Literature DB >> 33859925

MicroRNA-520a Suppresses Pathogenesis and Progression of Non-Small-Cell Lung Cancer through Targeting the RRM2/Wnt Axis.

Yi Xie1, Congyu Xue2, Shuai Guo1, Lei Yang2.   

Abstract

MicroRNAs (miRNAs) regulate multiple cellular behaviors, and their aberrant expression is frequently associated with disease progression. This research focused on the effects of miR-520a on the development of non-small-cell lung cancer (NSCLC) and the molecules involved. Tumor and normal tissues from 24 patients with NSCLC were collected. Differentially expressed miRNAs between tumor tissues and normal tissues were screened using microarrays, and miR-520a was screened to be significantly poorly expressed in tumor samples. Artificial upregulation of miR-520a reduced proliferation, migration and invasion, and resistance to death of NSCLC A549 and H460 cells according to the MTT, EdU labeling, transwell, and flow cytometry assays, respectively. miR-520a upregulation suppressed growth and metastasis of xenograft tumors in vivo. The integrated bioinformatic analysis and dual luciferase assays suggested that miR-520a targeted ribonucleotide reductase subunit 2 (RRM2) mRNA and inactivated the Wnt/β-catenin signaling pathway in NSCLC cells. Upregulation of RRM2 enhanced the malignant behaviors of NSCLCs, but the oncogenic effects of RRM2 were blocked upon miR-520a overexpression. To conclude, this study evidenced that miR-520a inhibits NSCLC progression through suppressing RRM2 and the Wnt signaling pathway. This paper may offer novel insights into NSCLC treatment.
Copyright © 2021 Yi Xie et al.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 33859925      PMCID: PMC8026327          DOI: 10.1155/2021/9652420

Source DB:  PubMed          Journal:  Anal Cell Pathol (Amst)        ISSN: 2210-7177            Impact factor:   2.916


1. Introduction

Lung cancer (LC) is one of the most prevailing and life-threatening cancer types which is estimated to account for nearly a quarter of cancer-related mortality in 2020 [1]. According to the pathological type, LC is categorized into two major subtypes including non-small-cell lung cancer (NSCLC, accounting for nearly 85% of all cases) and small-cell lung cancer (15% of all cases) [2]. In China, LC has the highest mortality rate among all cancer types [3]. Despite the improvements in conventional therapeutic regimens including surgery, radiotherapy, and chemotherapy, the treating outcome of LC patients remains unfavorable [4]. A major reason is that a considerable number of LC patients are initially diagnosed at advanced stages with metastatic properties, and the overall 5-year survival rate of these patients is extremely low at about 5% [1]. Identifying key molecules involved in growth and metastasis of LC is of great importance to develop novel therapeutic options. Gene-based therapy has been a promising target for disease treatment and aroused wide concerns. Approximately, 97% of all human genomes are transcribed to noncoding (nc) RNAs and can regulate the molecular processes at DNA-RNA-protein levels [5]. MicroRNAs (miRNAs) are largely studied short ncRNAs renowned for their capacity in controlling the gene expression by primarily interacting with the 3′-UTR of target mRNAs [6]. Owing to the potent gene-modifying functions, miRNAs can regulate diverse fundamental cellular processes including apoptosis, proliferation, maintenance of cell differentiation, and tumorigenesis in several cancers including LC [7]. A microarray analysis in this study identified miR-520a as an aberrantly poorly expressed miRNA in NSCLC tissues. miR-520a has been demonstrated as a tumor inhibitor in many human malignancies [8-11]. Downregulation of miR-520-3p by other RNA transcripts has been suggested to facilitate the progression of NSCLC [12, 13]. However, the independent roles of miR-520a in NSCLC and the downstream molecules involved are not fully explored yet. Here, our integrated bioinformatic analyses suggested ribonucleotide reductase subunit 2 (RRM2) mRNA as a potential target transcript of miR-520a. RRM2 has shown oncogenic roles in many malignancies such as gastric cancer [14] and pancreatic cancer [15]. Herein, we hypothesized that miRNA-520a suppresses progression of NSCLC through inhibiting RRM2, and both cell and animal experiments were performed to validate this hypothesis.

2. Materials and Methods

2.1. Clinical Sample Collection

Twenty-four patients with NSCLC diagnosed and treated in Shandong Provincial Chest Hospital from January 2015 to January 2016 were recruited into the research. Patients with other chronic diseases, with a history of chemo/radio therapy, or with a family history of malignancy were excluded. The tumor tissues and the adjacent normal tissues (over 5 cm away from lesion sites) were resected during surgery and instantly frozen in liquid nitrogen and preserved at -80°C for further use. A three-year follow-up study was performed. This study was ratified and supervised by the Ethics Committee of Shandong Provincial Chest Hospital. Signed informed consent was collected from each eligible patient. The clinical characteristic information of all participants is presented in Table 1.
Table 1

Detailed characteristics of 24 patients with NSCLC.

