Identification of the protective effect of Polygonatum sibiricum polysaccharide on d-galactose-induced brain ageing in mice by the systematic characterization of a circular RNA-associated ceRNA network.

CONTEXT: Polygonatum sibiricum polysaccharide (PSP), derived from Polygonatum sibiricum Delar. ex Redoute (Liliaceae), is known to be able to delay the ageing process. However, the specific mechanisms underlying these effects are not clear.
OBJECTIVE: To investigate the mechanisms underlying the effects of PSP treatment on brain ageing by the application of transcriptomic analysis.
MATERIALS AND METHODS: Forty Kunming mice were randomly divided into four groups (control, d-galactose, low-dose PSP, high-dose PSP). Mice were administered d-galactose (50 mg/kg, hypodermic injection) and PSP (200 or 400 mg/kg, intragastric administration) daily for 60 days. Behavioural responses were evaluated with the Morris water maze and the profiles of circRNA, miRNA, and mRNA, in the brains of experimental mice were investigated during the ageing process with and without PSP treatment.
RESULTS: PSP improved cognitive function during brain ageing, as evidenced by a reduced escape latency time (p < 0.05) and an increase in the number of times mice crossed the platform (p < 0.05). A total of 37, 13, and 679, circRNAs, miRNAs, and mRNAs, respectively, were significantly altered by PSP treatment (as evidenced by a fold change ≥2 and p < 0.05). These dysregulated RNAs were closely associated with synaptic activity. PSP regulated regulate nine mRNAs (Slc6a5, Bean1, Ace, Samd4, Olfr679, Olfr372, Dhrs9, Tsc1, Slc12a6), three miRNAs (mmu-miR-5110, mmu-miR-449a-5p, mmu-miR-1981-5p), and two circRNAs (2:29227578|29248878 and 5:106632925|106666845) in the competing endogenous RNA (ceRNA) network. DISCUSSION AND
CONCLUSIONS: Our analyses showed that multiple circRNAs, miRNAs, and mRNAs responded to PSP treatment in mice experiencing brain ageing.

Introduction

Ageing is a comprehensive and complex multifactorial process that refers to a gradual decline of physiological function in molecules, cells, tissues, and organs (López-Otín et al. 2013). Ageing has a particularly profound effect on the brain and the nervous system; this is because these systems incur the most severe damage caused by dysfunction in oxygen demand, regeneration ability, and endogenous antioxidant capacity (Mecocci et al. 2018). Brain ageing is also known to be related to the occurrence and development of Alzheimer’s disease, and other prevalent neurodegenerative disorders (Apple et al. 2017). Brain ageing has also been linked to a higher risk of several chronic diseases. Therefore, there is an urgent need to identify novel anti-ageing agents to delay brain ageing and improve the health of elderly individuals.

Drug discovery strategies from natural bioactive substances or components against neurodegeneration may represent a promising treatment with which to alleviate ageing-related brain injuries. Polygonatum sibiricum Delar. ex Redoute (Liliaceae) is a biologically active Chinese herb that has a long history of application for the invigoration of qi and the nourishment of yin. Polygonatum sibiricum polysaccharide (PSP) is the main active component of Polygonatum sibiricum Redouté and exhibits a range of biological functions, particularly with regards to anti-ageing effects (Zhao and Li 2015; Liu et al. 2018). A previous study demonstrated that PSP may play an important role in delaying the ageing process by regulating the Klotho/FGF23 endocrine axis, inhibiting oxidative stress, and by modulating the metabolism of calcium and phosphorus (Zheng 2020). Several recent reports have also reported that PSP acts directly on brain tissue during the anti-ageing process. Other research has shown that PSP intervention can improve the ultrastructure of the Cal region in the hippocampus of rats injected with Aβ1-42 (Yi et al. 2014). Telomerase activity was also activated in the brain and gonadal tissues of a mouse model of ageing when treated with PSP (Li et al. 2005). However, the specific effects of PSP on ageing in the brain have yet to be investigated in specific detail.

Micro-RNAs (miRNAs) are non-coding RNAs (ncRNAs) that are approximately 22 nucleotides in length; these miRNAs perform a repressive function on the expression of their target genes via miRNA response elements (Bartel 2004). Previous research based on RNA-Seq approaches found that miRNAs could represent good bioindicators for the investigation of ageing and age-related disease (Warnefors et al. 2014; Kumar et al. 2017). Circular RNAs (circRNAs) are an emerging class of ncRNA and represent a class of closed circRNA molecules that are enriched in neural tissues and exert a range of neural functions (Qu et al. 2015). CircRNAs have been demonstrated to play biological roles that are relevant to the ageing process in the nervous system (Knupp and Miura 2018). It is possible that circRNAs could associate with miRNAs via the competing endogenous RNA (ceRNA) network, in which circRNAs acting as miRNA sponges; these sponges can regulate splicing events and therefore modulate the expression of parental genes (Memczak et al. 2013). Interestingly, circRNA-associated-ceRNA networks have already been implicated in the onset of diseases that are related to ageing (Wang et al. 2018). Therefore, by analysing the ceRNA network, we were able to investigate the mechanisms underlying the restorative effect of PSP on age-related brain injuries.

Transcriptomics has proven to be an effective tool for unravelling the pharmacological mechanisms underlying specific physiological processes in various medical fields (Zhang et al. 2019). In the present study, we investigated the anti-ageing effect of PSP in a mouse model of brain ageing that was induced by d-galactose (d-gal). We were specifically interested in the effect of PSP on learning and memory. We also used RNA sequencing-based transcriptomics analysis to identify changes in the profiles of mRNA, miRNA, and circRNA, in order to establish a ceRNA network associated with the anti-ageing effects of PSP.

Material and methods

Animals and experimental design

Male Kunming mice, weighing 18–22 g, were provided by the Laboratory Animal Centre, Hunan Academy of Chinese Medicine (Changsha, China). All experimental procedures were conducted in accordance with institutional guidelines and were approved by the Institutional Animal Care and Use Committee in Hunan Academy of Chinese Medicine, Changsha, China. The mice were randomly divided into four groups (n = 10 for each group): (i) Control group, (ii) d-gal group (50 mg/kg/d for 60 days, i.h.), (iii) low-dose PSP (200 mg/kg/d for 60 days, i.g.) plus d-gal (i.h.), and high-dose PSP (400 mg/kg/d for 60 days, i.g.) plus d-gal. Behavioural tests were conducted after 60 consecutive days of modelling and administration. PSP was purchased from Ci Yuan Bio-Technology Co., Ltd (Shanxi, China) and was 98% pure (batch number: CY170510). The d-gal reagent was purchased from Kunming Nanjiang Pharmaceutical Co., Ltd (batch number: G19031406).

Morris water maze test

The Morris water maze test was carried out on days 54 to 60 the start of gavage treatment. The test was divided into two stages: navigation training and a probe trial. In the directional navigation test, we used a video analysis system to record the time it took mice to find a safe platform from the time they first entered the water (referred to as ‘escape latency’). The mice were trained four times a day for five consecutive days; we then carried out statistical analysis on escape latency data for each group of mice. After the directional navigation experiment, we removed the safety platform and allowed the mice to swim for 60 s. We then recorded the number of times each mouse crossed the location of the original platform and the time spent in each quadrant.

RNA extraction

Each mouse was sacrificed after behavioural analysis and specimens of brain tissue were collected. TRIzol Reagent (Invitrogen, Grand Island, NY, USA) was added to each brain tissue sample, ensuring that the volume of the tissue sample did not exceed 10% of the volume of TRIzol Reagent. The tissue sample was then homogenized. We then used a NanoDrop ND-1000 to determine the concentration of RNA; RNA integrity was assessed by standard denaturing agarose gel electrophoresis.

RNA sequencing analysis

Next, we constructed miRNA sequencing libraries in accordance with the protocol provided with the TruSeq® miRNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA). Small RNA molecules were sequenced on a NovaSeq 6000 platform by Genergy Biotechnology Co., Ltd. (Shanghai, China). Unique small RNA sequences were mapped to reference sequences in the miRBase database by bowtie software. MiRDeep2 was then applied to predict novel miRNAs.

RNA-seq libraries for mRNAs and circRNAs were constructed in accordance with the guidelines provided with the TruSeq® strand RNA LT Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was then performed on a NovaSeq 6000 platform. High-quality mRNA reads were aligned to the mouse reference genome (mm9) using SOAP aligner. The expression levels for each of the target genes were then normalized to reads per kilobase of exon model per million mapped reads (RPKM) so that we could compare mRNA levels between samples. For circRNA, sequencing data were analysed using CIRCexplorer2, an algorithm that can be used for de novo circRNA identification.

Gene ontology (GO) and KEGG pathway enrichment analyses

GO and KEGG pathway enrichment analyses are widely used to annotate gene function. In this study, we performed GO annotation and KEGG pathway analyses of differentially expressed (DE) mRNAs. We then used the Cluster Profiler package in R to identify the source genes of DE circRNAs and predict the target genes of the DE miRNAs. p < 0.05 was set as the cut-off criterion.

Construction of the ceRNA network

The miRanda software package (http://www.microrna.org/microrna/home.do) was used to predict miRNA-binding seed-sequence sites. We also identified miRNA response elements (MREs) that corresponded to the circRNAs and mRNAs. An overlap of the same miRNA-binding sites on both circRNA and mRNA indicated a potential circRNA–miRNA–mRNA network interaction. Based on the analysis of high-throughput sequencing data, we constructed a circRNA-related ceRNA network and visualized this network using Cytoscape software v.3.5.0 (San Diego, CA, USA).

Validation by real-time quantitative polymerase chain reaction (qPCR)

Quantitative real-time qPCR analysis was used to validate the results derived from RNA-Seq. qPCR was carried out with a LineGene FQD-96A Real-time PCR System (BIOER, China) in accordance with the manufacturer’s instructions. The expression levels of circRNA, mRNA, and miRNA, were normalized to those of β-actin, ACTB, and U6, respectively. Primer details are given in Table 1.

Table 1.

Primers designed for qRT-PCR validation of candidate miRNAs, mRNAs, and circRNAs.

Names	Primer sequence (5′ to 3′)
Pianp	F: CACAGGCCATAGCACAGTCAR: TAGGCAACACGAGGGAGAGA
Ubl5	F: CAACGACCGTCTCGGAAAGAR: ACCTTCCATCTGCTCACAGC
Stmn1	F: AGGTGCTCCAGAAAGCCATCR: TTCTCTCGCAAGCGCTCC
Tspyl2	F: CACTATTACCCCACCCTGAGCR: TGGCTCCTGCGATTATAGGC
Hnrnpu	F: CAGAGGTGGAATGCCCAACAR: CACAGCACATTCACATGGACA
10:33996667|34012137	F: CCTGACTACAATCCTGTTGCCR: TAAAGTGGAGTCTCATCAGGGT
7:84262393|84305259	F: CCGGCTGACCCTTCATCCTAR: TCCTTCTTTCACAGGGCCAA
2:29227578|29248878	F: GAGGATGGAGAGCGCCAAGR: TCAACTCTCACTTCATCCAGGTA
11:29705535|29708770	F: AAGGTGCCCTTATTGCTTCCAAR: AGAGGAGGGTATCACAGGCTC
mmu-miR-182-5p	F: GGCTTTGGCAATGGTAGAACTCRT: GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATACGACCGGTGT
mmu-miR-183-5p	F: GCGGCTATGGCACTGGTAGAART: GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATACGACAGTGAA
mmu-miR-5110	F: CGGAGGAGGTAGAGGGTGGTRT: GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATACGACAATTCC
mmu-miR-7044-3p	F: CATGCAGCCCCGACCCRT: GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATACGACCTGTGA
mmu-miR-96-5p	F: CGGCTTTGGCACTAGCACATTRT: GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATACGACAGCAAA

Statistical analysis

All data are expressed as mean ± standard deviation (SD). Statistical analysis involved the unpaired Student’s t-test for two comparisons or one-way analysis of variance (ANOVA) for repeated measures. p < 0.05 denoted a statistically significant difference. Sequencing data were processed by DEseq software. Genes and ncRNAs were defined as differentially expressed if p < 0.01 and |log2 (fold change)| >2.

