 18b
Relative force (% of maximum)50 ± 3100 ± 0.236 ± 298 ± 1
Acta1 H40Y —Tirasemtiv
Absolute force (mN)--50 ± 5a110 ± 10a
Normalized force (mN/mm2)78 ± 13126 ± 1891 ± 9a211 ± 13
Relative force (% of maximum)60 ± 3a99 ± 0.342 ± 2a99 ± 0.3

aVehicle versus Tirasemtiv (P < 0.05)

b Acta1(WT) versus Acta1 (P < 0.05)

Effects of chronic tirasemtiv (Tira) administration on in vitro (A) and in vivo (B) muscle function. (A) Left panels: Force-stimulation frequency relation of EDL muscle. Middle panels: The force at 40 Hz stimulation relative to that at 200 Hz stimulation. Right panels: The force at maximal stimulation (200 Hz). Note that data are presented relative to the vehicle (V) treated group. (B) Top left panel: The force at 20 Hz stimulation relative to that at 150 Hz stimulation in Acta1 muscle. Top right panel: The force at maximal stimulation (150 Hz) in Acta1 muscle. Note that data are presented relative to the vehicle (V) treated group. Bottom left panel: Force of gastrocnemius muscle in Acta1 mice during a fatigue protocol. Bottom right panel: Phosphocreatine (PCr) levels in gastrocnemius muscle in Acta1 mice during the fatigue protocol. In vitro muscle mechanics—chronic treatment aVehicle versus Tirasemtiv (P < 0.05) b Acta1(WT) versus Acta1 (P < 0.05) Next, we evaluated the effect of chronic administration of tirasemtiv on the in vivo contractility of gastrocnemius muscle in Acta1 mice. Note that during these in vivo assays, tirasemtiv was present in the muscles. After 4 weeks, Tirasemtiv increased the force generated at 20 Hz (normalized to maximal force at 150 Hz) by ~25% in Acta1 muscle (Fig. 4B, top panel). Tirasemtiv also increased the maximal force (normalized to muscle mass) generated by gastrocnemius muscle (Fig. 4B, top panel). Absolute force values are shown in Table 4.
Table 4

In vivo muscle mechanics—chronic treatment

Week 0Week 4
Frequency20 Hz150 Hz20 Hz150 Hz
Acta1 H40Y —Vehicle
Absolute force (mN)39 ± 3179 ± 1334 ± 3149 ± 8c
Normalized force (mN/mg)——0.5 ± 0.042 ± 0.1
Acta1 H40Y —Tirasemtiv
Absolute force (mN)40 ± 5177 ± 946 ± 4a165 ± 6c
Normalized force (mN/mg)——0.8 ± 0.1a3 ± 0.2a

aVehicle versus Tirasemtiv (P < 0.05)

cWeek 0 versus Week 4 (P < 0.05)

In vivo muscle mechanics—chronic treatment aVehicle versus Tirasemtiv (P < 0.05) cWeek 0 versus Week 4 (P < 0.05) Subsequently, the gastrocnemius muscle was subjected to repetitive stimulations at 20 Hz to induce fatigue. As shown in Figure 4B (lower panel, left), in tirasemtiv-treated Acta1 mice the force generated was higher than in vehicle-treated mice at all time points. The fatigue index was comparable between tirasemtiv-treated and vehicle-treated Acta1 mice. Interestingly, the reduction in phosphocreatine (PCr; Fig. 4B, lower panel, right) and pH (Vehicle: from 7.08 ± 0.02 to 6.98 ± 0.01; tirasemtiv: from 7.13 ± 0.03 to 6.96 ± 0.05) during the fatigue protocol was comparable between tirasemtiv-treated and vehicle-treated Acta1 mice. Thus, chronic administration of tirasemtiv increased submaximal force generation. Chronic administration also increased maximal force generation, suggesting that chronic administration of tirasemtiv induces muscle remodeling to improve contractility. The force generated during the development of fatigue was higher in tirasemtiv-treated mice, while the metabolic changes were comparable. This indicates a lower energetic cost of force generation in muscle of tirasemtiv-treated Acta1 mice.

Effect of tirasemtiv on the respiratory muscles

Diaphragm muscle of Acta1 mice had a significantly larger CSA of slow-twitch fibers than Acta1(WT) mice (Fig. 5A). Tirasemtiv affects the contractility of fast-twitch muscle fibers, which express type 2 MHC isoforms. Therefore, we evaluated the MHC isoform composition of diaphragm muscles. As shown in Figure 5B, diaphragm contains ~5% type 1 MHC, a percentage that was comparable between Acta1(WT) and Acta1 mice. Thus, the vast majority of fibers expressed type 2 MHC, with type 2A MHC the most abundant one. In Acta1 mice, there was a significant increase in fibers expressing type 2A MHC at the expense of type 2B and type 2X MHC. The maximal tetanic tension (150 Hz) generated by isolated diaphragm strips was lower in Acta1 than in Acta1(WT) mice (Fig. 5C, left panel). The force-stimulation frequency curve was comparable between mice (Fig. 5C, right panel). Finally, we applied plethysmography to determine the in vivo functioning of the respiratory muscles. As shown in Figure 5D, tidal volume was higher in Acta1 mice than in Acta1(WT) mice, and respiratory frequency was reduced in Acta1 mice.
Figure 5

Characterization of respiratory muscles in the Acta1 mouse model. (A) Diaphragm fiber cross sectional area; left panel shows typical diaphragm cryosections stained to identify slow-twitch muscle fibers. (B) MHC isoform composition in the diaphragm muscle as determined by SDS-PAGE. Inset: a typical SDS-PAGE result showing separation of the four isoforms. (C) Left panel: In vitro maximal tension of diaphragm strips stimulated with 150 Hz. Right panel: the force-stimulation frequency relation of diaphragm strips. (D) In vivo respiratory function, as determined by whole body plethysmography. Left panel shows tidal volume and right panel shows respiratory rate.