ItemGroupn
GenderMale14
Female10
Age≤ 6011
> 6013
TNMI and II5
III and IV19
Lymph node metastasisNegative6
Positive18
Tumor size≤ 3 cm15
> 3 cm9
HistologyAdenocarcinoma10
Squamous cell carcinoma8
Others6

Note: TNM: tumor node metastasis.

2.2. Hematoxylin and Eosin (HE) Staining

The collected tissues from patients and liver and lung tissues from mice (see below) were embedded in paraffin and cut into 5-μm slices. The tissue slices were successively baked at 60°C for one hour, soaked in xylenes I, II, and III (10 minutes for each), dehydrated in an ascending series of alcohol for 5 minutes, and washed in water for 5 minutes. After that, the slices were stained in hematoxylin solution for 8 minutes, differentiated in 0.5% hydrochloric acid-ethanol mixture for 10 seconds, soaked in ammonia for 40 seconds, and then stained with 0.5% eosin for 5 minutes. After that, the slices were rehydrated in a decreasing series of alcohol, sealed with neutral balsam (96949-21-2, Solarbio, Science & Technology Co., Ltd., Beijing, China), and then observed under a microscope (BX53, Olympus Optical Co., Ltd, Tokyo, Japan) with 5 random fields selected. The nuclei were stained in blueish, while the cytoplasm in reddish. To each group, three slices from a same tissue sample were stained.

2.3. Microarray Analysis

Total RNA from 15 mg NSCLC and the adjacent tissues was extracted using a miRNeasy Kit (217061, Qiagen GmbH, Hilden, Germany) and a mirVana miRNA Isolation Kit (AM1560, Ambion, Austin, Texas, USA), respectively. The RNA purity was examined by Nano Drop (2000/2000C, Thermo Fisher Scientific, Carlsbad, CA, USA). Subsequently, 100 ng RNA was collected and labeled using a miRNA Complete Labeling and Hyb Kit (5190-0456, Agilent Technologies, Inc. Wakefield, MA, USA). Then, the samples were hybridized with Human V2 mi RNA Microarrays (G4470B, Agilent) at 200 rpm at 60°C for 20 hours. The images were scanned and analyzed using a DNA Microarray Scanner (G2505-60525, Agilent), while the data were obtained and analyzed by GeneSpring GX (V11.5, Agilent).

2.4. Bioinformatic Analysis

Data were analyzed using an R-Language Package (version 3.6.3). The microarray results were analyzed using a Limma Package (http://www.bioconductor.org/). Differentially expressed miRNAs between tumor and normal tissues were screened with ∣log2FC | >2.0 and p < 0.01 as the screening criteria. The heat map was produced using a pheatmap Package (https://cran.r-project.org/web/packages/pheatmap/index.html). The expression and prognostic value of miR-520a in NSCLC were first predicted on The Cancer Genome Atlas (TCGA, https://cancergenome.nih.gov/). Target mRNAs of miR-520a were predicted on several bioinformatic systems including StarBase (http://starbase.sysu.edu.cn/), TargetScan (http://www.targetscan.org), miRDB (http://www.mirdb.org), and miRbase (http://www.mirbase.org). The predicted results were compared using a gplot package (https://cran.r-project.org/web/packages/gplots/), and a Gene Ontology (GO) enrichment analysis was performed using a clusterProfiler package (http://www.bioconductor.org/).

2.5. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA from tissues and cells was extracted using the TRIzol Reagent (Thermo Fisher Scientific). Then, the RNA was reversely transcribed into cDNA using a high-capacity cDNA Reverse Transcription Kit (4368814, Thermo Fisher Scientific). Subsequently, real-time qPCR was performed using TaqMan microRNA assay kits (4427975, Thermo Fisher Scientific) on a 7900HT fast Real-time PCR system (Applied Biosystems, Foster City, CA). The fold change of the acquired data was measured using the 2- method. The primer sequences are exhibited in Table 2, in which U6 was used as the internal control for miRNA while GAPDH as the control for RRM2 mRNA.
Table 2

Primer sequences in RT-qPCR.

GenePrimer sequence (5′-3′)
miR-520aF: GCCACCACCATCAGCCATAC
R: GCACATTACTCTACTCAGAAGGG
RRM2F: CCTGACTGTAAATCGTCCAGTGGTA
R: AGTTTGGAAGCGACTGTAGGT
U6F: CTCGCAGCGCTTCGACA
R: ACTTGCGGCTTCACGAATT
GAPDHF: GATATATGATCAGTCATCTGC
R: TTGGATGATCTGGTTTAGCG

Note: RT-qPCR: reverse transcription quantitative polymerase chain reaction; RRM2: ribonucleotide reductase subunit 2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; F: forward; R: reverse.