Results

PSP improved the spatial memory ability of mice induced by d-gal

The d-gal animal model is internationally recognized and widely used to screen drugs and study the mechanisms involved with brain ageing (Zhang et al. 2005; Li et al. 2015). Compared to the Control group, the escape latency of mice in the Model group was significantly longer (p < 0.01). Furthermore, mice in the Model group had significantly fewer platform crossing times (p < 0.01), thus confirming that the mouse model of brain ageing had been successfully established. However, the escape latency in the PSP group was significantly shorter than that in the Model group (p < 0.05). Furthermore, PSP treatment significantly increased the number of platform crossings (p < 0.05) in mice experiencing brain ageing when compared with the Model group, thus suggesting the ameliorative effect of PSP on cognitive impairment in mice suffering from brain ageing induced by d-gal (Figure 1).

Figure 1.

Effects of PSP on spatial learning and memory deficiency in mice experiencing brain ageing. (A) Representative images of swimming paths undertaken on the fifth day of the spatial acquisition test, and (B) the time needed to reach the hidden platform. (C) Spatial memory function was tested by counting the number of times each mouse crossed the target platform within 90 s. (D) Representative images of swimming paths in the spatial probe trial. Data are expressed as the mean ± SD (n = 6 per group; escape latency was analysed by repeated measures analysis of variance (ANOVA); other data were analysed by one-way ANOVA followed by least significant difference tests). *p < 0.05, vs. Control group; #p < 0.05 vs. Model group.

Differentially expressed (DE) mRNAs and functional enrichment analysis

Next, we compared the gene profiles of the Model group to those of the Control group; this allowed us to identify a number of DE genes that we referred to as ‘ageing-related genes.’ These ageing-related genes were then compared to the gene profiles of the PSP group, and the genes that were regulated by PSP were considered as ‘PSP-related genes.’ Using p < 0.01 and |log 2 (fold change)| ≥ 2 as thresholds, we identified 2425 ageing-related mRNAs (1175 upregulated and 1250 downregulated) and 679 PSP-related mRNAs (Table 2). Compared with the Control group, 254 mRNAs were upregulated in the Model group. Interestingly, PSP intervention reversed these d-gal-induced alterations and yielded expression levels that were similar to those of the Control group. Similarly, compared with the Control group, 425 mRNAs were downregulated in the Model group; PSP treatment led to the upregulation of these mRNAs. Next, we created a heatmap; this revealed a distinct expression signature for mRNA in the Model group, Control group, and PSP group (Figure 2(A–B)). A volcano plot was then used to visualize the expression of DE genes in the ‘Model group vs. Control group’ and the ‘Model group vs. PSP group’ (Figure 2(C–D)). These results suggested that PSP treatment could reverse transcriptomic alterations induced by brain ageing to a significant extent.

Table 2.

Dysregulated mRNAs associated with the anti-brain ageing effect of PSP.