Characterization of respiratory muscles in the Acta1 mouse model. (A) Diaphragm fiber cross sectional area; left panel shows typical diaphragm cryosections stained to identify slow-twitch muscle fibers. (B) MHC isoform composition in the diaphragm muscle as determined by SDS-PAGE. Inset: a typical SDS-PAGE result showing separation of the four isoforms. (C) Left panel: In vitro maximal tension of diaphragm strips stimulated with 150 Hz. Right panel: the force-stimulation frequency relation of diaphragm strips. (D) In vivo respiratory function, as determined by whole body plethysmography. Left panel shows tidal volume and right panel shows respiratory rate. We evaluated the effect of acute administration of 3 μmtirasemtiv on the in vitro contractility of diaphragm strips of Acta1(WT) and Acta1 mice. Tirasemtiv induced a leftward shift of the force-stimulation frequency curve in both Acta1(WT) and Acta1 diaphragm (Fig. 6A, left panel). Consequently, the force generated at 20 Hz (normalized to maximal force at 150 Hz) was increased by 47% in Acta1(WT) muscle and by ~55% in Acta1 mice (Fig. 6A, right panel). Tirasemtiv did not significantly affect the maximal force generated by diaphragm muscle (Fig. 6B). Note that absolute force values are shown in Table 1.
Figure 6

Effect of acute and chronic tirasemtiv administration on respiratory muscle function in Acta1(WT) and Acta1 mice. (A and E) Left panels: Force-frequency stimulation relations during acute and chronic treatment with tirasemtiv. Right panels: The force at 20 Hz stimulation relative to that at 150 Hz stimulation. (B and F) The force at maximal stimulation (150 Hz). (C and G) Tidal volume as determined by whole body plethysmography. (D and H) Respiratory rate as determined by whole body plethysmography. Note that data is presented relative to the vehicle (V) treated group.

Effect of acute and chronic tirasemtiv administration on respiratory muscle function in Acta1(WT) and Acta1 mice. (A and E) Left panels: Force-frequency stimulation relations during acute and chronic treatment with tirasemtiv. Right panels: The force at 20 Hz stimulation relative to that at 150 Hz stimulation. (B and F) The force at maximal stimulation (150 Hz). (C and G) Tidal volume as determined by whole body plethysmography. (D and H) Respiratory rate as determined by whole body plethysmography. Note that data is presented relative to the vehicle (V) treated group. We evaluated the effect of acute administration of 3 mg/kg tirasemtiv on in vivo function of the respiratory muscles using plethysmography. During exposure to 5% CO2, tirasemtiv increased the tidal volume by ~11% in both Acta1(WT) and Acta1 mice compared to vehicle-treated mice (Fig. 6C). During exposure to 5% CO2, tirasemtiv decreased respiratory frequency by ~5% in both Acta1(WT) and Acta1 mice compared to vehicle-treated mice (Fig. 6D). The data collected at room air (normal CO2) as well as the absolute data are shown in Table 5.
Table 5

Plethysmography—acute treatment

Vehicle Tirasemtiv
Rest5% CO2Rest5% CO2
Acta1(WT)
Breathing frequency (per min)150 ± 5214 ± 5156 ± 3211 ± 2
Tidal volume (ml/kg)10 ± 0.214 ± 0.310 ± 0.315 ± 0.3a
Minute volume (ml/kg/min)1444 ± 492921 ± 1141551 ± 483191 ± 60
Acta1 H40Y
Breathing frequency (per min)145 ± 4209 ± 3144 ± 2b203 ± 5
Tidal volume (ml/kg)12 ± 0.3b17 ± 0.5b12 ± 0.2b18 ± 0.4a,b
Minute volume (ml/kg/min)1666 ± 61b3466 ± 118b1708 ± 503735 ± 116b

aVehicle versus Tirasemtiv (P < 0.05)

b Acta1(WT) versus Acta1 (P < 0.05)

Plethysmography—acute treatment aVehicle versus Tirasemtiv (P < 0.05) b Acta1(WT) versus Acta1 (P < 0.05) We evaluated the effect of chronic administration of tirasemtiv on the in vitro contractility of diaphragm muscle strips of Acta1(WT) and Acta1 mice. Note that after excision of the diaphragm from the mouse and prior to the contractility assay, muscles were bathed for ~20 min in tirasemtiv-free Ringer solution. Previous work indicated that this time frame is sufficient to completely remove tirasemtiv from diaphragm muscles. The chronic administration of tirasemtiv did not affect the force-stimulation frequency relation in Acta1(WT) mice (Fig. 6E, upper left panel), and thus the ratio of force generated at 20 Hz to that at 150 Hz was comparable (Fig. 6E, upper right panel). However, in Acta1 mice, chronic tirasemtiv administration induced a leftward shift of the force-stimulation curve (Fig. 6E, lower left panel), resulting in a higher force generated at 20 Hz (normalized to maximal force at 150 Hz; Fig. 6E, lower right panel). Chronic administration of tirasemtiv did not affect the maximal force generated by the diaphragm in Acta1(WT) and Acta1 mice (Fig. 6F). Absolute force values are shown in Table 3. We also assessed the effect of chronic tirasemtiv administration on in vivo respiratory muscle function using plethysmography. Note that during these assays, tirasemtiv was present in the respiratory muscles. Chronic administration of tirasemtiv did not affect tidal volume and respiratory frequency during exposure to 5% CO2 in both Acta1(WT) and Acta1 mice (Fig. 6G and H; Table 6). The data collected at room air (normal CO2), as well as the absolute data, are shown in Table 6.
Table 6

Plethysmography—chronic treatment

Week 0Week 4
Rest5% CO2Rest5% CO2
Acta1(WT)—Vehicle
Breathing frequency (per min)174 ± 3249 ± 3166 ± 4249 ± 2
Tidal volume (ml/kg)11 ± 0.216 ± 0.310 ± 0.2c16 ± 0.2
Minute volume (ml/kg/min)1846 ± 504090 ± 1081618 ± 42c3934 ± 67
Acta1(WT)—Tirasemtiv
Breathing frequency (per min)168 ± 4261 ± 4a159 ± 3244 ± 3c
Tidal volume (ml/kg)11 ± 0.317 ± 0.310 ± 0.216 ± 0.2
Minute volume (ml/kg/min)1797 ± 714282 ± 1081656 ± 574014 ± 98c
Acta1 H40Y —Vehicle
Breathing frequency (per min)157 ± 5b247 ± 5144 ± 3b,c237 ± 5b
Tidal volume (ml/kg)13 ± 0.3b20 ± 0.5b12 ± 0.4b19 ± 0.6b
Minute volume (ml/kg/min)2015 ± 764894 ± 198b1767 ± 71c4551 ± 189b
Acta1 H40Y —Tirasemtiv
Breathing frequency (per min)157 ± 5245 ± 5141 ± 4c234 ± 4c
Tidal volume (ml/kg)12 ± 0.319 ± 0.312 ± 0.420 ± 0.4a,c
Minute volume (ml/kg/min)1879 ± 864530 ± 1711677 ± 594527 ± 117

aVehicle versus Tirasemtiv (P < 0.05)

b Acta1(WT) versus Acta1 (P < 0.05)

cWeek 0 versus Week 4 (P < 0.05)