2.6. Cell Culture and Transfection

Lung large cell carcinoma cell lines H273 (CRL-5917) and H460 (HTB-177), lung adenocarcinoma cell lines H23 (CRL-5800) and A549 (CCL-185), a normal pulmonary epithelial cell line 16HBE (PCS-300-010), and HEK293T (CRL-3216) cells were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultivated in RPMI-1640 (21870076, Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS, North Andover, MA, USA) at 37°C with 5% CO2. The miR-520 mimic and RRM2 overexpressing (OE) vector were synthesized by RiboBio Co., Ltd. (Guangzhou, Guangdong, China). Cell transfection was performed using a Lipofectamine 2000 DNA Transfection Reagent (11668027, Thermo Fisher Scientific). In brief, when the cell confluence reached 80%, the Lipofectamine Reagent was diluted in Opti-MEM, while another Opti-MEM was used to dilute DNA. The diluted DNA was mixed with the diluted Lipofectamine 2000 at a ratio of 1 : 1. After 5 minutes, the cells were filled with DNA-lipid compound and cultured at 37°C for 48 hours.

2.7. 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) Assay

Exponentially growing cells were resuspended to 5 × 104/mL. The cell suspension was sorted into 96-well plates at 100 μL per well till the cells reaching a density of 5 × 103 cells/well (the marginal pores were filled with sterile phosphate-buffered saline (PBS) to eliminate the potential edge effect). Three duplicated wells were set for each group. The plates were incubated in a 37°C incubator with 5% CO2. One plate was taken out every 24 hours for measurement. In brief, each well was filled with 20 μL MTT solution (M1025, Solarbio), and the cells were incubated for another 4 hours. Then, the culture medium in wells was discarded, and each well was further loaded with 150 μL dimethyl sulphoxide to fully dissolve the crystal violets. Then, the optical density at 570 nm of each well was determined using a microplate reader (Varioskan LUX, Thermo Fisher Scientific). The obtained data were analyzed to produce an MTT proliferation curve.

2.8. 5-Ethynyl-2′-Deoxyuridine (EdU) Labeling Assay

Exponentially growing cells were sorted into 6-well plates. When the cell confluence reached 80%, 10 μM EdU solution (Genecopoeia, USA) was loaded into each well. The cells were incubated for 2 hours, washed in PBS, fixed in 4% paraformaldehyde for 30 minutes, incubated in glycine solution, and rinsed with PBS containing 0.5% TritonX-100. Subsequently, the cells were incubated with Andy Fluor™ 555 azide (A004, Genecopoeia, USA) in the dark for 30 minutes, washed in methanol and PBS, and further incubated with 4′,6-diamidino-2-phenylindole (DAPI) for 20 minutes. The labeling was observed under a fluorescence microscope (XSP-BM13C, Shanghai CSOIF. Co., Ltd., Shanghai, China) at a ×400 magnification with 3 random fields included. The EdU-positive cells were stained in reddish, and all cells were stained in bluish by DAPI: the cell proliferation rate = number of proliferation cells/total cells × 100%.

2.9. Transwell Assay

The 24-well plates were used for transwell assays. The Matrigel gel (Corning, Corning, NY, USA) was diluted in serum-free RPMI-1640 at a ratio of 5 : 1 and then loaded onto the apical chamber (80 μL in each apical chamber) and maintained for 1-2 hours, while each basolateral chamber was filled with 500 μL 10% FBS-RPMI-1640. The cells were seeded into 24-well plates and incubated for 24 hours. The cells that invaded into lower membranes were fixed in 4% paraformaldehyde and stained by crystal violet staining solution (C0121, Beyotime Biotechnology Co., Ltd., Shanghai, China) for 10 minutes. The staining was observed under a microscope (BX53, Olympus Optical Co., Ltd., Tokyo, Japan) at a ×400 magnification with 5 random fields included. Cell migration was examined in a similar manner except for pre-coating of Matrigel gel on the apical chambers. The number of invading and migrating cells was counted, and the average value of 3 duplicated wells was calculated.

2.10. Flow Cytometry

Apoptosis of cells was determined by an Annexin V-FITC Apoptosis Detection Kit (15342-54, Nacalai, Tesque, Japan). After transfection, the cells were cultivated at 37°C with 5% CO2 for 48 hours, centrifuged at 1,000 rpm for 3 minutes, washed in PBS, and then centrifuged again. Then, 20 μL Annexin V Binding Buffer (×10) was added into 200 μL PBS. Cells were resuspended in PBS and then incubated with 10 μL Annexin V-FITC conjugate and 5 μL PI solution at room temperature in the dark for 15 minutes. Then, the cells were added with 300 μL binding buffer, and the excitation wavelength at 488 nm was determined using a flow cytometer (6028651, Beckman Coulter, USA).

2.11. Dual Luciferase Reporter Gene Assay

The 3′-UTR sequences of RRM2, SDC1, and YWHAZ mRNAs containing putative binding sequences with miR-520a were inserted to the pGL3 vectors (kl-zl-1031, Ke Lei Biological Technology Co., Ltd., Shanghai, China) to construct pGL3-based wide type (WT) vectors. The corresponding mutant type (MT) vectors were constructed as well using the mutant binding sequences. Well-constructed vectors were cotransfected with miR-520a mimic or mimic control in HEK293T cells using the Lipofectamine 2000 Kit. After 48 h, the cells were collected and lysed, and the relative luciferase activity in cells was evaluated using a Luciferase Reporter Assay Kit (K801-200, Biovision) and a Dual Luciferase Reporter Assay System (E1910, Promega, Madison, WI, USA).