Transcript_ID	Symbol	Con	Mod	PSP	log2FoldChange		Pvalue
					Con_vs_Mod	Mod_vs_PSP	Con_vs_Mod	Mod_vs_PSP
ENSMUST00000089161	Tnfrsf13c	2.896	0.000	3.085	2.896	−3.085	0.001	0.000
ENSMUST00000050709	Dok7	5.681	4.226	5.458	1.455	−1.232	0.007	0.001
ENSMUST00000106464	Ccdc163	3.874	0.000	5.163	3.874	−5.163	0.001	0.000
ENSMUST00000050228	Tmem241	0.000	4.588	0.000	−4.588	4.588	0.000	0.000
ENSMUST00000113572	Runx2	7.264	8.767	7.124	−1.503	1.643	0.000	0.000
ENSMUST00000121564	Fam118b	3.424	4.808	3.524	−1.384	1.284	0.021	0.027
ENSMUST00000151630	Fam117b	2.843	0.000	2.852	2.843	−2.852	0.002	0.001
ENSMUST00000167191	Hs3st5	3.166	1.506	3.295	1.660	−1.789	0.032	0.015
ENSMUST00000019439	Tmem129	9.154	7.625	8.971	1.529	−1.346	0.012	0.042
ENSMUST00000028880	Slc20a1	6.181	8.633	6.944	−2.452	1.689	0.026	0.000
ENSMUST00000110267	Sybu	11.044	4.985	9.070	6.059	−4.085	0.000	0.001
ENSMUST00000169653	Ankrd13d	7.213	5.802	7.322	1.411	−1.520	0.000	0.000
ENSMUST00000089003	Atp2b2	2.820	4.410	2.596	−1.590	1.814	0.022	0.007
ENSMUST00000023655	Mx1	1.380	4.809	2.250	−3.429	2.559	0.000	0.038
ENSMUST00000103037	Ush1g	4.673	3.557	5.247	1.116	−1.690	0.035	0.000
ENSMUST00000164853	Ccdc24	7.050	5.391	7.214	1.659	−1.822	0.011	0.010
ENSMUST00000126914	Pgap2	3.198	1.378	3.386	1.820	−2.008	0.013	0.003
ENSMUST00000036300	Col27a1	7.400	6.278	8.716	1.123	−2.438	0.008	0.000
ENSMUST00000169421	Tmprss7	0.397	3.473	1.375	−3.076	2.098	0.034	0.018
ENSMUST00000179201	Bsg	6.943	4.359	8.507	2.584	−4.148	0.001	0.000
ENSMUST00000173341	Gtf2i	10.331	11.837	10.267	−1.506	1.570	0.000	0.004
ENSMUST00000119168	Zfp740	3.804	0.000	5.294	3.804	−5.294	0.000	0.000
ENSMUST00000044616	Ints8	7.647	5.398	8.788	2.249	−3.389	0.000	0.000
ENSMUST00000212404	Spire2	1.069	3.159	5.773	−2.090	−2.615	0.049	0.027
ENSMUST00000143089	Rad54l	0.613	3.775	2.533	−3.162	1.242	0.000	0.030
ENSMUST00000049655	Tmem215	9.336	8.019	6.703	1.317	1.316	0.034	0.039
ENSMUST00000089317	Magi1	9.030	10.289	9.004	−1.259	1.285	0.000	0.001
ENSMUST00000028291	Inpp5e	5.419	3.414	5.763	2.006	−2.350	0.019	0.006
ENSMUST00000109134	Zfp879	2.528	4.130	1.680	−1.603	2.450	0.020	0.014
ENSMUST00000134862	Rnf44	6.929	5.278	6.694	1.652	−1.416	0.007	0.008
ENSMUST00000030858	Fbxo6	2.623	6.664	4.897	−4.041	1.768	0.003	0.005
ENSMUST00000161769	Hnrnpu	8.561	10.751	8.308	−2.190	2.443	0.008	0.000
ENSMUST00000123479	Kdm2b	4.724	6.289	4.364	−1.565	1.925	0.004	0.009
ENSMUST00000198204	Kcnt1	2.670	4.931	3.016	−2.261	1.915	0.010	0.031
ENSMUST00000102488	Myo18a	5.766	1.946	4.446	3.821	−2.500	0.000	0.001
ENSMUST00000183402	Szt2	3.078	5.303	3.794	−2.224	1.508	0.001	0.009
ENSMUST00000053722	Zfp607a	4.114	2.795	4.073	1.318	−1.277	0.022	0.034
ENSMUST00000147938	Tab2	4.825	6.131	7.981	−1.306	−1.850	0.001	0.001
ENSMUST00000117929	Tmcc3	4.656	2.849	5.018	1.807	−2.169	0.008	0.003
ENSMUST00000066601	Hyou1	9.118	10.358	8.674	−1.239	1.683	0.002	0.000
ENSMUST00000113222	Stxbp1	10.169	9.060	11.462	1.108	−2.402	0.016	0.002
ENSMUST00000113228	Drp2	6.732	4.509	6.138	2.223	−1.629	0.000	0.011
ENSMUST00000135589	Lpin2	2.458	4.631	3.322	−2.173	1.310	0.030	0.037
ENSMUST00000024639	Map2	5.320	7.343	5.247	−2.023	2.096	0.045	0.026
ENSMUST00000076442	Plec	5.167	7.736	6.072	−2.569	1.664	0.000	0.036
ENSMUST00000061722	Dlk2	3.005	6.320	3.275	−3.316	3.045	0.002	0.001
ENSMUST00000201588	Medag	4.550	2.955	4.187	1.595	−1.232	0.001	0.014
ENSMUST00000201583	Tbc1d24	4.943	3.771	4.893	1.172	−1.122	0.018	0.036
ENSMUST00000145667	Arl6ip4	4.969	6.035	4.808	−1.067	1.228	0.000	0.000
ENSMUST00000159415	Fsd1l	3.429	1.951	3.267	1.478	−1.316	0.033	0.030
ENSMUST00000215016	Cx3cr1	4.244	7.929	4.604	−3.685	3.325	0.000	0.000
ENSMUST00000021544	Plek2	4.636	3.225	4.890	1.411	−1.665	0.008	0.000
ENSMUST00000129010	Nprl3	3.160	1.701	3.206	1.459	−1.505	0.036	0.026
ENSMUST00000148868	Mpped1	5.797	6.850	4.844	−1.053	2.006	0.001	0.001
ENSMUST00000185177	Rfx7	5.530	3.917	5.039	1.613	−1.122	0.009	0.030
ENSMUST00000180046	Usp34	8.168	9.733	8.474	−1.566	1.260	0.037	0.046
ENSMUST00000196695	Fubp1	7.705	5.913	7.450	1.792	−1.538	0.035	0.006
ENSMUST00000023465	Top3b	3.360	1.516	6.700	1.844	−5.184	0.023	0.000
ENSMUST00000211413	Tulp2	0.000	2.038	0.000	−2.038	2.038	0.036	0.021
ENSMUST00000123203	Scfd2	4.802	3.666	5.208	1.136	−1.542	0.050	0.005
ENSMUST00000137285	Zfp644	6.557	5.354	6.717	1.203	−1.363	0.003	0.000
ENSMUST00000171151	Washc3	2.371	4.283	2.402	−1.912	1.882	0.009	0.004
ENSMUST00000117994	C330027C09Rik	2.556	0.000	5.726	2.556	−5.726	0.044	0.000
ENSMUST00000220532	Exoc2	5.604	6.715	5.614	−1.110	1.100	0.017	0.034
ENSMUST00000119316	Ccnj	7.932	5.262	8.081	2.670	−2.819	0.003	0.001
ENSMUST00000148162	Flot2	8.595	6.725	8.382	1.870	−1.658	0.000	0.000
ENSMUST00000140359	Kif3a	0.000	2.723	0.000	−2.723	2.723	0.050	0.026
ENSMUST00000173989	Rps6ka1	3.023	5.095	6.613	−2.072	−1.519	0.000	0.003
ENSMUST00000191230	Ilkap	3.998	5.086	4.083	−1.087	1.002	0.033	0.048
ENSMUST00000187548	Dnah7b	4.385	3.141	5.733	1.245	−2.592	0.041	0.000
ENSMUST00000022398	1700011H14Rik	3.107	0.540	3.171	2.567	−2.631	0.009	0.004
ENSMUST00000176374	Pex12	2.695	0.000	2.710	2.695	−2.710	0.042	0.034
ENSMUST00000224676	Arhgef33	0.000	2.140	3.481	−2.140	−1.341	0.027	0.044
ENSMUST00000108238	Yif1b	7.476	6.319	7.659	1.157	−1.340	0.005	0.001
ENSMUST00000146291	Crebzf	3.911	0.000	3.710	3.911	−3.710	0.019	0.012
ENSMUST00000097666	Cab39	4.829	2.983	4.866	1.847	−1.883	0.021	0.028
ENSMUST00000093829	Megf11	7.114	5.973	7.014	1.141	−1.042	0.000	0.008
ENSMUST00000186807	2310035C23Rik	6.499	4.018	6.464	2.481	−2.446	0.035	0.040
ENSMUST00000182003	Anks1b	3.321	4.853	2.148	−1.532	2.705	0.006	0.000
ENSMUST00000106727	0610037L13Rik	0.000	2.800	0.000	−2.800	2.800	0.005	0.002
ENSMUST00000138547	Ripor2	5.221	6.393	5.058	−1.172	1.335	0.008	0.040
ENSMUST00000110157	Prokr2	0.611	3.076	0.654	−2.464	2.421	0.017	0.023
ENSMUST00000224182	Hnrnpk	3.250	1.368	3.141	1.881	−1.773	0.024	0.018
ENSMUST00000224455	Emb	4.776	5.892	7.753	−1.116	−1.861	0.027	0.021
ENSMUST00000079719	Tbx3	6.490	5.054	6.263	1.436	−1.209	0.001	0.031
ENSMUST00000165365	Cd276	5.313	2.984	6.129	2.329	−3.145	0.026	0.002
ENSMUST00000173280	H2-T22	3.382	0.000	6.312	3.382	−6.312	0.024	0.000
ENSMUST00000116388	Rcor1	6.451	3.407	4.629	3.044	−1.221	0.000	0.016
ENSMUST00000199534	Ldb2	4.819	2.555	5.140	2.264	−2.584	0.023	0.002
ENSMUST00000219554	Myl6	6.794	3.364	6.543	3.431	−3.179	0.000	0.000
ENSMUST00000189871	Ppp4r4	2.143	3.535	1.567	−1.392	1.967	0.030	0.007
ENSMUST00000113590	Speg	8.534	5.954	4.626	2.580	1.328	0.000	0.003
ENSMUST00000058210	Eps8	9.721	8.479	10.481	1.242	−2.002	0.010	0.000
ENSMUST00000214432	Ncapd3	6.850	4.085	6.894	2.765	−2.809	0.000	0.000
ENSMUST00000114845	Pfkfb3	1.026	4.719	0.638	−3.693	4.081	0.001	0.000
ENSMUST00000225845	Zkscan4	3.827	0.000	3.330	3.827	−3.330	0.030	0.015
ENSMUST00000162242	Impdh1	5.056	1.893	4.864	3.162	−2.970	0.020	0.015
ENSMUST00000171263	Gbp7	6.787	5.436	7.245	1.351	−1.809	0.001	0.000
ENSMUST00000131390	Mfsd9	1.815	5.920	1.356	−4.105	4.564	0.000	0.000
ENSMUST00000022551	Rcbtb1	5.516	7.511	8.964	−1.995	−1.453	0.021	0.033
ENSMUST00000110949	Arhgap11a	4.809	0.000	4.050	4.809	−4.050	0.000	0.000
ENSMUST00000063690	Dhrs9	2.888	0.000	2.906	2.888	−2.906	0.001	0.001
ENSMUST00000077737	Brd3	7.024	2.511	8.382	4.514	−5.871	0.046	0.003
ENSMUST00000022882	Myo10	4.479	2.967	10.666	1.512	−7.699	0.022	0.000
ENSMUST00000044484	Kdm6a	7.843	6.412	8.811	1.431	−2.399	0.000	0.000
ENSMUST00000041175	Ptger3	4.195	5.632	3.675	−1.437	1.957	0.000	0.000
ENSMUST00000114439	Snx10	7.737	4.136	6.623	3.601	−2.487	0.000	0.002
ENSMUST00000095893	Armt1	8.751	7.120	8.599	1.631	−1.480	0.014	0.032
ENSMUST00000075644	Calcr	6.433	2.341	6.188	4.092	−3.847	0.029	0.036
ENSMUST00000148313	Tmc4	2.762	0.000	3.814	2.762	−3.814	0.048	0.000
ENSMUST00000105867	Stmn1	5.629	8.281	6.252	−2.652	2.029	0.000	0.000
ENSMUST00000210312	Gm45799	0.000	3.278	0.000	−3.278	3.278	0.036	0.017
ENSMUST00000127286	Ndfip2	6.576	7.977	6.898	−1.401	1.079	0.026	0.009
ENSMUST00000081335	Tgif2	5.372	3.721	5.335	1.651	−1.614	0.000	0.005
ENSMUST00000163324	Fbxo34	3.088	9.177	6.669	−6.089	2.508	0.029	0.003
ENSMUST00000204481	Ybx3	3.426	4.581	2.939	−1.156	1.642	0.043	0.017
ENSMUST00000113069	Slc25a53	1.026	7.417	0.638	−6.390	6.779	0.000	0.000
ENSMUST00000133595	Jmjd8	5.504	7.020	5.874	−1.515	1.145	0.011	0.043
ENSMUST00000179804	Cldn12	2.761	5.030	3.085	−2.269	1.945	0.007	0.005
ENSMUST00000106128	Adgrl2	10.700	7.484	9.072	3.216	−1.589	0.000	0.011
ENSMUST00000210988	Mamstr	2.678	5.486	3.984	−2.808	1.502	0.000	0.035
ENSMUST00000065330	Clk3	6.371	8.003	6.799	−1.631	1.204	0.001	0.020
ENSMUST00000128187	Hnrnpdl	9.693	11.005	9.713	−1.311	1.291	0.027	0.000
ENSMUST00000111783	Mapkapk5	3.762	0.986	2.814	2.777	−1.828	0.005	0.019
ENSMUST00000111785	Ssfa2	9.541	7.345	10.966	2.195	−3.621	0.003	0.000
ENSMUST00000136114	Plxna3	2.866	0.644	3.097	2.223	−2.454	0.031	0.010
ENSMUST00000203445	Add2	5.633	3.838	4.999	1.796	−1.162	0.000	0.017
ENSMUST00000178982	43891	6.534	7.834	6.194	−1.300	1.640	0.026	0.004
ENSMUST00000093798	Zbtb38	7.693	5.988	4.671	1.705	1.317	0.002	0.038
ENSMUST00000225179	Zcchc6	3.268	0.000	3.068	3.268	−3.068	0.025	0.020
ENSMUST00000173569	Gne	3.189	0.000	3.499	3.189	−3.499	0.042	0.014
ENSMUST00000149537	Fastk	3.888	1.693	3.981	2.195	−2.288	0.033	0.014
ENSMUST00000105500	Snx3	0.000	3.077	0.000	−3.077	3.077	0.030	0.013
ENSMUST00000037422	Rnf44	7.400	5.172	6.682	2.228	−1.510	0.034	0.036