Plethysmography—chronic treatment aVehicle versus Tirasemtiv (P < 0.05) b Acta1(WT) versus Acta1 (P < 0.05) cWeek 0 versus Week 4 (P < 0.05)

Effect of chronic tirasemtiv administration on protein expression in gastrocnemius

We determined, in gastrocnemius muscle, the effect of chronic tirasemtiv administration on the expression of several markers of intracellular pathways involved in the regulation of muscle atrophy/hypertrophy, oxidative stress and mitochondrial structure and function (see Supplementary Material, Figs S1 and S2). Chronic administration of tirasemtiv increased MuRF-1 levels, but only in the Acta1 muscles. Chronic administration of tirasemtiv also increased MFN1 and MFN2 levels in Acta1 muscles, but decreased MFN1 levels in Acta1(WT) muscles. Tirasemtiv decreased OPA1 levels in Acta1(WT) muscles, but not in Acta1 muscles.

Effect of tirasemtiv on permeabilized quadriceps fibers of a patient with the ACTA1 mutation

Finally, we studied the ability of tirasemtiv to restore the force generated at submaximal calcium levels in muscle fibers isolated from muscle of a patient harboring the ACTA1 mutation. First, we performed histological assays in the muscle biopsy and observed in NADH-stained cryosections a relatively high proportion of fast-twitch fibers (Fig. 7A). Electron microscopy showed muscle fibers with severely damaged myofibrillar structure, nemaline rods (a hallmark feature of NEM) and nuclear rods, but also fibers with normal structure (Fig. 7B). Small bundles were permeabilized, exposed to solutions with incremental Ca2+ concentration, and the force generated was determined. The myosin heavy chain (MHC) composition of these small bundles consists of 33% type 1 and 67% type 2 fibers. Experiments were performed in the presence and absence of 10 μmtirasemtiv. As shown in Figure 7C, tirasemtiv induced a profound leftward shift of the force-pCa relation in fast-twitch fibers, indicating increased Ca2+ sensitivity of force. This shift was illustrated by an increase in the pCa50 (Fig. 7C, inset). Importantly, al low, yet physiological Ca2+ concentrations, tirasemtiv increased active tension in ACTA1 fibers to values that were close to, or even exceeded those generated in fibers of healthy subjects (Fig. 7D). These findings show the promise of tirasemtiv in restoring muscle strength in patients with the ACTA1 mutation.
Figure 7

Effect of tirasemtiv on the contractility of permeabilized quadriceps fibers of a patient with ACTA1 mutation. (A) NADH stained cryosection of the patient’s muscle biopsy. The cryosection shows both slow-twitch (dark; *) and fast-twitch (light; #) muscle fibers. Bar: 100 μm. (B) electron microscopy image showing a fiber with severely damaged myofibrillar structure, nemaline rods (*) and a nuclear rod (arrow), and a fiber with preserved ultrastructure (#). (C) The relative force-pCa relation of permeabilized muscle fibers isolated from the patient’s biopsy (inset at top shows a typical bundle of 5–10 fibers used for the contractility assays; left bar graph shows the MHC composition of the muscle bundles; rightbar graph shows the tirasemtiv-induced shift in the pCa50, i.e. the pCa required to generate 50% of maximal force). (D) The tension-pCa relation of treated and untreated permeabilized muscle fibers from the patient, compared to the tension-pCa relation of muscle fibers from healthy subjects. The yellow bar indicates the physiological calcium concentration in muscle fibers during normal contractility.

Effect of tirasemtiv on the contractility of permeabilized quadriceps fibers of a patient with ACTA1 mutation. (A) NADH stained cryosection of the patient’s muscle biopsy. The cryosection shows both slow-twitch (dark; *) and fast-twitch (light; #) muscle fibers. Bar: 100 μm. (B) electron microscopy image showing a fiber with severely damaged myofibrillar structure, nemaline rods (*) and a nuclear rod (arrow), and a fiber with preserved ultrastructure (#). (C) The relative force-pCa relation of permeabilized muscle fibers isolated from the patient’s biopsy (inset at top shows a typical bundle of 5–10 fibers used for the contractility assays; left bar graph shows the MHC composition of the muscle bundles; rightbar graph shows the tirasemtiv-induced shift in the pCa50, i.e. the pCa required to generate 50% of maximal force). (D) The tension-pCa relation of treated and untreated permeabilized muscle fibers from the patient, compared to the tension-pCa relation of muscle fibers from healthy subjects. The yellow bar indicates the physiological calcium concentration in muscle fibers during normal contractility.

Discussion

In skeletal muscles of mice with the Acta1 mutation, acute in vitro or in vivo treatment with tirasemtiv increased the force response to submaximal stimulation frequencies. The increase in muscle force at submaximal stimulation persisted following chronic treatment of Acta1 mice with tirasemtiv. Furthermore, 31P-MRS revealed that the increased force generation during treatment with tirasemtiv did not increase muscle energy consumption, indicating that the energetic cost of force generation was reduced in muscle of tirasemtiv-treated Acta1 mice. Chronic treatment of Acta1 mice with tirasemtiv also increased the force response to maximal stimulation, with no muscle mass increase. This suggests that muscle remodeling had occurred to improve contractility. Finally, studies on muscle fibers from a patient with the ACTA1H40Y mutation revealed that, at physiological Ca2+ concentrations, tirasemtiv increased force generation to values that were close to those generated in muscle fibers of healthy subjects. Together, these findings indicate the therapeutic potential of fast skeletal troponin activators to alleviate muscle weakness in patients with the ACTA1H40Y mutation.

