| Literature DB >> 33803315 |
Matteo Zarantoniello1, Basilio Randazzo1, Gloriana Cardinaletti2, Cristina Truzzi1, Giulia Chemello1, Paola Riolo3, Ike Olivotto1.
Abstract
Insects represent a valuable and sustainable alternative ingredient for aquafeed formulation. However, insect-based diets have often highlighted controversial results in different fish species, especially when high inclusion levels were used. Several studies have demonstrated that nutritional programming through parental feeding may allow the production of fish better adapted to use sub-optimal aquafeed ingredients. To date, this approach has never been explored on insect-based diets. In the present study, five experimental diets characterized by increasing fish meal substitution levels with full-fat Black Soldier Fly (<span class="Species">Hermetia illucens; BSF) prepupae meal (0%, 25%, 50%, 75% and 100%) were used to investigate the effects of programming via broodstock nutrition on F1 zebrafish larvae development. The responses of offspring were assayed through biometric, gas chromatographic, histological, and molecular analyses. The results evidenced that the same BSF-based diets provided to adults were able to affect F1 zebrafish larvae fatty acid composition without impairing growth performances, hepatic lipid accumulation and gut health. Groups challenged with higher BSF inclusion with respect to fish meal (50%, 75% and 100%) showed a significant downregulation of stress response markers and a positive modulation of inflammatory cytokines gene expression. The present study evidences that nutritional programming through parental feeding may make it possible to extend the fish meal substitution level with BSF prepupae meal in the diet up to almost 100% without incurring the well-known negative side effects of BSF-based diets.Entities:
Keywords: Black Soldier Fly; Hermetia illucens; insect meal; nutritional programming; zebrafish
Year: 2021 PMID: 33803315 PMCID: PMC8000180 DOI: 10.3390/ani11030751
Source DB: PubMed Journal: Animals (Basel) ISSN: 2076-2615 Impact factor: 2.752
Ingredients (as g/Kg) and proximate composition (g/100 g) of the experimental diets used in the present study according to Zarantoniello et al. [8].
| Hi0 | Hi25 | Hi50 | Hi75 | Hi100 | |
|---|---|---|---|---|---|
| Ingredients (g/kg) | |||||
| Fish meal 1 | 470 | 400 | 250 | 110 | - |
| Vegetable protein mix 2 | 220 | 230 | 298 | 385 | 440 |
| BSF prepupae meal | - | 115 | 235 | 350 | 460 |
| Wheat flour 3 | 198 | 172 | 120 | 110 | 72 |
| Fish oil | 80 | 51 | 25 | 10 | - |
| Soy lecithin | 8 | 8 | 8 | 11 | 4 |
| Mineral and Vitamin supplements 4 | 14 | 14 | 14 | 14 | 14 |
| Binder | 10 | 10 | 10 | 10 | 10 |
| Proximate composition (%) | |||||
| Moisture | 2.9 ± 0.1 | 4.2 ± 0.1 | 5.1 ± 0.1 | 6.5 ± 0.1 | 7.3 ± 0.1 |
| Crude protein, CP | 51.6 ± 0.1 | 50.7 ± 2.6 | 50.4 ± 0.3 | 51.2 ± 1.5 | 50.5 ± 3.1 |
| Crude lipid, CL | 14.4 ± 0.6 | 13.1 ± 0.4 | 12.9 ± 0.4 | 13.2 ± 0.5 | 13.0 ± 0.5 |
| Nitrogen-free extract | 21.3 ± 0.3 | 20.8 ± 1.0 | 20.6 ± 0.5 | 19.0 ± 0.7 | 18.5 ± 1.3 |
| Ash | 9.8 ± 0.2 | 11.1± 0.01 | 11.0 ± 0.00 | 10.1 ± 0.1 | 10.7 ± 0.1 |
| Fatty acid content (as % of total FA) | |||||
| SFA | 27.8 ± 1.3 a | 40.9 ± 0.7 c | 40.0 ± 2.0 c | 35.9 ± 0.7 b | 37.6 ± 2.8 b |
| MUFA | 24.7 ± 0.6 d | 19.8 ± 0.3 b | 19.0 ± 0.9 a | 21.5 ± 0.2 c | 20.0 ± 1.0 b |
| PUFA | 47.4 ± 1.4 c | 39.3 ± 1.0 a | 41.0 ± 1.0 ab | 42.6 ± 0.3 b | 42.4 ± 3.2 b |
| n3 | 38.8 ± 1.4 e | 27.6 ± 0.9 d | 20.8 ± 0.9 c | 15.6 ± 0.3 b | 11.1 ± 3.1 a |
| n6 | 8.6 ± 0.1 a | 11.7 ± 0.3 b | 20.2 ± 0.4 c | 26.9 ± 0.1 d | 31.3 ± 0.9 e |