ENSMUST00000176263	Ppp1r9a	6.620	7.770	6.505	−1.151	1.266	0.006	0.025
ENSMUST00000144454	Arrb2	5.954	4.713	6.091	1.241	−1.378	0.000	0.000
ENSMUST00000125399	Rusc2	3.069	0.000	3.545	3.069	−3.545	0.029	0.000
ENSMUST00000170710	Glod4	5.098	3.761	5.015	1.337	−1.254	0.026	0.050
ENSMUST00000137069	Atat1	0.000	2.902	0.000	−2.902	2.902	0.047	0.024
ENSMUST00000180025	Bhlhb9	6.544	4.457	6.145	2.087	−1.688	0.003	0.009
ENSMUST00000108173	Rffl	8.504	7.445	9.235	1.059	−1.790	0.001	0.000
ENSMUST00000140893	Manba	5.003	3.209	6.018	1.794	−2.810	0.007	0.000
ENSMUST00000124526	Ahnak2	4.363	5.483	7.620	−1.120	−2.137	0.010	0.000
ENSMUST00000035889	Myo6	9.089	7.982	9.670	1.108	−1.689	0.024	0.034
ENSMUST00000146569	Slx4	6.226	5.216	6.912	1.010	−1.697	0.021	0.000
ENSMUST00000169438	Plec	5.095	1.169	4.616	3.926	−3.446	0.032	0.049
ENSMUST00000114205	Ablim2	4.691	3.387	5.333	1.304	−1.946	0.020	0.001
ENSMUST00000002298	Ppm1j	4.390	3.212	4.859	1.178	−1.647	0.048	0.013
ENSMUST00000174317	Jmjd1c	9.076	7.061	8.339	2.015	−1.277	0.000	0.014
ENSMUST00000180476	Usp35	3.811	0.000	3.438	3.811	−3.438	0.000	0.000
ENSMUST00000151980	Rdh12	3.736	0.663	5.123	3.074	−4.460	0.014	0.000
ENSMUST00000124922	Afdn	5.632	8.079	5.738	−2.446	2.340	0.000	0.001
ENSMUST00000112491	Rps6ka3	5.850	4.059	5.286	1.791	−1.227	0.001	0.019
ENSMUST00000127303	Cfap44	2.937	0.644	2.491	2.293	−1.847	0.020	0.030
ENSMUST00000144221	Crebrf	1.128	5.694	2.370	−4.566	3.324	0.001	0.002
ENSMUST00000224798	Nr2f1	4.234	5.757	4.026	−1.523	1.731	0.000	0.005
ENSMUST00000120645	Gsto2	4.340	2.527	4.633	1.813	−2.105	0.015	0.004
ENSMUST00000208394	Gprc5b	4.926	6.412	8.388	−1.486	−1.976	0.006	0.000
ENSMUST00000126888	Setd6	5.042	3.577	4.863	1.465	−1.286	0.011	0.035
ENSMUST00000216412	Exosc7	6.588	2.165	7.703	4.423	−5.538	0.000	0.000
ENSMUST00000080394	Sh3kbp1	0.000	3.861	1.310	−3.861	2.551	0.002	0.010
ENSMUST00000212046	Elmo3	6.927	1.632	6.816	5.295	−5.185	0.001	0.000
ENSMUST00000219834	Dgka	1.268	3.884	1.649	−2.616	2.235	0.038	0.018
ENSMUST00000056517	Gja10	0.000	1.979	0.000	−1.979	1.979	0.039	0.023
ENSMUST00000052368	Kdm6a	7.845	6.182	7.687	1.663	−1.505	0.002	0.014
ENSMUST00000143674	Pde6d	6.242	5.070	3.766	1.171	1.305	0.000	0.035
ENSMUST00000133257	Ggnbp1	5.509	7.011	5.586	−1.502	1.426	0.012	0.016
ENSMUST00000053950	Lrrc28	6.986	8.515	6.264	−1.528	2.250	0.000	0.000
ENSMUST00000145066	Trmt2b	8.603	5.085	7.693	3.519	−2.608	0.000	0.000
ENSMUST00000136804	Mrpl51	6.356	5.155	6.415	1.201	−1.260	0.037	0.029
ENSMUST00000213062	Aprt	1.026	2.806	0.963	−1.780	1.843	0.034	0.017
ENSMUST00000199592	Elp6	7.085	4.917	5.969	2.169	−1.053	0.000	0.040
ENSMUST00000038522	Slmap	2.697	3.886	2.798	−1.189	1.088	0.043	0.048
ENSMUST00000114559	Zfp467	2.878	0.000	2.565	2.878	−2.565	0.044	0.034
ENSMUST00000085786	Card11	3.035	0.000	3.182	3.035	−3.182	0.002	0.000
ENSMUST00000220895	Aaed1	7.058	0.000	6.957	7.058	−6.957	0.000	0.000
ENSMUST00000163281	Skint7	0.000	3.241	0.000	−3.241	3.241	0.001	0.000
ENSMUST00000032479	Pianp	8.075	9.921	7.932	−1.846	1.989	0.027	0.000
ENSMUST00000064872	Ahcyl2	6.697	4.046	5.881	2.651	−1.835	0.001	0.008
ENSMUST00000209203	Chd9	9.069	7.290	8.575	1.779	−1.285	0.004	0.032
ENSMUST00000115101	Nupl2	0.000	3.470	0.000	−3.470	3.470	0.032	0.014
ENSMUST00000091892	Ctxn3	6.215	3.995	6.003	2.220	−2.008	0.000	0.000
ENSMUST00000209905	Ebf3	2.516	4.386	6.214	−1.870	−1.828	0.008	0.009
ENSMUST00000108707	Ubc	2.600	4.761	3.502	−2.162	1.259	0.006	0.031
ENSMUST00000139953	Slc39a8	4.877	3.030	4.640	1.847	−1.609	0.000	0.001
ENSMUST00000195907	Sema3a	5.354	3.866	5.151	1.488	−1.285	0.001	0.008
ENSMUST00000098696	Psd3	5.797	7.870	6.343	−2.073	1.527	0.041	0.038
ENSMUST00000163750	Nedd8	4.412	2.811	5.239	1.601	−2.428	0.023	0.001
ENSMUST00000129290	Fam117a	2.331	0.000	2.323	2.331	−2.323	0.012	0.007
ENSMUST00000161523	Tmem63a	6.907	2.278	10.634	4.629	−8.356	0.019	0.000
ENSMUST00000204278	Slc6a1	9.634	8.478	9.565	1.156	−1.086	0.033	0.049
ENSMUST00000162366	Apbb2	6.479	4.712	3.147	1.767	1.565	0.004	0.005
ENSMUST00000209537	Pde2a	4.150	5.379	2.592	−1.228	2.787	0.022	0.001
ENSMUST00000165881	Mark2	2.741	0.644	2.700	2.097	−2.056	0.047	0.032
ENSMUST00000223611	Nrn1	2.572	4.358	2.989	−1.787	1.369	0.014	0.018
ENSMUST00000176756	Dnah11	4.345	0.993	4.764	3.352	−3.771	0.001	0.000
ENSMUST00000172670	Ccdc9	4.587	3.119	4.370	1.467	−1.251	0.002	0.009
ENSMUST00000029707	Gpatch4	2.703	5.226	2.221	−2.523	3.005	0.005	0.002
ENSMUST00000086167	Nfrkb	6.210	7.702	6.650	−1.492	1.052	0.047	0.026
ENSMUST00000219778	Ascc1	3.076	4.690	3.563	−1.614	1.127	0.006	0.040
ENSMUST00000166724	Hrh3	5.725	7.631	5.635	−1.906	1.996	0.000	0.000
ENSMUST00000217966	Heatr5a	1.341	3.987	5.478	−2.646	−1.491	0.000	0.000
ENSMUST00000132274	Rsad1	6.680	0.655	3.890	6.025	−3.235	0.001	0.001
ENSMUST00000225488	Ntrk2	3.644	5.093	6.337	−1.448	−1.244	0.001	0.019
ENSMUST00000129775	Kyat3	3.884	1.704	3.732	2.180	−2.028	0.009	0.007
ENSMUST00000079777	Pard3	0.000	3.448	0.289	−3.448	3.159	0.031	0.013
ENSMUST00000055014	Skint7	1.471	4.871	1.862	−3.400	3.009	0.000	0.001
ENSMUST00000065111	Usp45	7.905	6.299	8.529	1.606	−2.230	0.013	0.001
ENSMUST00000095775	Setdb2	5.175	2.667	4.534	2.508	−1.867	0.002	0.012
ENSMUST00000124313	Chaf1b	2.511	0.000	2.988	2.511	−2.988	0.008	0.001
ENSMUST00000129335	Numb	0.000	3.593	0.000	−3.593	3.593	0.029	0.012
ENSMUST00000139003	Pnkp	5.066	3.502	4.854	1.564	−1.353	0.003	0.004
ENSMUST00000112394	Csrnp3	4.840	6.150	5.142	−1.310	1.007	0.000	0.006
ENSMUST00000141927	Efcab14	2.683	0.000	3.355	2.683	−3.355	0.003	0.000
ENSMUST00000126085	Aamdc	2.011	4.719	2.901	−2.708	1.818	0.001	0.016
ENSMUST00000198675	Nhlh2	4.114	1.158	5.769	2.956	−4.611	0.001	0.000
ENSMUST00000113736	Dlg3	5.751	8.014	6.095	−2.262	1.918	0.008	0.008
ENSMUST00000186315	Usp40	6.001	7.957	6.456	−1.955	1.500	0.016	0.002
ENSMUST00000106220	Macf1	7.714	9.280	7.743	−1.567	1.537	0.000	0.001
ENSMUST00000156444	Zfp707	3.616	2.217	4.163	1.399	−1.946	0.043	0.003
ENSMUST00000156442	Sec16a	7.669	5.805	7.950	1.864	−2.145	0.000	0.000
ENSMUST00000147556	Rtkn2	3.987	6.365	3.590	−2.377	2.775	0.000	0.001
ENSMUST00000048678	Lss	8.197	4.145	6.089	4.052	−1.945	0.000	0.023
ENSMUST00000166558	Efemp2	2.950	0.000	2.395	2.950	−2.395	0.002	0.006
ENSMUST00000055281	Skor1	2.230	3.594	6.538	−1.363	−2.944	0.034	0.000
ENSMUST00000145622	Zfp715	4.194	3.170	5.426	1.023	−2.255	0.046	0.002
ENSMUST00000203538	Klhl5	6.404	5.283	6.832	1.121	−1.549	0.002	0.003
ENSMUST00000099742	Cfap44	7.981	6.594	7.968	1.388	−1.374	0.005	0.017
ENSMUST00000131424	Uggt2	4.287	2.242	4.690	2.045	−2.448	0.046	0.008
ENSMUST00000133896	Slc11a1	2.612	0.000	2.328	2.612	−2.328	0.005	0.008
ENSMUST00000128706	Tcf4	7.917	6.227	7.413	1.690	−1.186	0.002	0.045
ENSMUST00000211174	Ankrd10	3.208	0.000	2.813	3.208	−2.813	0.043	0.028
ENSMUST00000178988	Tmem205	4.231	0.931	3.836	3.300	−2.904	0.010	0.031
ENSMUST00000154718	Reps1	2.293	3.902	1.909	−1.609	1.993	0.026	0.001
ENSMUST00000114100	Sdccag3	3.231	0.000	3.069	3.231	−3.069	0.034	0.023
ENSMUST00000122945	44078	3.021	5.999	2.273	−2.978	3.726	0.029	0.000
ENSMUST00000143262	Lrrc75a	1.567	3.882	2.102	−2.314	1.780	0.047	0.012
ENSMUST00000214732	Zfp651	3.956	1.840	4.446	2.116	−2.606	0.049	0.013
ENSMUST00000132517	Abca7	8.436	5.958	9.478	2.478	−3.520	0.010	0.000
ENSMUST00000160620	Arap2	9.418	6.553	7.556	2.866	−1.003	0.000	0.026
ENSMUST00000217197	Gm1110	2.230	0.000	2.863	2.230	−2.863	0.019	0.029
ENSMUST00000167633	Bean1	3.138	0.000	4.088	3.138	−4.088	0.029	0.007
ENSMUST00000212479	Syde2	4.087	5.554	3.949	−1.466	1.605	0.001	0.001
ENSMUST00000006431	Atp6v1b1	4.989	2.003	4.298	2.986	−2.295	0.001	0.028
ENSMUST00000048485	Sln	3.481	1.377	3.693	2.103	−2.316	0.046	0.024
ENSMUST00000123140	Lrp8	4.427	8.085	4.750	−3.658	3.335	0.004	0.000
ENSMUST00000177840	Cd151	7.394	6.120	8.358	1.274	−2.238	0.005	0.000
ENSMUST00000138091	Ahcyl1	7.020	5.589	7.247	1.430	−1.658	0.003	0.002
ENSMUST00000068617	Mettl27	0.000	2.776	0.000	−2.776	2.776	0.010	0.004
ENSMUST00000091420	Skida1	3.501	7.791	5.321	−4.289	2.469	0.000	0.015
ENSMUST00000123594	Otub1	0.613	4.015	1.567	−3.403	2.448	0.000	0.000
ENSMUST00000134105	Slc2a1	4.878	2.774	5.156	2.104	−2.382	0.002	0.000
ENSMUST00000207252	Crebzf	6.366	4.601	5.734	1.764	−1.133	0.004	0.045
ENSMUST00000207879	Supt5	7.658	5.677	9.073	1.981	−3.396	0.024	0.000
ENSMUST00000149972	Nfat5	4.870	1.512	4.541	3.359	−3.029	0.002	0.000
ENSMUST00000165320	Fiz1	4.853	3.254	5.193	1.599	−1.939	0.023	0.007
ENSMUST00000208131	Myh14	3.223	0.000	4.033	3.223	−4.033	0.001	0.000
ENSMUST00000087133	Exoc1	5.273	1.626	5.135	3.647	−3.509	0.000	0.000
ENSMUST00000110013	Jak3	2.197	5.392	2.549	−3.195	2.844	0.004	0.024
ENSMUST00000111566	Clip1	6.623	8.717	6.162	−2.094	2.555	0.029	0.003
ENSMUST00000220509	Ppp2r5c	7.300	3.326	5.073	3.974	−1.747	0.000	0.015
ENSMUST00000117460	Tmcc3	7.888	6.057	8.562	1.831	−2.505	0.003	0.000
ENSMUST00000043429	Nfyc	6.958	8.069	6.807	−1.112	1.262	0.001	0.006
ENSMUST00000106494	Pomgnt1	3.570	6.306	4.327	−2.736	1.979	0.000	0.003
ENSMUST00000114069	Elmod3	4.610	1.414	4.729	3.196	−3.315	0.002	0.000
ENSMUST00000136721	Ncln	5.407	4.193	5.423	1.214	−1.229	0.031	0.027
ENSMUST00000062580	Itsn2	8.126	5.605	6.955	2.521	−1.350	0.000	0.000
ENSMUST00000051390	Zbtb45	8.726	5.951	7.269	2.775	−1.318	0.000	0.003
ENSMUST00000114882	Rps10	6.118	4.729	6.976	1.389	−2.247	0.025	0.000
ENSMUST00000159959	Hr	2.769	0.342	2.345	2.427	−2.003	0.006	0.023
ENSMUST00000110437	Dtwd1	4.793	6.547	4.580	−1.754	1.968	0.000	0.000