2.12. Western Blot Analysis

Cells were centrifuged and washed in PBS and resuspended in Tris containing protease inhibitor (50 mM Tris-HCL, 150 mM NaCl). The protein concentration was determined using a Pierce™ BCA Protein Assay Kit (23225, Thermo Fisher Scientific). Then, an appropriate volume of protein was separated on 8%-12% SDS-PAGE and transferred onto PVDF membranes (LM-937D, LMAI Bio, Shanghai, China). The membranes were blocked and washed in 5% nonfat milk for 1 hour, followed by an incubation with the primary antibodies against B-cell lymphoma-2 (Bcl-2, 1 : 1,000, sc-7382, SANTA CRUZ, CA, USA), Bcl-2-associated x, (Bax, 1 : 5,000, sc-7480, SANTA CRUZ), caspase-3 (1 : 1,000, ab208161, Abcam, Inc., Cambridge, MA, USA), cleaved caspase-3 (1 : 500, ab2302, Abcam), β-catenin (1 : 1,000, ab208161, Abcam), cyclin D1 (1 : 500, sc-8396, SANTA CRUZ), and β-actin (1 : 1,000, #3700, Cell Signaling Technology) at 4°C for 16 hours. After that, the membranes were washed and further incubated with secondary antibodies to IgG (1 : 5,000, ab205719, Abcam) and cleaved caspase (1 : 10,000, ab205718, Abcam) at 20°C for 2 hours. The protein bands were developed using enhanced chemiluminescence western blotting substrate (PE0010, Solarbio), and the images were captured and analyzed using a Western Blot Imaging System (FluorChem M, ProteinSimple).

2.13. Growth of Xenograft Tumors in Nude Mice

A total of 12 female nude mice (strain: BALB/c; 3-4 weeks old, 14 ± 2 g) were purchased from the Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). The mice were fed at constant 25°C with 45% humidity with free access to food and water. The mice were randomly allocated into 4 groups: miR-520a control group (n = 3, each mouse were injected with A549 cells transfected with miR-520a control), miR-520a mimic group (n = 3, each mouse were injected with A549 cells transfected with miR-520a mimic), miR-520a control group (n = 3, each mouse were injected with H460 cells transfected with miR-520a control), and miR-520a mimic group (n = 3, each mouse were injected with H460 cells transfected with miR-520a mimic). For cell implantation, exponentially growing A549/H460 cells with stable transfection of miR-520a mimic or mimic control were adjusted to 1 × 107 cells/mL. Then, each mouse was transplanted with 20 μL cell suspension through axillary injection, and then the growth of tumor in vivo was photographed and recorded. The tumor volume (V) was recorded every 7 days as follows: V = a × b2/2 (where “a” refers to the long diameter while “b” refers to the short diameter), and a growth curve was produced. After 28 days, the mice were euthanized by overdose of 1% pentobarbital sodium (150 mg/kg), and the tumor was collected and weighed [16]. All procedures were performed in line with the guidelines of the Animal Ethics Committee of Shandong Provincial Chest Hospital. Great attempts were made to reduce the usage and pain of animals.

2.14. Tumor Metastasis in Nude Mice

Another 12 nude mice were numbered by weight and allocated into 4 groups again as performed above (n = 3 in each group). For tumor metastasis measurement, A549/H460 cells with stable transfection of miR-520a mimic or mimic control were injected into mice through caudal veins. The mice were euthanized in a similar manner on the 45th day after injection. Then, the lung and liver tissues of mice were collected, embedded in paraffin, and cut into slices for HE staining. The formation of metastatic nodules in the tissues was observed under the microscope with 5 nonoverlapping fields included.

2.15. Statistical Analysis

SPSS 22.0 (IBM Corp. Armonk, NY, USA) was used for data analysis. Measurement data were collected from three independent experiments and expressed as mean ± standard deviation (SD). Data between every two groups were analyzed using the t-test, while those among multiple groups were analyzed by one-way or two-way analysis of variance (ANOVA) followed with Tukey's multiple comparison test. The p value was obtained from two-tailed tests, and p < 0.05 was regarded to show statistical significance.

3. Results

3.1. miR-520a Is Poorly Expressed in NSCLC Tissues and Cells

Tissue samples from three NSCLC patients were collected for HE staining and miRNA microarray analysis. The staining results suggested that the cells in the NSCLC tissues showed destructed cell structure and shrinking nuclei, indicating severe injury in lungs (Figure 1(a)). Then, the RNA samples extracted from three pairs of tissues were used for microarray analysis. Importantly, miR-520a was found to be significantly downregulated in the NSCLC tumor tissues compared to the adjacent tissues (Figure 1(b)). To validate this, tissues from all 24 patients were used for RT-qPCR. Consequently, poor expression of miR-520a was found in the NSCLC tissues compared to the paired adjacent tissues (Figure 1(c)). The follow-up study results suggested that patients with higher levels of miR-520a had better prognosis and longer lifetime (Figure 1(d)). In addition, the miR-520a expression in NSCLC cell lines H273, H23, A549, and H460 and in normal pulmonary epithelial cells 16HBE was determined by RT-qPCR as well. It was found that all NSCLC cell lines showed the decreased miR-520a expression relative to the 16 HBE cells (Figure 1(e)). Among them, the A549 and H460 cells showing the lowest expression of miR-520a were transfected with miR-520a mimic or mimic control for subsequent use (Figure 1(f)). In addition, according to the data from the TCGA database, miR-520a was poorly expressed in NSCLC (Figure 1(g)), and the poor expression of miR-520a indicated unfavorable prognosis in patients with NSCLC (Figure 1(h)). These results suggested that miR-520a might have prognostic value in NSCLC.
Figure 1