The effect of tirasemtiv persists during chronic treatment of Acta1 mice

NEM is a congenital myopathy, which, in the majority of cases, is caused by mutations in genes encoding proteins of the skeletal muscle thin filament (16). The most severely affected patients fail to survive beyond the first year of life due to severe muscle weakness. The mechanisms underlying muscle weakness have gained widespread attention during the past years. These include disturbed interactions between the thin and thick filaments, reduced length of the thin filaments, muscle fiber hypotrophy and myofibrillar disarray (17–19,27–29). To date, no specific therapies are available for NEM patients. Considering the central role of the thin filament in the NEM pathology, targeting the functioning of this sarcomeric microstructure might prove an effective approach (1). Therefore, we tested the ability of tirasemtiv, a fast skeletal muscle troponin activator that specifically targets the troponin complex on the thin filament (24), to alleviate muscle weakness in NEM. We hypothesized that fast skeletal troponin activation would augment the force response to submaximal stimulation frequencies. These are clinically relevant frequencies considering that during daily life activities the force levels of muscle range between 10% and 65% of its maximal level (30). To test this hypothesis, we made use of the Acta1 mouse model, a knock-in mouse with a mutation (p.His42Tyr) in the α-skeletal actin gene that causes a dominantly inherited severe form of the disease in humans (25). In line with our hypothesis, we found that acute administration of tirasemtiv markedly increases force generation at submaximal stimulation frequencies, with a more than 25% increase of force in gastrocnemius muscle in vivo (Fig. 2B). This effect is comparable to that found in previous work in a nebulin-based NEM mouse model (26). The magnitude of the increase was comparable to that observed after 4 weeks of chronic tirasemtiv treatment via chow (Fig. 4B), which is an important finding as it indicates that long-term administration of tirasemtiv does not desensitize the muscles to its effect. In addition to the persistent positive inotropic effect of chronic tirasemtiv treatment at submaximal stimulation frequencies, both EDL and gastrocnemius muscles showed increased force at maximal stimulation frequencies (increase in EDL: ~43%, in gastrocnemius: ~35%; Fig. 4). This finding is not explained by the direct effects of tirasemtiv, as at saturating calcium concentrations tirasemtiv does not augment force generation (24). Indeed, this inotropic effect was not observed during acute treatment with tirasemtiv (Fig. 2). Thus, this finding indicates that, during chronic tirasemtiv treatment, the EDL and gastrocnemius muscles adapt by structural remodeling. The nature of this remodeling is not clear (it does not include increased muscle fiber size or muscle mass, or changes in fiber type proportion; Fig. 3). It is tempting to speculate that the positive inotropic effects of tirasemtiv improved the myofibrillar structure in muscle fibers. Damaged myofibrillar proteins are labeled by chains of ubiquitin molecules, which mark them for degradation by the proteasome (31). Several major myofibrillar proteins, including myosin, are ubiquitinated by MuRF1 (32). We observed that in the Acta1 mice, chronic tirasemtiv treatment increased the levels of MuRF1 (Supplementary Material, Fig. S2). This increase in MuRF1 protein might have facilitated the degradation of damaged proteins in Acta1 mice, thereby improving the myofibrillar ultrastructure and force generation. Another mechanism via which tirasemtiv might have increased the force generating capacity of muscle following chronic treatment could be based on post-translational modifications of myofibrillar proteins, such as oxidation and nitrosylation. Both of them have been shown to be able to affect force production (33,34). Our results rule out the possibility that a tirasemtiv-induced decrease in the oxidation of myosin or other proteins is involved (Supplementary Material, Fig. S1), but leave open the possibility that other post-translational modifications play a role.

Tirasemtiv reduces the energetic cost of contraction in Acta1 mice

The benefit from fast skeletal troponin activators, such as tirasemtiv, involves both increased force development and lower energy cost of contraction. In the present study, we showed, using in vivo31P-MRS in Acta1 mice, that chronic treatment with tirasemtiv increased force generation of gastrocnemius muscles during a fatigue protocol at a stimulation frequency of 20 Hz. Such an increase is very likely due to tirasemtiv reducing the off-rate of Ca2+ from fast skeletal muscle troponin, with no effect on Ca2+ release and cytosolic Ca2+ concentrations (35). Importantly, the tirasemtiv-induced increase in force was not accompanied by a faster decay in muscle PCr concentration, suggesting a similar energy consumption rate in treated and untreated muscles (Fig. 4B). As we assume that cytosolic Ca2+ content did not vary (35)—note that force was measured at set stimulation frequencies—the energy required by SERCA to re-uptake Ca2+ should be comparable in treated and untreated muscles. Energy utilization of SERCA pumps accounts for a relevant portion, 30–40%, of total ATP consumption during contraction (36). Therefore, similar SERCA ATP utilization in the presence of higher force could play a significant role in the similar PCr depletion between treated and untreated muscles, and therefore in the lower energy cost of contraction in treated muscles. In line with our reasoning, it has been previously shown that CK-2066260, a fast skeletal muscle troponin activator similar to tirasemtiv, decreases ATP utilization and glycogen consumption in contractions developing the same force, rendering the muscle more efficient and fatigue-resistant (35). Another mechanism via which tirasemtiv might have enabled more force production with similar PCR consumption is by enhancing mitochondrial fusion (upregulation of MFN1 and MFN2, Supplementary Material, Fig. S2), which in turn could improve mitochondrial function and ATP production. Whether this mechanism plays a role requires further studies. Thus, tirasemtiv ameliorates the energy cost of contraction in muscles from Acta1 mice, possibly through optimization of ATP consumption of SERCA pumps and/or through the production of more ATP by mitochondria. This effect is very important for daily-life activities of NEM patients, considering that muscle fatigue is one of their major complaints.

