| Literature DB >> 33816591 |
Haidong Wei1, Lei Pan1, Chun Li2, Peng Zhao1, Jianhong Li2, Runxiang Zhang1,3, Jun Bao1,3.
Abstract
To evaluate dietary ass="Species">soybean <ass="Chemical">span class="Chemical">oil supplementation on production performance, egg quality, and keel bone health in laying hens. Two hundred and four laying hens at 20 weeks of age (WOA) were distributed into 12 cages containing 17 birds each. Birds were either fed a commercial diet (control group, CON) or a diet supplemented with 3% of soybean oil (SO group). Experiments lasted 17 weeks. Body weight, daily feed intake, production performance and egg quality were measured at 25, 29, 33, and 37 WOA. Birds were subsequently assessed for keel bone status by palpation, and keel was excised to measure bone length, microstructure, bone mineral density (BMD), elements contents, and the expression of osteoprotegerin (OPG), receptor activator of nuclear factor kappa-B ligand (RANKL), collagen type II alpha 1 (COL2α1), periostin (POSTN), and sclerostin (SOST). The results showed that dietary SO supplementation did not affect production performance and egg quality (P > 0.05), but improved body weight of hens at 29 and 37 WOA (P < 0.05), and decreased daily feed intake at 33 and 37 WOA (P < 0.05). Incidence of keel bone damage (especially fracture) was higher in hens of SO group. Keel bone length in birds of SO group was significantly decreased compared to CON (P < 0.05). Keel bone of supplemented hens showed increased trabecular separation at 29 WOA and higher levels of V, Mn, Fe, Se, and Ba at 33 WOA (P < 0.05). Moreover, decreased BMD, trabecular number and thickness were observed in keel bone of laying hens receiving supplementation at 29 and 37 WOA (P < 0.05); decreased levels of Li, Ca, Hg, and TI at 33 WOA and trabecular thickness at 37 WOA (P < 0.05) were also identified. mRNA levels of SOST and RANKL and the ratio of RANKL/OPG mRNA levels were increased in birds fed a SO-supplemented diet (P < 0.05); COL2α1, OPG, and POSTN were downregulated at all sampling points (P < 0.05). Taken together, results indicate that feeding laying hens a diet supplemented with soybean oil can decrease daily feed intake and impair keel bone health but not influence production performance and egg quality.Entities:
Keywords: diet; keel bone health; laying hen; production performance; soybean oil
Year: 2021 PMID: 33816591 PMCID: PMC8017272 DOI: 10.3389/fvets.2021.657585
Source DB: PubMed Journal: Front Vet Sci ISSN: 2297-1769
Ingredients and nutrient composition of the diets.
| Corn (8.7% CP) | 63.6 | 54.2 |
| Soybean meal (44.2% CP) | 20.5 | 21.1 |
| Wheat bran (14.3% CP) | 4.80 | 10.6 |
| Soybean oil | 0.00 | 3.00 |
| Limestone | 8.50 | 8.50 |
| Calcium hydrogen phosphate | 1.04 | 1.04 |
| Sodium chloride | 0.38 | 0.38 |
| DL-Methionine | 0.18 | 0.18 |
| Vitamin-mineral premix | 1.00 | 1.00 |
| Total | 100 | 100 |
| Metabolic energy (MJ/kg) | 11.4 | 11.4 |
| Crude protein (CP) | 15.3 | 15.6 |
| Calcium | 3.37 | 3.37 |
| Total phosphorus | 0.53 | 0.55 |
| Available phosphorus | 0.30 | 0.31 |
| Lysine | 0.72 | 0.73 |
| Methionine | 0.41 | 0.41 |
Vitamin–mineral premix provided the following per kilogram of mixed feed: Mn, 50.18 mg; Zn, 40.22 mg; Fe, 40.14 mg; Cu, 6.10 mg; I, 0.29 mg; Se, 0.18 mg; vitamin A, 12,500 IU; vitamin D3, 3,750 IU; vitamin E, 15 IU; vitamin K3, 2.5 mg; vitamin B1, 2.5 mg; vitamin B2, 7.0 mg; vitamin B6, 3.75 mg; vitamin B12, 0.015 mg; folic acid, 1.0 mg; pantothenic acid, 12.5 mg; niacin, 25 mg; and biotin, 0.075 mg.