miR-520a is poorly expressed in NSCLC tissues and cells. (a) NSCLC tissues and the adjacent normal tissues observed by HE staining. (b) Differentially expressed miRNAs between cancer and the adjacent normal tissues screened out by miRNA microarray analysis. (c) The miR-520a expression in NSCLC and the adjacent normal tissues determined by RT-qPCR (∗p < 0.05, two-way ANOVA). (d) Overall survival rate of patients with different levels of miR-520a according to a 3-year followed-up study. (e) The miR-520a expression in NSCLC cell lines and in normal pulmonary epithelial cell line 16HBE determined by RT-qPCR (∗p < 0.05, one-way ANOVA). (f) The miR-520a expression in A549 and H460 cells after miR-520a mimic/control transfection determined by RT-qPCR (∗p < 0.05, two-way ANOVA). (g) The expression of miR-520a in NSCLC predicted on the TCGA database. (h) Relevance of miR-520a to the survival of patients predicted on the TCGA database.

3.2. Artificial Upregulation of miR-520a Inhibits NSCLC Progression

Subsequently, we found that the overexpression of miR-520a by miRNA mimic led to a significant decline in the number of EdU-positive A549 and H460 cells (Figure 2(a)). The MTT assay results suggested that the number of proliferative A549 and H460 cells were reduced following the miR-520a overexpression (Figure 2(b)). As for cell migration and invasion, the transwell assay results suggested that the migration and invasion abilities of both A549 and H460 cell were decreased upon the miR-520a overexpression (Figures 2(c) and 2(d)). In addition, the flow cytometry results suggested that the overexpression of miR-520 increased the number of Annexin V- and PI-positive cells, namely increased apoptosis of A549 and H460 cells (Figure 2(e)). From the molecular perspective, it was found that miR-520a mimic decreased the level of Bcl-2 but increased the levels of Bax and cleaved caspase-3 (Figure 2(f)). Collectively, these results suggested that miR-520a inhibits the malignant behaviors of NSCLC cells.
Figure 2

Artificial upregulation of miR-520a inhibits NSCLC progression. (a) Viability of A549 and H460 cells determined by the EdU labeling assay (∗p < 0.05, two-way ANOVA). (b) Proliferation of A549 and H460 cells after miR-520a transfection determined by the MTT assay (∗p < 0.05, two-way ANOVA). (c, d) Changes in number of migrating (c) and invading cells (d) detected using the transwell assays (∗p < 0.05, two-way ANOVA). (e) The apoptosis rate of A549 and H460 cells determined by flow cytometry (∗p < 0.05, two-way ANOVA). (f) Protein levels of apoptosis-related factors Bcl-2, Bax, caspase-3, and cleaved caspase-3 determined by western blot analysis (∗p < 0.05, two-way ANOVA).

3.3. miR-520a Directly Binds to RRM2 to Mediate the Wnt Signaling Pathway

To further identify the potential downstream molecules implicated, we first predicted that the target mRNAs of miR-520a on several bioinformatic systems including StarBase, TargetScan, miRDB and miRBase, and 219 mRNAs were found to be intersected (Figure 3(a)). Then, a GO enrichment analysis was performed based on these genes, which identified that the Wnt signaling was highly enriched (Figure 3(b)), and 18 genes were enriched in this signaling pathway. Then, the levels of Wnt signaling pathway-related factors cyclin D1 and β-catenin in A549 and H460 cell lines were measured. The western blot analysis results showed that the cyclin D1 and β-catenin levels in both cells were declined following the miR-520a overexpression (Figure 3(c)), indicating that miR-520a inactivated the Wnt signaling. Subsequently, we tested the expression of mRNAs enriching on the Wnt signaling in tissues using RT-qPCR. It was found that the expression of SDC1, YWHAZ, and RRM2 was significantly increased in tumor tissues as compared to the paired normal tissues (Figure 3(d)). Then, the luciferase assays validated that only RRM2 presented a binding relationship with miR-520a (Figure 3(e)). The correlation analysis suggested that the expression of miR-520a was negatively correlated with expression of RRM2 mRNA in NSCLC tumor tissues (Figure 3(f)). In concert with the above findings, the RRM2 expression was found higher in NSCLC cell lines than that in 16HBE cells (Figure 3(g)). Also, miR-520a mimic was found to decrease the RRM2 expression in A549 and H460 cells (Figure 3(h)). In addition, the overexpression of RRM2 in cells increased the levels of cyclin D1 and β-catenin in A549 and H460 cells (Figure 3(i)), indicating that miR-520a inactivates the Wnt signaling pathway possibly through downregulating the RRM2 expression.
Figure 3