ENSMUST00000176509	Zbtb25	5.392	3.596	5.330	1.796	−1.734	0.000	0.000
ENSMUST00000039752	Slc16a8	5.257	4.094	5.258	1.163	−1.164	0.033	0.034
ENSMUST00000152544	Plk5	6.321	5.290	6.606	1.031	−1.315	0.044	0.025
ENSMUST00000201219	Nat8f3	4.748	3.662	5.635	1.087	−1.973	0.017	0.000
ENSMUST00000033608	Sytl4	5.079	3.077	4.722	2.002	−1.645	0.002	0.020
ENSMUST00000215324	Olfr372	0.000	2.278	0.000	−2.278	2.278	0.016	0.008
ENSMUST00000161882	Ubl5	4.207	5.776	3.717	−1.569	2.060	0.002	0.000
ENSMUST00000163421	Axin1	8.800	6.591	8.773	2.209	−2.182	0.000	0.000
ENSMUST00000123384	Angel2	6.848	5.171	6.595	1.677	−1.424	0.003	0.011
ENSMUST00000180636	Slc35a5	3.489	5.460	2.816	−1.971	2.644	0.007	0.001
ENSMUST00000210358	Isyna1	4.755	3.428	4.521	1.327	−1.094	0.013	0.048
ENSMUST00000110124	Homer3	3.858	1.432	3.969	2.426	−2.537	0.026	0.002
ENSMUST00000169536	Zfyve27	10.679	9.064	10.246	1.616	−1.182	0.000	0.003
ENSMUST00000045011	Atrip	4.230	7.404	5.683	−3.174	1.722	0.000	0.003
ENSMUST00000044204	Tyw1	6.193	1.072	5.376	5.120	−4.304	0.000	0.006
ENSMUST00000102692	Pemt	1.113	3.936	0.638	−2.823	3.298	0.001	0.000
ENSMUST00000108690	Sco1	2.953	4.820	3.336	−1.867	1.484	0.003	0.039
ENSMUST00000118810	Mapk1ip1	5.624	3.973	6.284	1.651	−2.311	0.000	0.000
ENSMUST00000220218	Dusp6	2.374	4.045	2.309	−1.671	1.735	0.006	0.009
ENSMUST00000139960	Zfp740	6.075	4.873	6.204	1.202	−1.331	0.026	0.001
ENSMUST00000126638	Spc25	2.813	0.342	2.245	2.471	−1.903	0.006	0.034
ENSMUST00000002145	Hsf2bp	4.455	2.903	4.282	1.552	−1.378	0.004	0.007
ENSMUST00000162637	Reln	5.735	4.265	6.382	1.470	−2.117	0.007	0.000
ENSMUST00000184503	Gpr155	8.226	6.879	8.734	1.347	−1.855	0.017	0.002
ENSMUST00000152243	Kctd9	5.620	4.192	6.162	1.429	−1.970	0.011	0.000
ENSMUST00000156420	Ipo4	5.184	7.463	3.797	−2.279	3.666	0.047	0.005
ENSMUST00000201100	Nsun7	5.774	4.667	6.183	1.106	−1.515	0.000	0.001
ENSMUST00000084325	B4galt2	3.816	0.000	3.640	3.816	−3.640	0.030	0.012
ENSMUST00000020981	Cenpo	2.824	0.000	2.716	2.824	−2.716	0.047	0.026
ENSMUST00000217046	Plekha7	6.090	7.206	5.530	−1.116	1.676	0.001	0.000
ENSMUST00000149575	Spag8	0.000	3.071	0.000	−3.071	3.071	0.003	0.001
ENSMUST00000137699	Lap3	3.857	5.296	3.500	−1.438	1.795	0.006	0.003
ENSMUST00000110232	Adam33	1.734	4.021	0.000	−2.287	4.021	0.024	0.000
ENSMUST00000224385	Nedd4l	2.247	0.342	2.340	1.905	−1.998	0.048	0.030
ENSMUST00000163297	Tmc3	3.530	0.000	5.492	3.530	−5.492	0.033	0.000
ENSMUST00000038369	Cipc	9.865	1.951	4.142	7.914	−2.192	0.000	0.003
ENSMUST00000155260	Cmc2	5.463	4.162	5.530	1.300	−1.368	0.001	0.019
ENSMUST00000115098	Kcnh2	0.759	6.438	7.830	−5.679	−1.392	0.000	0.005
ENSMUST00000211431	Trpm4	5.630	6.960	5.564	−1.330	1.396	0.011	0.038
ENSMUST00000178644	Gm21969	4.940	3.544	5.875	1.396	−2.331	0.013	0.000
ENSMUST00000183241	Rnasel	3.583	0.000	5.634	3.583	−5.634	0.021	0.000
ENSMUST00000132123	Ago3	3.829	2.512	3.889	1.318	−1.377	0.028	0.020
ENSMUST00000196090	Lgi1	3.488	0.000	3.219	3.488	−3.219	0.029	0.026
ENSMUST00000126066	Zbtb38	3.411	6.845	5.634	−3.434	1.211	0.045	0.001
ENSMUST00000027495	44076	7.256	8.760	7.174	−1.503	1.585	0.009	0.003
ENSMUST00000023441	P2rx6	7.435	3.628	7.540	3.807	−3.912	0.022	0.015
ENSMUST00000129554	Surf6	2.902	0.000	3.859	2.902	−3.859	0.044	0.000
ENSMUST00000096222	Kat6b	7.744	8.993	7.666	−1.249	1.327	0.004	0.000
ENSMUST00000109946	Scrib	8.472	6.619	8.105	1.853	−1.486	0.000	0.000
ENSMUST00000110132	1110034G24Rik	4.710	3.363	5.112	1.347	−1.749	0.023	0.004
ENSMUST00000038959	Psd3	4.254	2.557	4.598	1.697	−2.040	0.010	0.001
ENSMUST00000146003	Mrpl48	6.039	7.915	5.505	−1.875	2.410	0.001	0.000
ENSMUST00000143685	Fkbp5	3.618	1.516	3.902	2.103	−2.386	0.018	0.003
ENSMUST00000172728	Fam92a	4.685	3.567	4.938	1.118	−1.371	0.040	0.006
ENSMUST00000115443	Met	3.331	5.935	3.912	−2.604	2.023	0.002	0.002
ENSMUST00000018547	Ggnbp2	9.278	7.995	9.206	1.282	−1.211	0.000	0.000
ENSMUST00000143867	Slc35f6	3.274	0.000	2.723	3.274	−2.723	0.028	0.026
ENSMUST00000143864	Trip4	0.000	4.650	1.841	−4.650	2.809	0.000	0.003
ENSMUST00000150258	Sgpl1	6.009	7.546	6.306	−1.537	1.240	0.023	0.037
ENSMUST00000166735	Papola	4.496	5.868	4.842	−1.372	1.026	0.020	0.042
ENSMUST00000137822	Rasa3	9.314	7.451	9.276	1.863	−1.825	0.000	0.000
ENSMUST00000030800	Fastk	2.527	5.315	2.357	−2.788	2.958	0.004	0.003
ENSMUST00000174779	Csnk2b	1.026	3.230	0.963	−2.204	2.267	0.031	0.014
ENSMUST00000127233	Tcf7l2	7.483	5.683	7.752	1.799	−2.068	0.045	0.020
ENSMUST00000123440	Rap1gap2	9.417	7.762	6.430	1.655	1.332	0.031	0.001
ENSMUST00000199125	Rilpl1	4.373	1.811	3.940	2.562	−2.129	0.000	0.001
ENSMUST00000105701	Masp2	0.331	3.169	0.000	−2.838	3.169	0.015	0.004
ENSMUST00000107068	E130114P18Rik	0.695	3.945	0.674	−3.250	3.271	0.000	0.000
ENSMUST00000110506	Sqor	3.584	0.331	2.652	3.253	−2.322	0.016	0.008
ENSMUST00000200570	Zzz3	5.183	0.000	5.078	5.183	−5.078	0.000	0.000
ENSMUST00000109997	Zfp961	7.935	6.827	9.272	1.108	−2.444	0.023	0.000
ENSMUST00000222617	Odc1	3.272	4.459	1.759	−1.187	2.699	0.010	0.006
ENSMUST00000088796	Tex47	3.190	4.543	2.666	−1.352	1.876	0.026	0.003
ENSMUST00000156455	Atf2	5.053	1.964	5.503	3.088	−3.539	0.027	0.005
ENSMUST00000109202	Ifi47	3.744	0.986	3.294	2.758	−2.308	0.002	0.002
ENSMUST00000122066	Zfp629	5.220	3.222	5.502	1.998	−2.280	0.004	0.002
ENSMUST00000113261	Cntn4	6.036	7.280	5.645	−1.244	1.635	0.016	0.011
ENSMUST00000170538	Eci2	0.000	3.488	0.943	−3.488	2.545	0.041	0.029
ENSMUST00000148702	Uimc1	3.202	0.000	3.039	3.202	−3.039	0.036	0.024
ENSMUST00000167110	Nfe2l1	4.342	1.516	3.130	2.826	−1.614	0.002	0.030
ENSMUST00000212716	Enkd1	4.287	2.259	3.868	2.027	−1.609	0.007	0.049
ENSMUST00000187400	Abi2	3.821	1.378	3.890	2.443	−2.512	0.002	0.000
ENSMUST00000177943	Slc45a3	3.324	0.000	6.362	3.324	−6.362	0.038	0.000
ENSMUST00000029666	Papss1	9.775	7.000	8.474	2.775	−1.474	0.000	0.014
ENSMUST00000022222	Erbin	1.026	3.028	0.963	−2.001	2.064	0.025	0.012
ENSMUST00000167096	Agtpbp1	5.791	2.965	4.148	2.826	−1.184	0.000	0.050
ENSMUST00000223068	Ispd	5.296	0.331	4.069	4.965	−3.738	0.000	0.010
ENSMUST00000039165	Golga1	4.925	6.119	7.625	−1.194	−1.506	0.031	0.010
ENSMUST00000001963	Ace	9.300	7.967	10.447	1.333	−2.480	0.007	0.000
ENSMUST00000066545	Shank3	7.184	8.216	6.908	−1.032	1.308	0.024	0.039
ENSMUST00000172578	Khdc3	3.774	1.598	3.441	2.176	−1.842	0.018	0.049
ENSMUST00000064285	Glcci1	10.489	7.730	9.740	2.759	−2.010	0.006	0.040
ENSMUST00000038193	Wdr59	7.378	6.330	7.632	1.047	−1.301	0.030	0.007
ENSMUST00000161908	Scyl3	3.947	6.819	4.701	−2.872	2.117	0.002	0.010
ENSMUST00000186242	Ppil3	3.271	1.518	3.303	1.754	−1.785	0.016	0.018
ENSMUST00000084455	Olfr61	3.150	4.240	3.054	−1.090	1.186	0.034	0.020
ENSMUST00000226068	Myof	3.580	2.194	5.175	1.387	−2.981	0.035	0.000
ENSMUST00000156053	Btbd17	6.378	5.353	7.068	1.025	−1.715	0.045	0.000
ENSMUST00000021817	Ippk	4.258	5.309	4.173	−1.051	1.136	0.023	0.045
ENSMUST00000029448	Sycp1	0.611	2.837	4.858	−2.225	−2.022	0.027	0.004
ENSMUST00000133925	Terf2	7.233	6.224	7.856	1.009	−1.632	0.045	0.000
ENSMUST00000029946	Rragd	0.397	2.554	0.638	−2.157	1.916	0.041	0.025
ENSMUST00000221379	Rps6ka5	4.858	0.986	4.736	3.872	−3.750	0.001	0.000
ENSMUST00000130597	Mavs	2.699	1.372	2.751	1.327	−1.379	0.049	0.034
ENSMUST00000160143	Rrnad1	3.663	1.706	3.160	1.957	−1.454	0.002	0.032
ENSMUST00000162170	Pianp	7.530	2.281	8.457	5.248	−6.176	0.000	0.000
ENSMUST00000140635	Rabl6	4.685	3.541	5.380	1.143	−1.839	0.039	0.000
ENSMUST00000140632	Ubl4a	4.704	3.369	4.568	1.335	−1.198	0.010	0.045
ENSMUST00000125887	Pde1a	3.669	5.066	2.920	−1.397	2.146	0.021	0.003
ENSMUST00000032926	Tmem219	2.651	0.000	4.685	2.651	−4.685	0.042	0.000
ENSMUST00000141305	Ift122	4.784	7.336	5.010	−2.552	2.326	0.001	0.000
ENSMUST00000115593	Deup1	3.664	0.788	3.619	2.876	−2.831	0.010	0.015
ENSMUST00000186017	Nek7	8.854	7.807	8.992	1.047	−1.185	0.038	0.027
ENSMUST00000151296	Osgepl1	6.673	5.373	6.659	1.300	−1.286	0.002	0.000
ENSMUST00000168649	Xpo6	3.730	4.899	3.101	−1.169	1.797	0.035	0.002
ENSMUST00000114388	Nsmf	7.308	4.716	6.847	2.592	−2.130	0.001	0.008
ENSMUST00000058089	Raly	9.897	8.510	9.573	1.387	−1.063	0.001	0.021
ENSMUST00000140257	Lsm14b	2.992	0.000	2.648	2.992	−2.648	0.038	0.034
ENSMUST00000161648	Mff	0.000	2.936	0.000	−2.936	2.936	0.049	0.025
ENSMUST00000130658	Zfp46	4.418	5.906	4.853	−1.488	1.053	0.000	0.034
ENSMUST00000150898	Slc25a19	6.147	4.258	5.761	1.889	−1.503	0.001	0.000
ENSMUST00000100302	Prkca	2.683	4.429	2.629	−1.745	1.800	0.001	0.001
ENSMUST00000176983	Wdr90	3.598	4.705	3.486	−1.107	1.219	0.029	0.036
ENSMUST00000029446	Csde1	11.398	10.346	11.597	1.053	−1.251	0.018	0.008
ENSMUST00000199502	Rasa4	2.472	3.803	4.923	−1.331	−1.120	0.023	0.020
ENSMUST00000201094	Tcf4	5.095	0.000	5.231	5.095	−5.231	0.000	0.000
ENSMUST00000187083	Hivep2	8.934	10.610	8.374	−1.676	2.235	0.000	0.000
ENSMUST00000146642	Homez	0.000	2.362	0.674	−2.362	1.688	0.039	0.046
ENSMUST00000150606	Pex11a	4.102	2.612	4.208	1.490	−1.596	0.035	0.013
ENSMUST00000094154	Serpinh1	9.021	7.710	8.850	1.311	−1.140	0.006	0.035
ENSMUST00000082121	Glmn	0.000	8.733	0.289	−8.733	8.444	0.000	0.000
ENSMUST00000179041	Cep170b	3.151	4.540	3.127	−1.389	1.413	0.028	0.021
ENSMUST00000101049	Elac2	9.281	7.945	9.302	1.336	−1.357	0.014	0.011
ENSMUST00000192844	Pfkfb3	8.749	6.867	8.808	1.882	−1.942	0.000	0.000
ENSMUST00000034046	Acsl1	10.077	8.990	10.270	1.086	−1.280	0.000	0.000
ENSMUST00000103236	Evi2a	7.802	5.028	8.180	2.774	−3.151	0.025	0.010