Parameter conditions for inductively coupled plasma mass spectrometry (ICP-MS).
| Frequency (Hz) | 27.1 |
| Reflect power (W) | 1550 |
| Carrier gas flow rate (L/min) | 1.05 |
| Plasma gas flow rate (L/min) | 14.0 |
| Auxiliary gas rate (L/min) | 0.80 |
| Spray chamber temperature (°?) | 2.70 |
| Sampling depth (mm) | 6.00 |
| Nebulizer pump (r/min) | 40.0 |
Primer sequences of each gene for qRT-PCR.
| OPG | Forward: ATCTCAGTCAAGTGGAGCATC | |
| RANKL | Forward: AGGAGAAATAAGCCCGAGAA | |
| COL2α1 | Forward: GGCTTTGATGCAGAATACTACCG | |
| SOST | Forward: CGTCCTCATCCAAATCGCATCCC | |
| POSTN | Forward: TGGAGCTGTCTATGAAACTTTGG | |
| β-actin | Forward: CACGATCATGTTTGAGACCTT |
OPG, osteoprotegerin; RANKL, receptor activator of nuclear factor kappa-B ligand; COL2α1, collagen type II alpha 1; POSTN, periostin; SOST, sclerostin.
Body weight, daily feed intake and production performance of laying hens fed a commercial diet (control group, CON) or a soybean oil-supplemented diet (SO).
| 25 | 1.22 ± 0.03 | 1.26 ± 0.02 | 0.24 | |
| 29 | 1.38 ± 0.03 | 1.47 ± 0.03 | 0.04 | |
| 33 | 1.50 ± 0.04 | 1.54 ± 0.04 | 0.34 | |
| 37 | 1.54 ± 0.03 | 1.65 ± 0.02 | 0.01 | |
| 25 | 126 ± 1.41 | 126 ± 1.22 | 0.98 | |
| 29 | 129 ± 0.96 | 127 ± 1.72 | 0.29 | |
| 33 | 131 ± 0.79 | 125 ± 1.04 | <0.01 | |
| 37 | 131 ± 0.96 | 126 ± 1.39 | 0.01 | |
| 25 | 42.4 ± 1.22 | 42.0 ± 1.21 | 0.83 | |
| 29 | 70.2 ± 1.42 | 71.6 ± 0.75 | 0.43 | |
| 33 | 82.3 ± 1.48 | 84.6 ± 1.34 | 0.28 | |
| 37 | 85.2 ± 1.21 | 85.8 ± 1.70 | 0.78 | |
| 25 | 6.50 ± 0.90 | 6.61 ± 0.58 | 0.93 | |
| 29 | 2.52 ± 0.60 | 4.36 ± 0.59 | 0.06 | |
| 33 | 0.91 ± 0.61 | 2.72 ± 0.55 | 0.06 | |
| 37 | 0.71 ± 0.43 | 1.39 ± 0.64 | 0.41 | |
Values were expressed as the mean ± SEM.
Comparison of egg quality in laying hens fed a commercial diet (control group, CON) or a soybean oil-supplemented diet (SO).