miR-520a directly binds to RRM2 to mediate the Wnt signaling pathway. (a) A Venn diagram for the intersected target mRNAs of miR-520a predicted on StarBase, TargetScan, miRDB, and miRbase. (b) The enriched signaling pathway by the putative mRNAs identified by GO enrichment analysis. (c) Protein levels of cyclin D1 and β-catenin in A549 and H460 cells after miR-520a mimic transfection determined by western blot analysis (∗p < 0.05, two-way ANOVA). (d) The expression of Wnt-enriched mRNAs in NSCLC tumor tissues determined by RT-qPCR (∗p < 0.05, two-way ANOVA). (e) Binding relationships between miR-520a and SDC1, YWHAZ, or RRM2 validated through dual-luciferase reporter gene assays (∗p < 0.05, two-way ANOVA). (f) Correlation analysis of the RRM2 and miR-520a expression in tumor tissues. (g) The RRM2 expression in NSCLC cell lines H273, H23, A549, and H460 and in normal pulmonary epithelial cell line 16HBE determined by RT-qPCR (∗p < 0.05, one-way ANOVA). (h) The RRM2 expression in A549 and H460 cells after miR-520a mimic transfection detected by RT-qPCR (∗p < 0.05, two-way ANOVA). (i) Protein levels of cyclin D1 and β-catenin in A549 and H460 cells after the RRM2 overexpression determined by western blot analysis (∗p < 0.05, two-way ANOVA).

3.4. miR-520a Inhibits the Oncogenic Effects of RRM2 on NSCLC Progression

To confirm the involvement of RRM2 in the miR-520a-mediated events, A549 and H460 cells transfected with RRM2 OE vector were further transfected with miR-520a mimic (Figure 4(a)). It was found that the cell viability increased by RRM2 was reversed after further upregulation of miR-520a (Figure 4(b)). In addition, cotransfection of miR-520a and RRM2 OE vector decreased the number of migrating and invading cells, and it increased the number of apoptotic cells compared to transfection of RRM2 OE vector alone (Figures 4(c)–4(e)). These results, collectively, validated that miR-520a directly binds to RRM2 to inhibit the malignant behaviors of NSCLC cells.
Figure 4

miR-520a inhibits the oncogenic effects of RRM2 on NSCLC progression. (a) The miR-520a expression in A549 and H460 cells cotransfected with RRM2-OE and miR-520a mimic/control determined by RT-qPCR. (b) Viability of cells determined by the EdU labeling assay. (c, d) Number of migrating (c) and invading (d) cells determined by transwell assays. (e) The apoptosis rate of cells determined by flow cytometry; in all panels, ∗p < 0.05, two-way ANOVA.

3.5. miR-520a Inhibits Tumor Growth and Metastasis In Vivo

A549 and H460 cells with stable miR-520a mimic/control transfection were implanted into nude mice through axillary injection (for growth measurement) or tail vein injection (for metastasis measurement). The tumor volume in mice was measured every 7 days. It was found that the overexpression of miR-520a significantly reduced the tumor growth rate in mice (Figure 5(a)). Twenty-eight days later when the mice were euthanized, it was found that miR-520a mimic also reduced the tumor weight in nude mice (Figure 5(b)). In addition, the HE staining results showed that the number of metastatic nodules in lung (Figure 5(c)) and liver (Figure 5(d)) tissues was decreased by miR-520a mimic.
Figure 5

miR-520a inhibits tumor formation and metastasis in nude mice. (a) Role of miR-520a mimic in tumor volume changes (∗p < 0.05, two-way ANOVA). (b) Role of miR-520a mimic in tumor weight change (∗p < 0.05, two-way ANOVA). (c, d) Formation of metastatic nodules in lung (c) and liver (d) nodules in rats (∗p < 0.05, two-way ANOVA).