| n9 | 13.9 ± 0.3 c | 10.7 ± 0.2 a | 12.1 ± 0.7 b | 14.6 ± 0.2 d | 15.2 ± 0.7 e |
| n6/n3 | 0.22 ± 0.05 a | 0.42 ± 0.10 b | 1.00 ± 0.10 c | 1.70 ± 0.10 d | 2.80 ± 0.20 e |
1 Raw ingredient kindly supplied by Skretting Italia. 2 Vegetable protein mix (pea protein concentrate: wheat gluten, 0.6:1 w/w in all the experimental diets) provided by Lombarda trading srl (Casale Belvedere, CR, Italy) and Sacchetto spa (Lagansco, CN, Italy). 3 Consorzio Agrario (PN, Italy); 4 Mineral and Vitamin supplement composition (% mix): CaHPO42H2O, 78.9; MgO, 2.725; KCl, 0.005; NaCl, 17.65; FeCO3, 0.335; ZnSO4.H2O, 0.197; MnSO4.H2O, 0.094; CuSO4.5H2O, 0.027; Na2SeO3, 0.067; thiamine hydrochloride (vitamin B1), 0.16; riboflavin (vitamin B2), 0.39; pyridoxine hydrochloride (vitamin B6), 0.21; cyanocobalamin (vitamin B12), 0.21; niacin (vitamin PP or B3), 2.12; calcium pantothenate, 0.63; folic acid, 0.10; biotin (vitamin H), 1.05; myo-inositol (vitamin B7), 3.15; stay C Roche (vitamin C), 4.51; tocopherol (vitamin E), 3.15; menadione (vitamin K3), 0.24; retinol (vitamin A 2500 UI/kg diet), 0.026; cholecalciferol (vitamin D3 2400 UI/kg diet), 0.05; choline chloride, 83.99. For proximate composition and fatty acid content, values reported as mean ± SD (n = 3). a–e Different letters show statistically significant differences among experimental groups compared within the same FA class (p < 0.05). SFA-saturated fatty acid; MUFA-monounsaturated fatty acid; PUFA-polyunsaturated fatty acid; n3, n6, n9-omega 3, omega 6 and omega 9 fatty acid, respectively.
Figure 1Schematic representation of the experimental design. Fish-fed diets including 0%, 25%, 50%, 75% and 100% of BSF meal respect to FM (F0Hi0, F0Hi25, F0Hi50, F0Hi75 and F0Hi100 for F0 zebrafish and F1Hi0, F1Hi25, F1Hi50, FiHi75 and F1Hi100 for F1 zebrafish larvae). dpf–days post fertilization; F0–parental generation; F1–first filial generation.
Primer sequences used in the present study and ZFIN IDs reported in previous studies.
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | References |
|---|---|---|---|
|
| CTGAACATCTCGCCCTTCTC | TAGCCGATCTGCAGACACAC | [ |
|
| TCTGGAGGACTGTAAGAGGTATGC | AGACGCACAATCTTGAGAGCAG | [ |
|
| GGCAAATCTCCACGATCTCTAC | CGGTTTCTCTTGTCTCTCTCAG | [ |
|
| GAGTCCCATCCATTCTGTTG | GTGGATTGGGGTTTGATGTG | [ |
|
| GGACTGGACTGCGATGAG | GATGGGTGTGGGGATACTTC | [ |
|
| AGACCTTGGTCCCCTTCACT | CGCCTTTAATCATGGGAGAA | [ |
|
| TGTTCAGTTCTCTGCCGTTG | AAAGCACTGAGGGACGCTAA | [ |
|
| CACTGGACGAAGTTGGTGAA | GTTGAGGACACACCACCAGA | [ |
|
| TGGATGGGACCGAAATACAT | GTCTCCTCCACTGTGGGTGT | [ |
|
| CATCACGCTAAACCCAACA | GGGAGGACCAATGAAGAAGA | [ |
|
| CAGCATGTTTCTGCTCCTGTG | TCTTCTGCCCACTCTTGGTG | [ |
|
| GTCTGCTTGGGGACTCTCAC | CGGGACTCTGTTTCACCAAT | [ |
|
| AGCAAAAGGAGCAACAGGCA | GTTGGTCTGGTACTTTCACTTGAC | [ |
|
| CTCCAGTGACGAAGGCAACTT | GGGAAGGAGCCGGAAATGT | [ |
|
| GCTGGGGATGTGGACTTC | GTGGATTGGGGTTTGATGTG | [ |
|
| ATTTGTGGAGGGCTTTCCTT | AGAGCTGTTGGCAGAATGGT | [ |
|
| TTGTGGTGGGGTTTGATG | TTGGGGCATTTTATTTTGTAAG | [ |
|
| GGTGCTCTGCCACCTTGCCTT | GGCATGGTTGATCATGGCGAAAGC | [ |
|
| TCGACCCTTACCTTTGCACACACCT’ | ACACCATGATGGAGAACTGTGCCGA | [ |
Figure 2(a) Content of saturated fatty acid (SFA), monounsaturated fatty acid (MUFA) and polyunsaturated fatty acid (PUFA) (as % of total fatty acids ) and omega 3 (n-3), omega 6 (n-6), omega 9 (n-9) fatty acid contribution to lipid profile and (b) n6/n3 ratio of F1 zebrafish larvae fed the different experimental diets (F1Hi0, F1Hi25, F1Hi50, F1Hi75 and F1Hi100). a–e Different letters show statistically significant differences among experimental groups compared within the same FA class (p < 0.05). Values are reported as mean ± standard deviation (n = 3).