Tirasemtiv improves diaphragm contractility

NEM patients have reduced spirometric values, and consequently some patients may suffer from the sensation of dyspnea (37–39) and die from respiratory failure. Thus, weakness of the respiratory muscles is prominent in NEM (note that the contractility of the diaphragm was significantly impaired in Acta1 mice; Fig. 5C) and augmenting respiratory muscle contractility can be of great benefit to patients. Therefore, in our work we also studied the effect of tirasemtiv on the respiratory muscles. Acute treatment with tirasemtiv improved the force response of the diaphragm to submaximal stimulation frequencies (Fig. 6B). Furthermore, using unrestrained whole body plethysmography, we found that tirasemtiv increased tidal volume (and decreased respiratory frequency to maintain minute volume; Fig. 6C and D). These effects on tidal volume are in line with previous work on a mouse model for amyotrophic lateral sclerosis (40). However, unlike the persisting effect of tirasemtiv on leg muscle contractility from chronic treatment (Fig. 4), the positive inotropic effect on respiratory muscle function did not persist following chronic treatment (except for a 20% increase in the force response to submaximal stimulation; Fig. 6E). We speculate that since tidal volume was not reduced in Acta1 mice—even slightly increased (Fig. 5)—there was no physiological need to modulate tidal volume. Thus, as tidal volume was maintained, the energy cost of contraction of the respiratory muscles must have been reduced in the tirasemtiv-treated mice, an important benefit which in patients could attenuate the development of respiratory failure. Unfortunately, we could not assess energy consumption in the diaphragm using 31P-MRS. We cannot explain why tirasemtiv increased tidal volume during acute treatment (Fig. 6C). We speculate that this increase was transient, and that the monitoring time (30 min) might not have been sufficiently long for the mice to adapt their respiratory mechanics to the positive inotropic effects of tirasemtiv on the inspiratory muscles.

Clinical perspective

The positive inotropic effect of tirasemtiv in the Acta1 mouse model was mimicked in a patient biopsy with the ACTA1(H40Y) mutation. At physiological calcium concentrations, the force generated by the patient’s fibers nearly doubled in the presence of tirasemtiv (Fig. 7), and reached values that were close to those of healthy subjects. Although, recently, tirasemtiv did not meet its primary endpoint in a phase 3 clinical trial in ALS patients in part due to its side effect profile, including dizziness (41), our findings illustrate the great therapeutic promise of fast skeletal muscle troponin activation. Reldesemtiv, a newer fast skeletal muscle troponin activator, does not appear to exhibit the same side effect profile as tirasemtiv and is currently being developed and tested for efficacy in clinical trials (35,42–45). Fast skeletal muscle troponin activators target fast-twitch muscle fibers. The improved contractility of these fibers improves strenuous muscle exercise as well as coughing and airway clearance—both major challenges for NEM patients—as these maneuvers are accomplished through the recruitment of fast-twitch fibers. It is possible that in patients, the magnitude of the effect of tirasemtiv is blunted by slow-twitch fiber predominance, a common feature of NEM (1). The patient’s fiber bundles studied here consisted of a mix of slow- and fast-twitch fibers, with predominance of fast-twitch fibers. Consequently, the effect of tirasemtiv was large (Fig. 7). Clearly, the effect size will decrease with slow-twitch fiber predominance. However, although NEM patients display a heterogeneous phenotype, fatigue and dyspnea are common complaints. Thus, even a modest improvement of diaphragm muscle function would benefit NEM patients and attenuate the development of dyspnea and respiratory failure, the major cause of death in NEM. Clearly, NEM patients might also benefit from the recruitment of slow-twitch fibers. During normal breathing and low intensity exercises, these fibers are first recruited. An additional advantage of recruiting slow-twitch fibers is the above-mentioned slow-twitch fiber predominance in NEM patients. Levosimendan is a calcium sensitizer that is approved for human use by the European Medicines Agency for acutely decompensated severe chronic heart failure. It exerts its effect through binding to slow skeletal/cardiac troponin C, which is also the dominant troponin C isoform in slow-twitch skeletal muscle fibers. However, previous studies showed no inotropic effect of levosimendan on slow-twitch fibers of NEM patients (46). Furthermore, a disadvantage of compounds that target slow skeletal/cardiac troponin C might be that they also affect cardiac function. To date, no activators specific for TnC in slow-twitch skeletal muscle fibers—with no effect on cardiomyocytes—have been developed. Alternatively, future studies might address the development of activators that target slow skeletal TnI, which is exclusively expressed in skeletal muscle.

Materials and Methods

Acta1 knock-in mouse model

Mice with the heterozygous NM_009606.3(Acta1):p.His42Tyr mutation in Acta1 (referred to as Acta1 to be consistent with existing literature utilizing an older numbering scheme) and wild-type (WT) littermates were used for the experiments, a well-established NEM knock-in mouse model (25,47,48). Experiments were conducted in agreement with the French and Dutch guidelines for animal care. All animal experiments were approved by the Institutional Animal Care Committee of Aix-Marseille University (#15–14 052 012) and by the local animal ethics committee at VU University (AVD114002016501). Experiments were only performed on females given that the majority of males typically die within the first 6–8 weeks after birth (25). Mice were housed in an environment-controlled facility (12–12 h light–dark cycle, 22°C), received water and standard food ad libitum. Mice were identified through PCR genotyping from mouse tail DNA.

Tirasemtiv treatment

For the studies in which the acute effects of tirasemtiv were studied, mice were I.P. injected with vehicle or 3 mg/kg tirasemtiv (40). Experiments were performed ~30 min after injection. For the experiments in which muscle contractility was studied in vitro, 10 μmtirasemtiv was added to the experimental solutions. For the studies in which the chronic effects of tirasemtiv were studied, mice were first fed for 1 week with custom-made mouse pellets (BioServ). After 1 week, mice were switched to the same pellets containing tirasemtiv (600 ppm), or the same pellets without tirasemtiv. Mice were kept on the chow for 4 weeks. Mice were tested before treatment and after 4 weeks of tirasemtiv-enriched diet or regular diet. After 4 weeks, mice were euthanized and tissues were collected, i.e. tibialis anterior (TA), extensor digitorum longus (EDL), soleus (SOL), gastrocnemius and diaphragm (DIA).