| 25 | 51.8 ± 1.10 | 51.8 ± 0.79 | 0.97 | |
| 29 | 52.3 ± 1.37 | 52.6 ± 0.92 | 0.87 | |
| 33 | 55.4 ± 1.09 | 56.7 ± 1.07 | 0.39 | |
| 37 | 60.8 ± 1.18 | 63.9 ± 1.32 | 0.08 | |
| 25 | 4.03 ± 0.07 | 4.13 ± 0.11 | 0.44 | |
| 29 | 4.16 ± 0.09 | 4.33 ± 0.12 | 0.27 | |
| 33 | 4.24 ± 0.13 | 4.44 ± 0.11 | 0.25 | |
| 37 | 4.61 ± 0.16 | 4.67 ± 0.12 | 0.76 | |
| 25 | 0.39 ± 0.01 | 0.39 ± 0.01 | 0.76 | |
| 29 | 0.37 ± 0.01 | 0.39 ± 0.01 | 0.29 | |
| 33 | 0.38 ± 0.01 | 0.38 ± 0.01 | 0.91 | |
| 37 | 0.40 ± 0.01 | 0.39 ± 0.01 | 0.47 | |
| 25 | 5.83 ± 0.31 | 5.85 ± 0.25 | 0.97 | |
| 29 | 6.54 ± 0.24 | 7.02 ± 0.29 | 0.21 | |
| 33 | 7.70 ± 0.12 | 7.88 ± 0.29 | 0.58 | |
| 37 | 8.31 ± 0.22 | 8.56 ± 0.26 | 0.49 | |
| 25 | 63.6 ± 3.85 | 65.5 ± 2.83 | 0.69 | |
| 29 | 69.9 ± 4.04 | 72.3 ± 3.20 | 0.65 | |
| 33 | 82.5 ± 2.60 | 84.5 ± 2.63 | 0.59 | |
| 37 | 89.5 ± 1.37 | 91.5 ± 1.05 | 0.27 | |
Values were expressed as the mean ± SEM, n = 12.
Figure 1Percentages of laying hens fed a commercial diet (control group, CON) or a soybean oil-supplemented diet (SO) presenting normal keel bone (NK), deviated keel bone (DK), and fractured keel bone (FK) at different sampling points.
Length (mm) of keel bone of laying hens in control (CON) and soybean oil (SO) groups.
| 25 weeks of age | 100 ± 0.89 | 96.8 ± 1.04 | 0.03 |
| 29 weeks of age | 100 ± 1.12 | 96.8 ± 0.87 | 0.03 |
| 33 weeks of age | 102 ± 0.84 | 97.1 ± 1.86 | 0.03 |
| 37 weeks of age | 103 ± 1.00 | 97.8 ± 1.17 | 0.01 |
Values were expressed as mean ± SEM, n = 12.
Keel bone microstructure parameters and bone mineral density of laying hens in control (CON) and soybean oil (SO) groups.
| BV/TV (%) | 0.73 ± 0.05 | 0.70 ± 0.05 | 0.68 | 0.66 ± 0.04 | 0.70 ± 0.07 | 0.65 |
| BS/BV (1/mm) | 6.73 ± 0.63 | 7.11 ± 0.48 | 0.64 | 6.73 ± 0.60 | 6.32 ± 1.21 | 0.77 |
| Tb.N (1/mm) | 5.14 ± 0.16 | 4.36 ± 0.24 | 0.03 | 4.41 ± 0.32 | 3.51 ± 0.25 | 0.05 |
| Tb.Th (mm) | 0.36 ± 0.10 | 0.23 ± 0.01 | 0.28 | 0.27 ± 0.02 | 0.21 ± 0.02 | 0.04 |
| Tb.Sp (mm) | 0.16 ± 0.01 | 0.20 ± 0.01 | 0.01 | 0.21 ± 0.02 | 0.27 ± 0.03 | 0.12 |
| Conn.Dn (1/mm3) | 29.2 ± 4.03 | 21.9 ± 3.19 | 0.19 | 22.6 ± 2.30 | 16.8 ± 1.65 | 0.07 |
| DA | 1.91 ± 0.23 | 1.60 ± 0.06 | 0.22 | 1.96 ± 0.14 | 1.75 ± 0.10 | 0.25 |
| BMD (mg HA/cm3) | 643 ± 12.1 | 611 ± 5.14 | 0.04 | 633 ± 12.5 | 585 ± 8.48 | 0.01 |
Values were expressed as mean ± SEM, n = 6.