ENSMUST00000135346	Aspscr1	5.440	0.673	4.545	4.767	−3.872	0.000	0.000
ENSMUST00000043865	Mpst	3.832	2.033	5.771	1.799	−3.738	0.019	0.000
ENSMUST00000204182	Rarres2	4.573	3.509	4.715	1.064	−1.206	0.020	0.005
ENSMUST00000207168	Cars	3.754	1.946	4.161	1.809	−2.216	0.017	0.004
ENSMUST00000071697	Fxyd1	4.239	2.364	4.158	1.874	−1.794	0.027	0.035
ENSMUST00000160899	B3gat1	7.206	4.797	7.239	2.409	−2.443	0.000	0.000
ENSMUST00000105839	Usp48	6.243	4.496	5.996	1.747	−1.500	0.010	0.018
ENSMUST00000109731	Cdk5rap1	5.720	2.819	4.874	2.901	−2.055	0.010	0.031
ENSMUST00000047075	Setd1a	8.795	5.346	7.673	3.449	−2.327	0.000	0.000
ENSMUST00000054449	Plec	8.869	5.080	8.668	3.789	−3.588	0.012	0.001
ENSMUST00000079056	Arrb2	3.755	0.655	3.802	3.100	−3.147	0.002	0.001
ENSMUST00000112087	Tnnt2	0.000	2.146	0.000	−2.146	2.146	0.027	0.015
ENSMUST00000213990	Gnb5	7.190	3.929	6.721	3.261	−2.792	0.000	0.023
ENSMUST00000189542	Nabp1	7.663	2.805	4.869	4.858	−2.064	0.000	0.004
ENSMUST00000143224	Gramd2	6.278	7.463	6.093	−1.185	1.370	0.015	0.006
ENSMUST00000126123	Optc	3.631	0.540	3.776	3.091	−3.236	0.001	0.000
ENSMUST00000031845	Dfna5	1.842	3.329	1.665	−1.487	1.664	0.048	0.023
ENSMUST00000210676	Gab1	5.602	3.055	6.797	2.547	−3.741	0.029	0.000
ENSMUST00000166101	Sptb	10.109	7.509	10.113	2.600	−2.603	0.000	0.000
ENSMUST00000019447	Psmc3ip	3.554	5.089	3.651	−1.535	1.438	0.030	0.002
ENSMUST00000075180	Baiap2	4.153	5.293	4.188	−1.141	1.105	0.044	0.033
ENSMUST00000185661	Zfp672	7.882	0.741	8.445	7.141	−7.704	0.000	0.000
ENSMUST00000112634	Galnt13	8.106	6.138	8.595	1.968	−2.457	0.007	0.000
ENSMUST00000193432	Cog6	5.165	3.934	6.739	1.231	−2.805	0.023	0.000
ENSMUST00000056442	Slc6a5	3.385	5.045	12.001	−1.659	−6.957	0.015	0.023
ENSMUST00000053959	Ints6	7.969	6.224	7.504	1.745	−1.280	0.004	0.023
ENSMUST00000225663	Arhgef28	7.537	5.907	7.662	1.630	−1.755	0.008	0.005
ENSMUST00000087684	Rgs12	4.907	8.100	3.735	−3.192	4.365	0.000	0.010
ENSMUST00000136375	Rasal3	3.792	0.000	3.578	3.792	−3.578	0.026	0.000
ENSMUST00000062861	Rabggta	8.387	4.807	6.610	3.580	−1.803	0.000	0.010
ENSMUST00000134667	Syvn1	4.491	1.506	6.144	2.985	−4.638	0.014	0.000
ENSMUST00000164877	Rims1	4.824	2.684	4.527	2.140	−1.843	0.006	0.006
ENSMUST00000128668	Fbxl21	4.868	3.770	4.908	1.098	−1.138	0.038	0.032
ENSMUST00000123277	Slc35a2	3.579	0.000	2.611	3.579	−2.611	0.000	0.035
ENSMUST00000173114	Csnk2b	1.133	3.772	1.460	−2.639	2.312	0.034	0.010
ENSMUST00000058879	Ntf5	2.516	0.000	2.977	2.516	−2.977	0.009	0.000
ENSMUST00000180196	Slc39a8	3.596	0.342	3.502	3.254	−3.159	0.033	0.014
ENSMUST00000154043	Numb	0.298	3.548	0.000	−3.250	3.548	0.026	0.012
ENSMUST00000149685	Tspyl2	6.814	9.395	7.024	−2.581	2.371	0.004	0.013
ENSMUST00000032132	Efcc1	5.992	3.108	6.796	2.883	−3.687	0.000	0.000
ENSMUST00000115712	Nrg2	4.944	3.428	5.212	1.516	−1.784	0.016	0.005
ENSMUST00000168428	Znrf1	5.733	6.933	5.079	−1.200	1.854	0.045	0.002
ENSMUST00000177731	Rabep1	3.096	6.252	3.283	−3.156	2.969	0.000	0.000
ENSMUST00000143141	Arhgef16	4.191	0.000	4.717	4.191	−4.717	0.000	0.000
ENSMUST00000125946	Gm42878	7.976	3.944	6.477	4.032	−2.533	0.000	0.007
ENSMUST00000126287	Srcin1	0.000	4.140	0.000	−4.140	4.140	0.000	0.000
ENSMUST00000136640	Fcho1	7.878	6.425	5.156	1.453	1.269	0.000	0.005
ENSMUST00000043836	Macrod2	7.039	2.711	4.985	4.328	−2.274	0.000	0.013
ENSMUST00000172697	Mecom	3.534	1.112	4.620	2.422	−3.508	0.008	0.001
ENSMUST00000085245	Slc39a9	8.701	10.486	9.164	−1.784	1.322	0.000	0.003
ENSMUST00000187307	Wdr89	1.897	3.356	1.050	−1.458	2.306	0.047	0.041
ENSMUST00000172330	Pak3	10.944	7.820	10.732	3.125	−2.913	0.002	0.001
ENSMUST00000173689	Jmjd1c	9.721	4.331	8.017	5.390	−3.686	0.007	0.022
ENSMUST00000122327	Fam160a2	5.303	3.959	5.117	1.343	−1.158	0.017	0.035
ENSMUST00000039021	Ssx2ip	9.876	0.000	9.956	9.876	−9.956	0.000	0.000
ENSMUST00000035237	Usp4	8.121	5.669	8.651	2.452	−2.982	0.006	0.001
ENSMUST00000117692	Rab27b	5.426	2.876	4.587	2.549	−1.710	0.000	0.008
ENSMUST00000002395	Rec8	0.000	3.280	5.304	−3.280	−2.024	0.000	0.001
ENSMUST00000112197	Kdm5b	6.939	8.538	7.101	−1.599	1.437	0.000	0.002
ENSMUST00000170853	Synj1	10.984	12.214	10.327	−1.229	1.886	0.000	0.000
ENSMUST00000173762	Jmjd1c	7.791	6.175	4.994	1.617	1.181	0.003	0.041
ENSMUST00000041779	Clec4a2	4.986	3.803	2.310	1.183	1.493	0.014	0.012
ENSMUST00000201595	Ubl3	7.333	8.648	7.206	−1.316	1.442	0.015	0.006
ENSMUST00000112923	Ift122	2.912	6.264	3.521	−3.352	2.743	0.000	0.001
ENSMUST00000200380	Crip2	2.146	5.257	3.632	−3.112	1.625	0.001	0.003
ENSMUST00000107115	Ubtf	7.742	6.573	7.602	1.169	−1.029	0.015	0.027
ENSMUST00000042009	Dlg5	5.126	4.078	5.181	1.049	−1.103	0.039	0.025
ENSMUST00000027067	Gsta3	5.229	0.876	4.995	4.353	−4.118	0.002	0.001
ENSMUST00000081393	Nphp4	6.099	4.061	5.208	2.038	−1.147	0.006	0.046
ENSMUST00000128345	Brinp3	7.279	4.132	5.144	3.147	−1.012	0.027	0.045
ENSMUST00000105914	Ahdc1	1.934	3.983	1.510	−2.048	2.472	0.018	0.029
ENSMUST00000224693	Nsd1	3.274	0.000	4.217	3.274	−4.217	0.039	0.000
ENSMUST00000196194	Zfp697	6.015	7.119	5.567	−1.104	1.551	0.005	0.000
ENSMUST00000147104	Tia1	3.915	2.756	4.696	1.160	−1.941	0.047	0.004
ENSMUST00000111143	Lmo2	6.088	1.898	4.389	4.190	−2.491	0.000	0.002
ENSMUST00000125935	Clip3	6.063	3.720	5.960	2.343	−2.239	0.005	0.004
ENSMUST00000060956	Trappc1	2.862	0.000	3.002	2.862	−3.002	0.050	0.019
ENSMUST00000039153	Cept1	3.517	2.278	3.304	1.239	−1.026	0.044	0.048
ENSMUST00000170928	Med7	4.267	0.986	3.124	3.281	−2.138	0.002	0.007
ENSMUST00000140554	Rita1	4.283	1.946	4.322	2.336	−2.375	0.019	0.029
ENSMUST00000204532	Magi1	7.049	3.379	6.290	3.670	−2.911	0.001	0.024
ENSMUST00000224754	Sec24c	4.884	1.169	4.641	3.715	−3.471	0.032	0.043
ENSMUST00000137267	Ydjc	2.938	1.518	4.218	1.420	−2.701	0.045	0.002
ENSMUST00000066717	Tcf4	4.646	2.527	4.198	2.119	−1.671	0.008	0.021
ENSMUST00000130116	Sema3e	6.030	7.952	5.766	−1.922	2.186	0.007	0.006
ENSMUST00000053666	Slc12a6	6.995	4.400	5.526	2.595	−1.126	0.000	0.028
ENSMUST00000137563	Atp5h	8.178	6.322	8.183	1.856	−1.861	0.019	0.021
ENSMUST00000107201	Cdc42se1	0.000	3.646	2.254	−3.646	1.391	0.004	0.035
ENSMUST00000107200	Cdc42se1	6.911	5.125	6.410	1.786	−1.285	0.000	0.010
ENSMUST00000146588	Tm9sf1	5.628	3.138	4.659	2.490	−1.522	0.000	0.013
ENSMUST00000091763	Nme8	2.312	0.000	2.091	2.312	−2.091	0.027	0.021
ENSMUST00000114126	Stx18	8.249	7.189	8.218	1.059	−1.029	0.001	0.006
ENSMUST00000195731	Chst10	3.366	0.000	4.775	3.366	−4.775	0.031	0.000
ENSMUST00000122116	Atg16l2	3.651	4.956	3.566	−1.305	1.390	0.028	0.012
ENSMUST00000145735	Lamtor5	9.765	8.207	7.000	1.559	1.206	0.000	0.006
ENSMUST00000124293	Dlk1	4.827	3.749	5.203	1.078	−1.454	0.047	0.005
ENSMUST00000102911	Slc44a1	9.991	8.484	10.370	1.507	−1.886	0.000	0.000
ENSMUST00000138282	Zc3h7a	7.805	4.072	6.284	3.733	−2.211	0.000	0.000
ENSMUST00000149074	1810043G02Rik	4.509	3.260	4.930	1.249	−1.670	0.034	0.007
ENSMUST00000135944	Pdlim2	2.428	0.000	2.072	2.428	−2.072	0.010	0.027
ENSMUST00000137543	Samd4	9.819	8.056	10.356	1.763	−2.300	0.000	0.000
ENSMUST00000069325	Dnaic2	5.967	4.074	6.252	1.893	−2.179	0.000	0.000
ENSMUST00000133019	Trpv4	4.421	1.421	5.281	3.000	−3.860	0.034	0.000
ENSMUST00000117301	Ddr1	0.000	3.331	1.865	−3.331	1.465	0.008	0.035
ENSMUST00000190785	2810474O19Rik	2.198	5.566	8.132	−3.368	−2.567	0.004	0.007
ENSMUST00000027800	Tmem63a	7.516	9.708	6.436	−2.192	3.272	0.024	0.000
ENSMUST00000149207	Col6a4	1.572	3.846	0.000	−2.274	3.846	0.007	0.000
ENSMUST00000185692	2310035C23Rik	7.998	3.290	5.524	4.708	−2.234	0.008	0.037
ENSMUST00000079322	Heph	3.689	2.086	6.842	1.603	−4.756	0.014	0.000
ENSMUST00000212989	Slc27a1	5.106	2.616	4.585	2.490	−1.969	0.000	0.000
ENSMUST00000115026	Cald1	8.622	7.021	9.284	1.601	−2.262	0.002	0.000
ENSMUST00000128381	Haus6	4.856	5.926	4.893	−1.070	1.034	0.017	0.014
ENSMUST00000212161	Spata33	3.873	0.000	2.791	3.873	−2.791	0.000	0.027
ENSMUST00000182903	Baiap3	4.025	1.441	4.294	2.584	−2.853	0.005	0.001
ENSMUST00000086209	Rnasel	5.296	6.957	5.144	−1.661	1.813	0.001	0.000
ENSMUST00000220346	Cep290	7.238	5.914	7.579	1.324	−1.666	0.023	0.005
ENSMUST00000098552	Tmod2	12.398	14.537	12.595	−2.139	1.941	0.000	0.000
ENSMUST00000042227	D11Wsu47e	5.544	4.511	6.181	1.033	−1.670	0.048	0.000
ENSMUST00000108124	Lingo2	4.730	3.330	6.034	1.400	−2.704	0.049	0.001
ENSMUST00000124725	Pkp4	4.430	5.908	4.071	−1.478	1.837	0.011	0.004
ENSMUST00000187638	Ccnyl1	3.578	1.041	2.781	2.536	−1.740	0.002	0.050
ENSMUST00000150780	Acbd4	7.679	6.128	7.149	1.551	−1.021	0.000	0.016
ENSMUST00000074834	Plec	7.507	3.706	7.207	3.801	−3.501	0.037	0.033
ENSMUST00000107040	Acbd4	7.435	5.212	6.657	2.224	−1.446	0.000	0.021
ENSMUST00000034692	Olfm2	1.573	5.007	1.778	−3.434	3.229	0.001	0.000
ENSMUST00000087818	Olfr262	0.000	2.179	0.000	−2.179	2.179	0.027	0.015
ENSMUST00000128338	Btbd11	3.560	5.825	4.823	−2.265	1.002	0.003	0.041
ENSMUST00000155133	Rars2	3.818	0.673	2.586	3.145	−1.913	0.004	0.030
ENSMUST00000165999	Cyp4f17	7.821	6.340	7.719	1.482	−1.379	0.000	0.001
ENSMUST00000002007	Siae	6.510	3.371	2.158	3.138	1.213	0.041	0.041
ENSMUST00000146201	Fbxo22	8.794	7.007	8.637	1.787	−1.630	0.001	0.001
ENSMUST00000110849	Rcor3	5.504	2.809	6.895	2.695	−4.085	0.009	0.000
ENSMUST00000171802	Mcmdc2	0.000	3.094	0.000	−3.094	3.094	0.049	0.026
ENSMUST00000173669	C4b	5.750	3.805	5.298	1.946	−1.494	0.000	0.001
ENSMUST00000113645	Phyhd1	3.110	1.176	3.438	1.934	−2.262	0.046	0.017
ENSMUST00000214328	Olfr679	0.000	2.173	0.000	−2.173	2.173	0.023	0.012