In vitro characterization of intact muscle

In vitro characterization of intact muscle was performed as described previously (20,49). The experimental protocols consisted of a full tetanus at 150 Hz and a force-frequency protocol. For the force-frequency protocol, the muscle was stimulated with incremental stimulation frequencies (diaphragm: 1, 5, 10, 20, 30, 40, 60, 80, 100, 150 Hz; EDL: 1, 5, 10, 20, 40, 60, 80, 100, 150, 200 Hz). Data were discarded when stimulation at 150 Hz rendered a force that was less than 95% of the force generated during the first stimulation at 150 Hz. Stimuli were applied with a train duration of 600 ms. The resting interval was 30 s between the stimulations at 1 and 10 Hz; 60 s after stimulation at 20 Hz; 90 s after stimulation at 30 Hz; and 120 s between stimulations at 50, 70, 100 and 150 Hz. After completion of the contractility measurements, the length and weight of the muscles were determined. CSA (in mm2) was calculated by dividing muscle weight (g) by muscle length (mm) multiplied by specific density (1.056 g/ml) × 100.

Plethysmography

Mice were placed in unrestrained whole body plethysmography chambers for 30 min of acclimation. After acclimation, tidal volume, respiratory frequency and minute ventilation were monitored for 15 min at room air. After 15 min, mice were exposed to a 5% CO2 gas mixture for 30 min and monitored. After the 5% CO2 exposure, mice were re-exposed to room air for 15 min and monitored (40).

In vivo investigations of the plantar flexor muscles

Animal preparation: Mice were anaesthetized and individually placed supine in a home-built cradle specially designed for the strictly non-invasive functional investigation of the left hindlimb muscles as described previously (50). Force output measurements: Non-invasive transcutaneous electrical stimulation was first elicited with square-wave pulses (0.5 ms duration) on the plantar flexor muscles. The individual maximal stimulation intensity was determined by progressively increasing the stimulus intensity until there was no further peak twitch force increase. Plantar flexion force was assessed in response to incremental frequencies (1–150 Hz; train duration = 0.75–1 s) and during a fatigue protocol (80 contractions; 20 Hz; 1.5 s on, 6 s off). The peak force of each contraction was measured. Regarding the fatigue protocol, the corresponding tetanic force was averaged every five contractions. A fatigue index corresponding to the ratio between the last five and the first five contractions was determined. For chronic experiments, the resulting force was divided by the soleus and gastrocnemius muscle weight in order to obtain specific force (in mN/mg). Experiments were performed in a 4.7-Tesla (T) horizontal superconducting magnet (47/30 Biospec Avance, Bruker, Ettingen, Germany) equipped with a Bruker 120 mm BGA12SL (200 mT/m) gradient insert. Metabolic changes were investigated using 31Phosphorus-MR Spectroscopy (31P-MRS) at rest and during the fatiguing protocol. Spectra from the gastrocnemius muscle region were continuously acquired at rest and throughout the fatigue protocol. A total of 495 free induction decays (FID) were acquired (TR = 2 s). Data were processed using proprietary software developed using IDL (Interactive Data Language, Research System, Inc., Boulder, CO, USA). The first 180 FID were acquired at rest and summed together (n = 1, time resolution = 6 min). The next 315 FID were acquired during the stimulation period and summed by blocks of 105 (n = 3, time resolution = 3.5 min). Relative concentrations of high-energy phosphate metabolites (phosphocreatine (PCr) and inorganic phosphate (Pi)) were obtained by a time-domain fitting routine using the AMARES-MRUI Fortran code and appropriate prior knowledge of the ATP multiplets. Intracellular pH (pHi) was calculated from the chemical shift of the Pi signal relative to PCr (51).

Muscle fiber cross-sectional area analysis

Muscle fibre CSA was determined in the mid-belly region of gastrocnemius and EDL muscles and in a portion of diaphragm muscle (52). Briefly, muscle serial transverse sections (10 μm thick) were obtained from each muscle and were immunostained with monoclonal antibodies against MHC isoforms (BA-F8 against MHC-1 and SC-71 against MHC-2A). The cryosections were incubated with primary antibody for 1 h at 37°C, rinsed with PBS buffer and incubated in a secondary rabbit anti-mouse antibody conjugated with peroxidase (DAKO, Denmark) for 1 h at 37°C. After washing in PBS buffer, the stain was visualized by using a DAB (3,3′-Diaminobenzidine) solution. Images of the stained sections were captured from a light microscope (LeicaDMLS) equipped with a camera (Leica DFC 280). Fibre CSA was measured with Image J analysis software (NIH, Bethesda, MD, USA) and expressed in micrometers squared.

MHC isoforms composition

Frozen muscles were pulverized in a steel mortar with liquid nitrogen to obtain a powder that was immediately resuspended in Laemmli solution (53). The samples were incubated in ice for 20 min and finally spun at 18 000g for 30 min. Protein concentration in the dissolved samples was determined with a protein assay kit (RC DC Biorad). About 10 μg of proteins for each sample were loaded on 8% SDS-PAGE polyacrylamide gels and the electrophoresis was run overnight at 250 V. Following a Coomassie stain, four bands corresponding to MHC isoforms were separated and their densitometric analysis was performed to assess the relative proportion of MHC isoforms (MHC-1, MHC-2A and MHC-2X) in the samples (54).

Western blot analysis

Frozen muscle samples were pulverized and immediately re-suspended in a lysis buffer (20 mm Tris–HCl, 1% Triton X100, 10% glycerol, 150 mm NaCl, 5 mm EDTA, 100 mm NaF and 2 mm NaPPi supplemented with 1× protease, phosphatase inhibitors (Sigma-Aldrich) and 1 mm PMSF). The homogenate obtained was kept on ice for 20 min and then centrifuged at 18 000g for 20 min at 4°C. The supernatant was stored at −80°C until ready to use. Protein concentration was evaluated for each sample and equal amounts of muscle samples were loaded on gradient precast gels purchased from Bio-Rad (AnyKd; Hercules, CA, USA). After the gel run, proteins were electro-transferred to PVDF membranes at 35 mA overnight. The membranes were incubated in 5% Milk for 2 h, rinsed with TBST buffer (0.02 M Tris and 0.05 M NaCl, pH 7.4–7.6) and subsequently probed with specific primary antibodies (see below). Thereafter, the membranes were incubated in HRP-conjugated secondary antibody. The protein bands were visualized by an enhanced chemiluminescence method in which luminol was excited by peroxidase in the presence of H2O2 (ECL Select, GE Healthcare). The content of each protein investigated was assessed by determining the brightness–area product of the protein band (55). Antibodies used were: anti-rabbit GAPDH (1:2000 Abcam); anti-rabbit Catalase (1:1000 Abcam); anti-mouse SOD1 (1:1000 Abcam); anti-rabbit FIS1 (1:1000 Abcam); anti-rabbit p-DRP1(ser616) (1:1000 Cell Signalling); anti-rabbit p-DRP1(ser637) (1:1000 Cell Signalling); anti-rabbit DRP1 (1:3000 Cell Signalling); anti-mouse MFN1 (1:1000 Abcam); anti-rabbit MFN2 (1:1000 Abcam); anti-rabbit OPA1 (1:3000 Abcam); anti-mouse IgG (1:5000 Dako North America Inc., Carpinteria, CA, USA); anti-rabbit IgG (1:10 000 Cell Signaling).