BV/TV, bone volume/tissue volume; BS/BV, bone surface/bone volume; Tb.N, trabecular number; Tb.Th, trabecular thickness; Tb.Sp, trabecular separation; Conn.Dn, connectivity density; DA, degree of anisotropy; BMD, bone mineral density.
Elements concentration in keel bones of laying hens in control (CON) and soybean oil (SO) groups.
| Li | mg/kg | 0.17 ± 0.01 | 0.11 ± 0.01 | 0.01 |
| B | mg/kg | 1.07 ± 0.06 | 1.06 ± 0.03 | 0.83 |
| Na | g/kg | 5.56 ± 0.41 | 5.42 ± 0.28 | 0.79 |
| Mg | g/kg | 2.50 ± 0.21 | 2.48 ± 0.22 | 0.95 |
| Al | mg/kg | 9.77 ± 1.34 | 7.33 ± 0.55 | 0.13 |
| Si | mg/kg | 235 ± 9.66 | 225 ± 12.3 | 0.51 |
| P | g/kg | 121 ± 12.5 | 120 ± 10.7 | 0.93 |
| K | g/kg | 3.29 ± 0.07 | 4.18 ± 0.49 | 0.11 |
| Ca | g/kg | 368 ± 10.9 | 323 ± 14.2 | 0.04 |
| Ti | g/kg | 0.64 ± 0.05 | 0.81 ± 0.06 | 0.07 |
| V | mg/kg | 0.30 ± 0.02 | 0.40 ± 0.04 | 0.04 |
| Cr | mg/kg | 3.96 ± 0.56 | 4.72 ± 0.58 | 0.37 |
| Mn | mg/kg | 7.08 ± 0.55 | 9.38 ± 0.28 | 0.01 |
| Fe | mg/kg | 96.7 ± 7.18 | 130 ± 8.62 | 0.02 |
| Co | μg/kg | 25.6 ± 2.32 | 22.7 ± 0.69 | 0.26 |
| Ni | mg/kg | 0.34 ± 0.02 | 0.30 ± 0.03 | 0.31 |
| Cu | mg/kg | 0.69 ± 0.03 | 0.75 ± 0.06 | 0.46 |
| Zn | mg/kg | 143 ± 4.44 | 155 ± 11.9 | 0.35 |
| As | μg/kg | 50.3 ± 3.39 | 45.6 ± 2.37 | 0.28 |
| Se | mg/kg | 0.23 ± 0.02 | 0.28 ± 0.01 | 0.05 |
| Sr | mg/kg | 93.6 ± 2.58 | 96.1 ± 2.26 | 0.47 |
| Mo | mg/kg | 0.19 ± 0.01 | 0.20 ± 0.01 | 0.05 |
| Cd | μg/kg | 3.00 ± 0.62 | 2.16 ± 0.27 | 0.25 |
| Sn | mg/kg | 0.39 ± 0.01 | 0.39 ± 0.01 | 0.99 |
| Sb | mg/kg | 0.19 ± 0.01 | 0.20 ± 0.01 | 0.36 |
| Ba | mg/kg | 21.0 ± 1.35 | 27.0 ± 1.68 | 0.02 |
| Hg | μg/kg | 1.21 ± 0.11 | 0.83 ± 0.12 | 0.04 |
| Tl | μg/kg | 1.49 ± 0.05 | 0.85 ± 0.07 | <0.01 |
| Pb | mg/kg | 0.36 ± 0.06 | 0.65 ± 0.16 | 0.13 |
Values were expressed as the mean ± SEM, n = 6.
Figure 2Relative mRNA levels of (A) COL1α2, (B) SOST, (C) POSTN, (D) OPG, (E) RANKL, and (F) ratio of RANKL/OPG mRNA expression in keel bones of laying hens fed a commercial diet (control group; CON) and a soybean oil-supplemented diet (SO). Values are expressed as mean ± SEM, n = 6. *P < 0.05, **P < 0.01.