Fatty acid composition (as % of total FA) and DHA/EPA ratio of F1 zebrafish larvae.
| F1 Zebrafish Larvae | |||||
|---|---|---|---|---|---|
| F1Hi0 | F1Hi25 | F1Hi50 | F1Hi75 | F1Hi100 | |
| 10:0 | 0.010 ± 0.001 | 0.023 ± 0.001 | 0.047 ± 0.004 | 0.052 ± 0.003 | 0.080 ± 0.009 |
| 12:0 | 0.29 ± 0.01 a | 2.70 ± 0.10 b | 4.80 ± 0.30 c | 5.70 ± 0.30 d | 6.40 ± 0.50 e |
| 13:0 | 0.051 ± 0.002 | 0.067 ± 0.002 | 0.084 ± 0.005 | 0.088 ± 0.002 | 0.092 ± 0.008 |
| 14:0 | 4.5 ± 0.3 a | 5.2 ± 0.3 ab | 5.5 ± 0.5 b | 5.4 ± 0.5 b | 5.5 ± 0.5 b |
| 14:1n5 | 0.09 ± 0.01 | 0.17 ± 0.02 | 0.28 ± 0.03 | 0.29 ± 0.03 | 0.26 ± 0.03 |
| 15:0 | 0.78 ± 0.02 | 0.90 ± 0.03 | 0.98 ± 0.04 | 0.98 ± 0.06 | 0.99 ± 0.07 |
| 16:0 | 18.2 ± 0.8 a | 19.6 ± 1.0 ab | 20.3 ± 1.0 b | 20.2 ± 0.7 b | 19.9 ± 0.9 b |
| 16:1n9 | 0.90 ± 0.05 a | 1.10 ± 0.04 b | 1.40 ± 0.10 c | 1.30 ± 0.10 c | 1.30 ± 0.10 c |
| 16:1n7 | 7.0 ± 0.5 a | 7.5 ± 0.4 a | 7.5 ± 0.6 a | 7.2 ± 0.6 a | 7.2 ± 0.5 a |
| 16:2n7 | 0.19 ± 0.02 | 0.20 ± 0.01 | 0.22 ± 0.02 | 0.29 ± 0.03 | 0.28 ± 0.03 |
| 17:0 | 0.80 ± 0.04 a | 0.90 ± 0.05 a | 1.20 ± 0.05 b | 1.30 ± 0.07 b | 1.20 ± 0.09 b |
| 17:1n7 | 0.09 ± 0.01 | 0.29 ± 0.02 | 0.46 ± 0.04 | 0.54 ± 0.04 | 0.54 ± 0.04 |
| 18:0 | 6.6 ± 0.3 a | 6.2 ± 0.4 a | 6.3 ± 0.5 a | 6.1 ± 0.5 a | 6.1 ± 0.4 a |
| 18:1n9 | 12.4 ± 0.6 a | 14.4 ± 1.0 b | 14.9 ± 1.0 b | 14.7 ± 1.2 b | 14.6 ± 1.1 b |
| 18:1n7 | 3.1 ± 0.2 a | 3.6 ± 0.2 a | 4.4 ± 0.3 b | 4.7 ± 0.4 bc | 5.1 ± 0.4 c |
| 18:2n6 | 8.7 ± 0.6 a | 9.0 ± 0.5 a | 8.1 ± 0.6 a | 8.8 ± 0.7 a | 9.0 ± 0.6 a |
| 18:3n3 | 1.3 ± 0.1 a | 1.3 ± 0.1 a | 1.7 ± 0.1 b | 1.9 ± 0.2 b | 1.7 ± 0.2 b |
| 20:0 | 0.32 ± 0.02 | 0.30 ± 0.02 | 0.28 ± 0.02 | 0.29 ± 0.02 | 0.33 ± 0.03 |
| 20:1n9 | 1.06 ± 0.06 | 1.01 ± 0.07 | 0.68 ± 0.04 | 0.60 ± 0.04 | 0.40 ± 0.03 |
| 20:2n6 | 0.31 ± 0.03 | 0.30 ± 0.02 | 0.30 ± 0.03 | 0.37 ± 0.04 | 0.37 ± 0.03 |
| 20:3n6 | 0.42 ± 0.04 | 0.56 ± 0.05 | 0.82 ± 0.08 | 0.92 ± 0.07 | 1.00 ± 0.10 |
| 20:4n6 | 2.0 ± 0.1 a | 2.3 ± 0.1 a | 2.9 ± 0.2 b | 3.1 ± 0.2 bc | 3.3 ± 0.2 c |
| 20:3n3 | 0.11 ± 0.01 | 0.10 ± 0.01 | 0.11 ± 0.01 | 0.10 ± 0.01 | 0.11 ± 0.01 |
| 20:5n3 | 8.6 ± 0.5 c | 5.0 ± 0.4 b | 3.1 ± 0.3 a | 2.8 ± 0.3 a | 2.7 ± 0.2 a |
| 22:0 | 0.17 ± 0.02 c | 0.24 ± 0.03 b | 0.30 ± 0.03 a | 0.25 ± 0.03 a | 0.28 ± 0.03 a |
| 22:1n9 | 0.48 ± 0.05 | 0.47 ± 0.04 | 0.21 ± 0.03 | 0.15 ± 0.03 | 0.03 ± 0.01 |
| 22:6n3 | 21.5 ± 1.0 c | 16.6 ± 1.1 b | 13.1 ± 1.0 a | 12.0 ± 0.9 a | 11.3 ± 0.8 a |