ENSMUST00000137735	Ctcf	2.749	3.963	2.806	−1.214	1.157	0.043	0.035
ENSMUST00000185861	Ly6e	6.325	2.038	6.939	4.287	−4.900	0.000	0.000
ENSMUST00000138752	Hdc	3.228	0.680	3.919	2.548	−3.240	0.037	0.000
ENSMUST00000211743	Trpm4	0.397	3.920	1.390	−3.524	2.530	0.000	0.014
ENSMUST00000133176	B4galt7	2.775	0.000	3.105	2.775	−3.105	0.037	0.018
ENSMUST00000106923	Rhog	1.275	5.775	2.017	−4.500	3.758	0.001	0.000
ENSMUST00000108199	Fut9	4.838	3.803	5.852	1.036	−2.049	0.020	0.000
ENSMUST00000177420	Pcdh15	3.788	5.619	3.500	−1.831	2.119	0.007	0.003
ENSMUST00000019051	Alox12e	2.622	0.501	2.722	2.121	−2.221	0.049	0.021
ENSMUST00000143238	1500009C09Rik	9.990	8.540	9.830	1.450	−1.290	0.002	0.004
ENSMUST00000042146	Stx18	4.523	0.000	3.312	4.523	−3.312	0.000	0.020
ENSMUST00000112848	Mapk10	4.548	5.837	3.563	−1.289	2.275	0.022	0.001
ENSMUST00000184560	Nlrp6	0.000	3.118	0.000	−3.118	3.118	0.040	0.020
ENSMUST00000108429	Rps19	7.779	0.000	7.264	7.779	−7.264	0.000	0.000
ENSMUST00000114877	Parp9	6.318	3.075	5.270	3.243	−2.196	0.000	0.005
ENSMUST00000162541	Wnk1	5.678	7.718	4.938	−2.040	2.779	0.000	0.000
ENSMUST00000123437	Lmo2	5.598	3.935	5.000	1.664	−1.065	0.000	0.023
ENSMUST00000210599	Cars2	5.474	1.961	4.309	3.513	−2.348	0.000	0.009
ENSMUST00000221694	Tmem170b	6.467	4.540	5.986	1.927	−1.447	0.000	0.012
ENSMUST00000029120	Raly	2.607	8.384	5.010	−5.777	3.374	0.000	0.004
ENSMUST00000029126	Itch	7.360	4.734	8.505	2.626	−3.771	0.028	0.002
ENSMUST00000196130	Snx8	4.768	1.813	5.247	2.955	−3.434	0.021	0.003
ENSMUST00000065603	Lrrc49	6.233	7.315	6.148	−1.082	1.167	0.048	0.020
ENSMUST00000204655	C2cd5	4.185	5.219	3.663	−1.034	1.557	0.041	0.012
ENSMUST00000170771	Frk	2.726	0.000	3.136	2.726	−3.136	0.041	0.018
ENSMUST00000113870	Tsc1	8.137	6.734	9.216	1.403	−2.483	0.010	0.000
ENSMUST00000103088	Elmo2	9.184	0.986	3.332	8.198	−2.346	0.000	0.017
ENSMUST00000202991	Ube2a	0.000	3.593	0.000	−3.593	3.593	0.000	0.000
ENSMUST00000193899	Pcdh11x	7.327	6.108	8.261	1.219	−2.154	0.016	0.000
ENSMUST00000135424	Hnrnpdl	8.899	7.284	9.880	1.615	−2.595	0.000	0.000
ENSMUST00000182131	Rnasel	6.473	7.601	5.901	−1.128	1.699	0.011	0.001
ENSMUST00000155592	Tfpt	5.788	7.326	5.930	−1.539	1.396	0.002	0.007
ENSMUST00000176363	Atp2c1	6.831	8.402	7.228	−1.571	1.174	0.001	0.032
ENSMUST00000072631	Nkx2-9	0.526	2.744	4.350	−2.218	−1.606	0.028	0.014
ENSMUST00000156357	Edc4	5.082	6.432	4.385	−1.351	2.047	0.024	0.000
ENSMUST00000150862	Dpy19l3	3.279	4.577	2.954	−1.298	1.623	0.006	0.017
ENSMUST00000178293	Usp27x	7.172	5.640	2.651	1.532	2.990	0.017	0.015
ENSMUST00000197307	Magi2	5.084	3.017	4.456	2.067	−1.438	0.000	0.004
ENSMUST00000027579	Actr3	2.131	5.125	1.460	−2.994	3.665	0.000	0.000
ENSMUST00000138191	Clu	4.061	2.632	4.617	1.428	−1.984	0.028	0.000
ENSMUST00000098132	Il11ra1	8.321	7.304	8.648	1.017	−1.344	0.017	0.000
ENSMUST00000145791	Tcirg1	1.639	4.085	1.493	−2.447	2.593	0.014	0.006
ENSMUST00000133775	Acad10	6.578	5.403	6.684	1.175	−1.281	0.002	0.002
ENSMUST00000111716	Arpc3	3.780	4.835	3.384	−1.055	1.450	0.033	0.012
ENSMUST00000077146	Dsg1a	0.664	2.879	1.123	−2.216	1.757	0.049	0.045
ENSMUST00000068693	Wdr86	4.658	0.663	3.469	3.995	−2.806	0.000	0.015
ENSMUST00000209061	Zfp36	4.727	2.355	4.873	2.372	−2.518	0.002	0.001
ENSMUST00000209066	Irf3	2.489	0.986	3.148	1.503	−2.162	0.047	0.006
ENSMUST00000196762	Nme6	4.216	3.103	4.118	1.112	−1.015	0.036	0.044
ENSMUST00000043794	Jakmip1	2.925	9.560	4.437	−6.635	5.123	0.002	0.000
ENSMUST00000109647	Vstm2a	6.268	4.844	6.017	1.424	−1.173	0.007	0.023
ENSMUST00000072481	Sgip1	8.846	10.039	4.711	−1.193	5.327	0.025	0.045
ENSMUST00000135214	Shank3	4.345	5.706	3.975	−1.361	1.731	0.023	0.009
ENSMUST00000132726	Mepce	2.950	0.331	3.406	2.619	−3.075	0.003	0.000
ENSMUST00000171738	Slc25a53	7.214	0.000	7.063	7.214	−7.063	0.000	0.000
ENSMUST00000072521	Adgrl3	7.400	5.987	7.010	1.413	−1.023	0.003	0.026
ENSMUST00000031797	Ssmem1	2.838	3.971	2.953	−1.133	1.017	0.030	0.042
ENSMUST00000192666	Mfsd7b	4.830	0.000	2.853	4.830	−2.853	0.000	0.026
ENSMUST00000206976	Mctp2	3.740	4.930	3.810	−1.190	1.121	0.035	0.026
ENSMUST00000169134	Fbxl17	3.300	5.455	3.044	−2.156	2.411	0.002	0.000
ENSMUST00000162663	Tyw5	3.356	4.933	3.218	−1.577	1.715	0.011	0.005
ENSMUST00000124745	Dda1	8.804	7.454	8.510	1.349	−1.055	0.007	0.050
ENSMUST00000099084	Zmynd8	3.297	7.930	3.230	−4.633	4.700	0.015	0.006
ENSMUST00000099296	Bfsp1	0.872	4.585	0.838	−3.713	3.747	0.005	0.000
ENSMUST00000211301	Trak1	2.821	5.592	2.895	−2.771	2.697	0.042	0.023
ENSMUST00000128256	Mtmr3	9.864	4.541	9.905	5.323	−5.364	0.000	0.000
ENSMUST00000075869	Fbxo40	3.006	4.209	6.307	−1.203	−2.098	0.040	0.005
ENSMUST00000160098	Tbc1d31	5.016	3.551	5.413	1.465	−1.862	0.028	0.006
ENSMUST00000081919	Musk	3.226	0.000	2.648	3.226	−2.648	0.036	0.034
ENSMUST00000186056	Myrf	8.043	6.501	7.789	1.542	−1.288	0.001	0.009
ENSMUST00000139266	Sulf2	4.756	6.192	4.868	−1.435	1.324	0.029	0.017
ENSMUST00000147132	Pcsk4	3.869	0.501	4.972	3.368	−4.471	0.000	0.000
ENSMUST00000111977	Cfh	3.149	1.613	3.912	1.536	−2.299	0.044	0.006
ENSMUST00000113800	B3galt5	3.256	4.432	2.655	−1.176	1.777	0.038	0.027
ENSMUST00000118917	Chdh	3.785	4.932	2.547	−1.147	2.385	0.039	0.007
ENSMUST00000131462	Plxnb1	4.340	3.106	4.548	1.233	−1.442	0.023	0.003
ENSMUST00000178615	Rbm4	4.764	3.572	4.782	1.192	−1.209	0.038	0.023
ENSMUST00000172282	Ptbp1	4.969	2.570	6.060	2.399	−3.490	0.012	0.000
ENSMUST00000173159	Chd1	3.064	4.386	3.250	−1.322	1.136	0.027	0.025
ENSMUST00000152095	9330182L06Rik	5.896	4.067	5.234	1.829	−1.167	0.006	0.032
ENSMUST00000100287	Abca8a	5.083	2.096	4.787	2.987	−2.690	0.005	0.000
ENSMUST00000064244	Rexo4	1.541	4.468	1.908	−2.926	2.559	0.000	0.000
ENSMUST00000155491	Bri3	0.000	2.581	0.517	−2.581	2.064	0.006	0.034
ENSMUST00000214640	Commd4	1.444	3.654	1.465	−2.210	2.189	0.002	0.001
ENSMUST00000150029	Reps1	5.907	4.148	5.775	1.759	−1.627	0.034	0.049
ENSMUST00000132689	Ripor2	3.936	5.590	3.196	−1.655	2.395	0.010	0.001
ENSMUST00000082303	Col15a1	3.513	0.000	2.657	3.513	−2.657	0.001	0.041
ENSMUST00000056338	Zfp536	3.963	2.098	6.349	1.865	−4.251	0.029	0.000
ENSMUST00000132527	Col9a3	2.495	5.164	0.325	−2.668	4.839	0.000	0.000
ENSMUST00000212414	Kcnn1	0.000	2.616	0.468	−2.616	2.147	0.013	0.032
ENSMUST00000110371	Acsl1	4.822	3.544	5.813	1.278	−2.269	0.024	0.001
ENSMUST00000165709	Usp24	7.117	5.272	7.592	1.845	−2.321	0.004	0.001
ENSMUST00000137024	Sirt3	5.150	3.624	5.926	1.526	−2.302	0.009	0.000
ENSMUST00000100411	Pfkfb3	3.272	5.863	4.293	−2.592	1.571	0.009	0.004
ENSMUST00000202677	Tex26	0.481	2.753	0.349	−2.272	2.404	0.041	0.012
ENSMUST00000151944	Mfsd11	3.008	4.104	3.044	−1.096	1.060	0.036	0.036
ENSMUST00000120674	Riox2	4.493	2.924	4.352	1.569	−1.428	0.013	0.020
ENSMUST00000160471	Gpatch2	6.206	1.425	3.032	4.781	−1.607	0.000	0.041
ENSMUST00000009705	Eng	4.009	6.934	4.671	−2.925	2.263	0.049	0.040
ENSMUST00000045091	Kirrel3	3.958	2.054	4.172	1.904	−2.118	0.019	0.003
ENSMUST00000046549	Apobec2	3.694	2.243	3.550	1.451	−1.307	0.016	0.036
ENSMUST00000078021	Glmn	8.121	4.406	7.818	3.715	−3.413	0.000	0.000
ENSMUST00000111627	Mobp	4.522	3.318	5.593	1.203	−2.275	0.039	0.000
ENSMUST00000141425	Rec8	2.433	0.000	3.317	2.433	−3.317	0.013	0.000
ENSMUST00000109266	Zmynd8	9.867	3.816	10.110	6.051	−6.294	0.000	0.000
ENSMUST00000144625	Cfap74	5.262	3.705	5.866	1.557	−2.161	0.019	0.001
ENSMUST00000142283	Homez	3.486	1.506	6.316	1.980	−4.810	0.020	0.000
ENSMUST00000150351	Appl2	4.908	3.778	5.566	1.129	−1.788	0.035	0.004
ENSMUST00000211259	Car11	4.758	6.166	5.121	−1.408	1.045	0.007	0.031
ENSMUST00000065573	Gpatch2	3.001	6.545	3.896	−3.544	2.649	0.044	0.021
ENSMUST00000054564	Pcolce	3.209	0.342	5.026	2.867	−4.684	0.036	0.000
ENSMUST00000149871	Irak1	2.757	0.313	4.495	2.444	−4.182	0.046	0.000
ENSMUST00000140490	Steap3	0.000	3.767	0.000	−3.767	3.767	0.027	0.011
ENSMUST00000169736	Pgghg	6.469	3.687	6.436	2.782	−2.749	0.001	0.000
ENSMUST00000029795	Rorc	0.000	5.172	7.488	−5.172	−2.316	0.000	0.000
ENSMUST00000144491	Tmem44	6.909	9.480	7.047	−2.571	2.433	0.000	0.000
ENSMUST00000119339	Ythdc1	4.671	1.174	4.738	3.497	−3.564	0.002	0.000
ENSMUST00000167063	Mpp6	4.664	2.740	4.215	1.923	−1.475	0.006	0.004
ENSMUST00000096194	Tmem2	7.834	4.161	7.027	3.673	−2.866	0.001	0.008
ENSMUST00000111106	Psen2	1.583	3.212	1.343	−1.629	1.869	0.036	0.013
ENSMUST00000105466	P4ha1	9.916	7.881	9.396	2.035	−1.515	0.000	0.003
ENSMUST00000125764	Jkamp	0.000	2.709	0.289	−2.709	2.420	0.049	0.031
ENSMUST00000144682	6430548M08Rik	4.322	2.689	4.701	1.633	−2.012	0.032	0.006
ENSMUST00000049430	Galnt18	5.219	6.594	4.492	−1.375	2.102	0.013	0.002
ENSMUST00000181402	Emc8	6.112	7.204	8.401	−1.092	−1.197	0.039	0.046
ENSMUST00000192068	Prkar2a	3.187	4.732	3.607	−1.545	1.125	0.010	0.041
ENSMUST00000023146	Nubp1	7.291	5.370	6.928	1.920	−1.557	0.000	0.002
ENSMUST00000035844	Josd2	3.979	6.494	5.176	−2.515	1.318	0.000	0.020
ENSMUST00000024791	Trem2	6.450	4.107	6.036	2.344	−1.929	0.000	0.002
ENSMUST00000168122	Sned1	4.786	3.648	5.170	1.137	−1.522	0.025	0.001
ENSMUST00000220845	Zfand4	5.664	4.614	5.640	1.050	−1.026	0.005	0.014
ENSMUST00000168977	Ylpm1	8.145	6.175	7.175	1.971	−1.001	0.001	0.000
ENSMUST00000164100	Tmod2	8.858	6.568	8.791	2.290	−2.223	0.039	0.027
ENSMUST00000126603	Lgals4	3.999	1.346	4.913	2.653	−3.567	0.024	0.000
ENSMUST00000001484	Tbx21	3.126	0.000	2.137	3.126	−2.137	0.041	0.015
ENSMUST00000118390	Synj1	10.688	9.094	10.835	1.594	−1.741	0.009	0.011