Carbonylated proteins analysis

Frozen samples from each subject group were suspended in a lysis buffer (50 mm Tris–HCl pH 7.6, 250 mm NaCl, 5 mm EDTA protease inhibitor cocktail and phosphatase inhibitor cocktail), left on ice for 20 min and finally centrifuged at 18 000g for 20 min at 4°C. Protein concentration was determined using the RC DC TM protein assay kit (Biorad product). The protein carbonylation level was detected using the OxyBlot TM Kit (Millipore) that provides reagents for sensitive immunodetection of carbonyl groups. Carbonyl groups in the protein side chains were derivatized to 2,4-dinitrophenylhydrazone (DNP) by reaction with 2,4-dinitrophenylhydrazine (DNPH). In detail, 10 μg of proteins for each muscle sample were denatured with SDS solution at a final concentration of 6%. The DNPH solution was added to obtain the derivation; the reaction was stopped after 10 min of incubation at room temperature. The DNP-derivatized protein samples were separated by polyacrylamide gel electrophoresis (Anykd Biorad gels) followed by western blotting. Proteins were transferred to nitrocellulose membranes at 100 V for 2 h, stained with Ponceau Red (Sigma) and then scanned. The membranes were blocked by incubation with 3% bovine serum albumin (BSA) for 1 h; then incubated with rabbit anti-DNP antibody overnight at 4°C and subsequently with a horseradish peroxidase-antibody conjugate (goat anti-rabbit IgG). The positive bands were visualized by using a chemiluminescent reagent (ECL advance as described previously (55). The total protein carbonylation level and the MHC carbonylation level were analyzed quantitatively by comparison of the signal intensity of immune-positive proteins normalized on total proteins amount loaded on gels (Ponceau staining signal) (55).

Gene expression analysis

Total RNA was extracted from gastrocnemius muscles using an SV Total RNA isolation kit (Promega, Madison, WI, USA). The RNA concentration was measured using a Nano Drop instrument (ThermoScientific, Waltham, MA, USA) and 400 ng was used to generate cDNA with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). The cDNA was analyzed by quantitative RT-PCR (Applied Biosystems AB7500) using a SYBR Green PCR kit (Applied Biosystems, Foster City, CA, USA) and the data were normalized to GAPDH content. Oligonucleotide primers were provided by Sigma Aldrich and were: MuRF-1 (FP: ACCTGCTGGTGGAAAACATC, RP: ACCTGCTGGTGGAAAACATC) and Atrogin-1 (FP: GCAAACACTGCCACATTCTCTC, RP: CTTGAGGGGAAAGTGAGACG). Differentially expressed genes were determined using a default threshold of 0.6. The difference between Ct (cycle threshold) values was calculated for each mRNA by taking the mean Ct of duplicate reactions and subtracting the mean Ct of duplicate reactions for the reference RNA measured on an aliquot from the same RT reaction (ΔCt = Cttarget gene—Ct reference gene). All samples were then normalized to the ΔCt value of a calibrator sample to obtain a ΔΔCt value (ΔCt target—ΔCt calibrator) (comparative method) (55).

Patient muscle biopsies

Quadriceps muscle specimens, remaining from diagnostic procedures, was collected from a patient with the NM_001100.3(ACTA1)His42Tyr mutation in ACTA1 (ACTA1, case 86-1 from Agrawal and coworkers (56)). Ethical approval was obtained from the Human Research Ethics Committees of the Boston Children’s Hospital Institutional Review Board. Quadriceps biopsies from six adult control subjects with no medical history were obtained. All biopsies were collected following informed consent supervised by the Radboud University Institutional Review Board (20). All biopsies were stored frozen and unfixed at −80°C until use.

Permeabilized muscle fiber mechanics in patient biopsy

Small strips were dissected from the muscle biopsies, permeabilized overnight and mechanical experiments were performed as described previously (18–20). As the contractile properties of muscle fibers are influenced by the MHC composition of the muscle fibers, we used a specialized SDS-PAGE technique to analyze the MHC isoform composition in the muscle fibers used in contractility experiments (57). In brief, muscles fibers were denatured by boiling for 2 min in SDS sample buffer. The stacking gel contained a 4% acrylamide concentration (pH 6.7), and the separating gel contained 7% acrylamide (pH 8.7) with 30% glycerol (v/v). The gels were run for 24 h at 15°C and a constant voltage of 275 volt. Finally, the gels were silver-stained, scanned, and analyzed with ImageQuant TL (GE Healthcare, Chicago, IL) software. To test the effect of tirasemtiv on the calcium sensitivity of force, patient fibers were exposed to solutions with varying pCa’s (protocol as described above) and in the presence/absence of tirasemtiv (10 μm; concentration based on previous studies (42); tirasemtiv dissolved in 1% dimethylsulfoxide). Note that 1% dimethylsulfoxide did not affect muscle fiber contractility (data not shown). After completion of the experiments, the MHC composition of the fibers was determined as described above.