| DHA/EPA | 2.5 ± 0.2 a | 3.3 ± 0.4 b | 4.2 ± 0.5 c | 4.3 ± 0.5 c | 4.2 ± 0.4 c |
Fish fed diets including 0%, 25%, 50%, 75% and 100% of BSF meal respect to fish meal (F1Hi0, F1Hi25, F1Hi50, F1Hi75 and F1Hi100). Means within rows bearing different letters (a–e) are significantly different (p < 0.05). Values are reported as mean ± standard deviation (n = 9). Statistical analysis was performed only for fatty acids > 1%. FA with a percentage < 1% were excluded from any statistical analyses because their concentrations were close to the limit of detection. DHA-docosahexaenoic acid; EPA-eicosapentaenoic acid.
Figure 3(a–e) Example of hepatic parenchima histomorphology, (f) percentage of fat fraction (PFF) in liver tissue and (g) perivisceral adipose tissue area (mm2) of F1 zebrafish larvae fed diets including 0%, 25%, 50%, 75% and 100% of BSF prepupae meal respect to FM (F1Hi0, F1Hi25, F1Hi50, F1Hi75 and F1Hi100 groups). Scale bars: 20 μm. For PFF and perivisceral adipose tissue area, values are shown as mean ± standard deviation (n = 15). ns: no significant differences.
Figure 4(a–j) Example of medium intestine histomorphology and (k) histological indexes (mucosal folds length, supranuclear vacuoles and Ab+ goblet cell abundance) measured in this gut tract of F1 zebrafish larvae fed diets including 0, 25, 50, 75 and 100% of BSF prepupae meal respect to fish meal (F1Hi0, F1Hi25, F1Hi50, F1Hi75 and F1Hi100 groups). Scale bars and staining: (a–e) 50 μm, H&E; (f–j) 20 μm, Ab. Letters: gc = Ab+ goblet cells. For histological indexes (k), values of mucosal folds length are shown as mean ± standard deviation (n = 15). Scores: supranuclear vacuoles + = scattered, ++ = abundant; Ab+ goblet cells + = 0 to 3 per villus, ++ = 4 to 6 per villus, + + + = more than 6 per villus. No significant differences were detected among the experimental groups.
Figure 5Relative mRNA abundance of genes analyzed in F1 zebrafish larvae fed diets including 0%, 25%, 50%, 75% and 100% of BSF prepupae meal respect to FM (F1Hi0, F1Hi25, F1Hi50, F1Hi75 and F1Hi100 groups). (a) igf1, (b) igf2a, (c) mstnb, (d) nr3c1, (e) hsp70.1, (f) elovl2, (g) elovl5, (h) fads2, (i) ghrl, (j) npy, (k) cnr1, (l) lepa, (m) il1b, (n) il10, (o) tnfa, (p) chia.2 and (q) chia.3. a–c Different letters specify statistically significant differences among experimental groups (p < 0.05). Values are shown as mean ± standard deviation (n = 5). ns: no significant differences.