4. Discussion

NSCLC remains the most prevailing cancer and consequently the biggest cause of cancer-related morbidity worldwide, leaving understanding the biology of NSCLC and identifying novel molecules involved in pathogenesis of great urgency [17]. miRNA-targeted therapies, including miRNA replacement and miRNA reduction where oligonucleotides, virus-based constructs, or small molecule compounds are administrated to restore the expression of suppressive miRNAs or inhibit expression of oncogenic miRNAs, have aroused increasing concerns in LC treatment [18]. The present study suggested that miR-520a played potent tumor suppressing roles in NSCLC in both cell models and animal models through the downregulation of RRM2 and inactivation of the Wnt signaling. Aberrant expression of miRNA is often linked to the onset and development of diseases including cancers [19]. Here, a miRNA microarray analysis and RT-qPCR results suggested that miR-520a was downregulated in NSCLC tumor samples. A higher level of miR-520a was associated with a better prognosis in NSCLC patients and artificial upregulation of miR-520a inhibited proliferation, migration, invasion, and resistance to death of NSCLC cell lines. There is increasing evidence that emphasized the core functions of miRNAs, either oncogenic or antioncogenic, in NSCLC pathogenesis. For instance, miR-218 was reported as a strong tumor suppressor in NSCLC which inhibited the malignant behaviors of NSCLC cells and tumor growth by targeting interleukin-6 receptor and JAK3 [20]. miR-421 was found as an oncogene and promoted proliferation and invasion potentials in NSCLC cells by targeting PCDC4 [21]. As for miR-520a, it has been reported as a tumor suppressor in many neoplastic diseases. Upregulation of miR-520a-3p by lidocaine, for example, has been found to block proliferation and trigger apoptosis of colorectal cancer cells [22]. Similar tumor-suppressing functions of miR-520a have been evidenced in osteosarcoma [23] and breast cancer [24]. This is also true for NSCLC. Recent studies have noted that downregulation of miR-520a by other RNA transcripts increased proliferation, migration, and invasion of NSCLC cells [12, 13, 25]. Likewise, a previous study by Lv X et al. suggested that miR-520a-3p suppressed growth and aggressiveness of NSCLC cells through mediating the PI3K/AKT/mTOR signaling pathway [26]. Here, our study validated the anticancer roles of miR-520a in NSCLC cells. In addition, animal experiments were further performed in our study, by which we confirmed that upregulation of miR-520a suppressed the growth and metastasis of xenograft tumors formed by NSCLC cells in vivo. Subsequently, 219 candidate target mRNAs of miR-520a were predicted using an integrated bioinformatic analysis. Then, a GO enrichment analysis confirmed that the Wnt signaling pathway was enriched by these mRNAs. The Wnt signaling is an evolutionary highly conserved signaling pathway that is important for the development and homeostasis, and its aberrant activation is a critical factor in the onset, maintenance, and development of many cancers [27-29]. There is no exception for NSCLC, and Wnt inactivation has been reviewed as a promising therapeutic option for NSCLC treatment [30, 31]. Intriguingly, miR-520a has been demonstrated as one of the core miRNAs mediating the sensitivity of esophageal squamous cell carcinoma cells to neoadjuvant chemoradiotherapy through the Wnt signaling pathway [32]. Here, in this paper, we found that miR-520a decreased the levels of cyclin D1 and β-catenin in NSCLC cells, indicating the implication of Wnt defect in the miR-520a-mediated events. Furthermore, our study found that SDC1, YWHAZ, and RRM2 were enriched on this signaling pathway, while only RRM2 was confirmed to have a binding relationship with miR-520a according to the luciferase assays. RRM2 is a cell cycle dependent factor that was suggested to play oncogenic roles in many cancers such as adrenocortical cancer [33], glioma [34], and neuroblastoma [35]. Interestingly, RRM2 has also been involved in several ceRNA networks, and its upregulation has been found to trigger cell proliferation, drug resistance, and tumor growth in NSCLC [36, 37]. Importantly, artificial upregulation of RRM2 in cells promoted cell viability, migration, invasion, and resistance to apoptosis. Accordingly, further experiments found that overexpression of miR-520a blocked the above events, indicating that RRM2 is a downstream target of miR-520a during its regulation in NSCLC progression. Interestingly, RRM2 silencing has been suggested to inactivate the Wnt/β-catenin signaling pathway by enhancing phosphorylation of glucose synthase kinase 3β [38]. Collectively, miR-520a possibly suppresses the RRM2/Wnt/β-catenin axis to block progression of NSCLC.

5. Conclusions

To sum up, the current study evidenced that miR-520a could inhibit malignant behaviors of cells and tumor growth in NSCLC by directly binding to RRM2 and the subsequent Wnt signaling defect. These findings can provide novel insights into the gene-based therapy for NSCLC treatment that miR-520a may serve as a potential tool while RRM2 may serve as a potential therapeutic target in the clinical practice. However, the sample size in this study was not that huge since a larger sample size is being analyzed but the three-year follow-up study of those patients has not been completed yet. We further analyzed the evaluation of the power of this research using the Minitab software. According to the data form the TCGA Database, the D value of the miR-520 expression between cancer tissues and normal tissues was 0.18, the SD was 0.25, and the power value we defined was 0.8 (a large effect size). In this setting, a sample size of 18 can indicate the significance of the statistical results. We would like to include data from a larger sample size in our future researches. We also hope more researches in this field will be conducted to develop more understandings to improve the therapeutic efficacy in NSCLC treatment.
  37 in total

1.  LINC01116 targets miR-520a-3p and affects IL6R to promote the proliferation and migration of osteosarcoma cells through the Jak-stat signaling pathway.

Authors:  Butian Zhang; Lili Yu; Ning Han; Zhenzhen Hu; Shuang Wang; Lei Ding; Jinlan Jiang
Journal:  Biomed Pharmacother       Date:  2018-08-08       Impact factor: 6.529

2.  Long noncoding RNA SOX21-AS1 regulates the progression of triple-negative breast cancer through regulation of miR-520a-5p/ORMDL3 axis.