Effect of tirasemtiv on murine muscle fiber types

Tirasemtiv is a fast skeletal muscle troponin activator, but the effect of tirasemtiv on individual murine type 2A, 2X and 2B fast muscle fibers is not known. Thus, to test the effect of tirasemtiv on the various muscle fiber types in mouse muscles, individual fibers were isolated from EDL and permeabilized as described above. The contractility of the permeabilized fibers was determined in the presence/absence of 10 μmtirasemtiv (protocol as described above). After completion of the experiments, the MHC isoform composition of the fibers was determined. The resolution of our SDS-PAGE allowed for identification of type 1 and 2B MHC isoforms; type 2A and 2X isoforms appeared as one band and these fibers were therefore grouped.

Statistics

Data are presented as mean ± standard error of the mean. For statistical analyses, one-way ANOVA’s, two-way ANOVA’s with Sidak’s multiple comparison tests and two-tailed t tests were used. A probability value < 0.05 was considered statistically significant. Conflict of Interest statement. D.T.H. and F.I.M. are employees of Cytokinetics and were financially compensated for their work.

Funding

The ERA-NET E-Rare2 grant TREAT-NEMMYOP to C.A.C.O., J.G. and R.B.; and VIDI grant (016.126.319) from the Dutch Organization for Scientific Research to C.A.C.O. A.H.B. was funded by MDA602235 from the Muscular Dystrophy Association USA and generous support for therapy development from the Anderson Family Foundation. ACTA1 patient genotyping utilized the resources of the Boston Children’s Hospital IDDRC Molecular Genetics Core Laboratory funded by NIH U54HD090255. Click here for additional data file. Click here for additional data file.
  57 in total

1.  A mutation in the alpha tropomyosin gene TPM3 associated with autosomal dominant nemaline myopathy.

Authors:  N G Laing; S D Wilton; P A Akkari; S Dorosz; K Boundy; C Kneebone; P Blumbergs; S White; H Watkins; D R Love
Journal:  Nat Genet       Date:  1995-01       Impact factor: 38.330

2.  A novel nemaline myopathy in the Amish caused by a mutation in troponin T1.

Authors:  J J Johnston; R I Kelley; T O Crawford; D H Morton; R Agarwala; T Koch; A A Schäffer; C A Francomano; L G Biesecker
Journal:  Am J Hum Genet       Date:  2000-08-21       Impact factor: 11.025

Review 3.  Respiratory involvement in inherited primary muscle conditions.

Authors:  N Shahrizaila; W J M Kinnear; A J Wills
Journal:  J Neurol Neurosurg Psychiatry       Date:  2006-10       Impact factor: 10.154

4.  Nemaline myopathy with minicores caused by mutation of the CFL2 gene encoding the skeletal muscle actin-binding protein, cofilin-2.

Authors:  Pankaj B Agrawal; Rebecca S Greenleaf; Kinga K Tomczak; Vilma-Lotta Lehtokari; Carina Wallgren-Pettersson; William Wallefeld; Nigel G Laing; Basil T Darras; Sutherland K Maciver; Philip R Dormitzer; Alan H Beggs
Journal:  Am J Hum Genet       Date:  2006-11-14       Impact factor: 11.025

5.  Reduced force of diaphragm muscle fibers in patients with chronic thromboembolic pulmonary hypertension.

Authors:  Emmy Manders; Peter I Bonta; Jaap J Kloek; Petr Symersky; Harm-Jan Bogaard; Pleuni E Hooijman; Jeff R Jasper; Fady I Malik; Ger J M Stienen; Anton Vonk-Noordegraaf; Frances S de Man; Coen A C Ottenheijm
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2016-05-17       Impact factor: 5.464

6.  Patterns of EMG activity of rat plantaris muscle during swimming and other locomotor activities.

Authors:  B J Jasmin; P F Gardiner
Journal:  J Appl Physiol (1985)       Date:  1987-08

7.  Activation of fast skeletal muscle troponin as a potential therapeutic approach for treating neuromuscular diseases.

Authors:  Alan J Russell; James J Hartman; Aaron C Hinken; Alexander R Muci; Raja Kawas; Lena Driscoll; Guillermo Godinez; Kenneth H Lee; David Marquez; William F Browne; Michael M Chen; David Clarke; Scott E Collibee; Marc Garard; Richard Hansen; Zhiheng Jia; Pu-Ping Lu; Hector Rodriguez; Khalil G Saikali; Julia Schaletzky; Vipin Vijayakumar; Daniel L Albertus; Dennis R Claflin; David J Morgans; Bradley P Morgan; Fady I Malik
Journal:  Nat Med       Date:  2012-02-19       Impact factor: 53.440

8.  Combined MRI and ³¹P-MRS investigations of the ACTA1(H40Y) mouse model of nemaline myopathy show impaired muscle function and altered energy metabolism.

Authors:  Charlotte Gineste; Yann Le Fur; Christophe Vilmen; Arnaud Le Troter; Emilie Pecchi; Patrick J Cozzone; Edna C Hardeman; David Bendahan; Julien Gondin
Journal:  PLoS One       Date:  2013-04-16       Impact factor: 3.240

9.  Muscle histopathology in nebulin-related nemaline myopathy: ultrastrastructural findings correlated to disease severity and genotype.

Authors:  Edoardo Malfatti; Vilma-Lotta Lehtokari; Johann Böhm; Josine M De Winter; Ursula Schäffer; Brigitte Estournet; Susana Quijano-Roy; Soledad Monges; Fabiana Lubieniecki; Remi Bellance; Mai Thao Viou; Angéline Madelaine; Bin Wu; Ana Lía Taratuto; Bruno Eymard; Katarina Pelin; Michel Fardeau; Coen A C Ottenheijm; Carina Wallgren-Pettersson; Jocelyn Laporte; Norma B Romero
Journal:  Acta Neuropathol Commun       Date:  2014-04-12       Impact factor: 7.801

Review 10.  Sarcomere Dysfunction in Nemaline Myopathy.

Authors:  Josine M de Winter; Coen A C Ottenheijm
Journal:  J Neuromuscul Dis       Date:  2017
View more
  1 in total

1.  Removal of MuRF1 Increases Muscle Mass in Nemaline Myopathy Models, but Does Not Provide Functional Benefits.

Authors:  Johan Lindqvist; Justin Kolb; Josine de Winter; Paola Tonino; Zaynab Hourani; Siegfried Labeit; Coen Ottenheijm; Henk Granzier
Journal:  Int J Mol Sci       Date:  2022-07-23       Impact factor: 6.208

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.