Authors:  Xia Liu; Jingyong Song; Yu Kang; Yaojia Wang; Anyue Chen
Journal:  J Cell Biochem       Date:  2020-04-10       Impact factor: 4.429

Review 3.  Systemic Therapy for Locally Advanced and Metastatic Non-Small Cell Lung Cancer: A Review.

Authors:  Kathryn C Arbour; Gregory J Riely
Journal:  JAMA       Date:  2019-08-27       Impact factor: 56.272

Review 4.  Aberrant regulation and function of microRNAs in cancer.

Authors:  Brian D Adams; Andrea L Kasinski; Frank J Slack
Journal:  Curr Biol       Date:  2014-08-18       Impact factor: 10.834

5.  Cell cycle dependent RRM2 may serve as proliferation marker and pharmaceutical target in adrenocortical cancer.

Authors:  Vince Kornél Grolmusz; Katalin Karászi; Tamás Micsik; Eszter Angéla Tóth; Katalin Mészáros; Gellért Karvaly; Gábor Barna; Péter Márton Szabó; Kornélia Baghy; János Matkó; Ilona Kovalszky; Miklós Tóth; Károly Rácz; Péter Igaz; Attila Patócs
Journal:  Am J Cancer Res       Date:  2016-09-01       Impact factor: 6.166

Review 6.  New advances in antiangiogenic combination therapeutic strategies for advanced non-small cell lung cancer.

Authors:  Huiping Qiang; Qing Chang; Jianlin Xu; Jialin Qian; Yanwei Zhang; Yuqiong Lei; Baohui Han; Tianqing Chu
Journal:  J Cancer Res Clin Oncol       Date:  2020-02-17       Impact factor: 4.553

7.  Cancer statistics in China, 2015.

Authors:  Wanqing Chen; Rongshou Zheng; Peter D Baade; Siwei Zhang; Hongmei Zeng; Freddie Bray; Ahmedin Jemal; Xue Qin Yu; Jie He
Journal:  CA Cancer J Clin       Date:  2016-01-25       Impact factor: 508.702

8.  HOTAIR, a long noncoding RNA, is a marker of abnormal cell cycle regulation in lung cancer.

Authors:  Minghui Liu; Hongyi Zhang; Ying Li; Rui Wang; Yongwen Li; Hongbing Zhang; Dian Ren; Hongyu Liu; Chunsheng Kang; Jun Chen
Journal:  Cancer Sci       Date:  2018-09       Impact factor: 6.716

9.  RRM2 is a potential prognostic biomarker with functional significance in glioma.

Authors:  Hongzhi Sun; Bingya Yang; Hao Zhang; Jingwei Song; Yenan Zhang; Jicheng Xing; Zhihui Yang; Changyong Wei; Tuoye Xu; Zhennan Yu; Zhipeng Xu; Min Hou; Minjun Ji; Yansong Zhang
Journal:  Int J Biol Sci       Date:  2019-01-01       Impact factor: 6.580

10.  Ropivacaine Inhibits the Growth, Migration and Invasion of Gastric Cancer Through Attenuation of WEE1 and PI3K/AKT Signaling via miR-520a-3p.

Authors:  Nianliang Zhang; Xiangji Xing; Fengcai Gu; Gang Zhou; Xianglan Liu; Baoqiang Li
Journal:  Onco Targets Ther       Date:  2020-06-09       Impact factor: 4.147

View more
  5 in total

1.  MicroRNA-582-3p targeting ribonucleotide reductase regulatory subunit M2 inhibits the tumorigenesis of hepatocellular carcinoma by regulating the Wnt/β-catenin signaling pathway.

Authors:  Hui Xu; Bin Li
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

2.  High RRM2 expression has poor prognosis in specific types of breast cancer.

Authors:  Shen-Chao Shi; Yi Zhang; Tao Wang
Journal:  PLoS One       Date:  2022-03-15       Impact factor: 3.240

3.  miR-29a-3p inhibits the malignant characteristics of non-small cell lung cancer cells by reducing the activity of the Wnt/β-catenin signaling pathway.

Authors:  Kang Zhang; Xiaoliang Han; Wenbin Hu; Chao Su; Binjun He
Journal:  Oncol Lett       Date:  2022-09-12       Impact factor: 3.111

4.  Circ_0039908/miR-let-7c/RRM2 axis was identified played an important role in lung adenocarcinoma by integrated analysis.

Authors:  Weijie Zhang; Jun Chen; Yue Li; Ruochen Zhang; Anqi Wang; Yuanyuan Zeng; Jianjie Zhu; Zeyi Liu; Jian-An Huang
Journal:  J Cancer       Date:  2022-07-18       Impact factor: 4.478

5.  Exosome-derived microRNA-433 inhibits tumorigenesis through incremental infiltration of CD4 and CD8 cells in non-small cell lung cancer.

Authors:  Boyang Liu; Ruiping Zhang; Yungang Zhu; Ruisheng Hao
Journal:  Oncol Lett       Date:  2021-06-15       Impact factor: 2.967

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.