Con: control; Mod: model; PSP: Polygonatum sibiricum polysaccharide.

Figure 2.

Distinct expression patterns of mRNAs and functional enrichment analyses. Heatmap of the expression profiles of significantly differentially expressed (DE) mRNAs between the Control group and Model group (A), and between the Model group and the PSP group (B). Volcano plot of the expression profiles of DE mRNAs between the Control group and Model group (C), and between the Model group and the PSP group (D). GO enrichment analysis of mRNAs that were altered by PSP treatment (E). The ordinate represents the GO term while the abscissa represents the − log10 (p-value). BP represents the biological process, CC represents the cellular component, and MF represents the molecular function. (F) KEGG enrichment analysis of mRNAs that were altered by PSP. The ordinate represents the KEGG pathway whilethe abscissa represents the − log10(p-value). PSP: Polygonatum sibiricum polysaccharide.

GO analysis of 679 PSP-related mRNAs identified several GO terms that were highly enriched (Figure 2(E)). The most enriched terms with regards to biological processes were positive regulation of dendritic spine development, cellular component organization, and localization. As for cellular components, the most enriched terms were the intracellular part, organelle part, and cell cortex. The most enriched molecular function terms were protein binding, binding, and protein domain–specific binding. As shown in Figure 2(E), KEGG analysis demonstrated that O-glycan biosynthesis, sulphur metabolism, and adherens junctions, may be closely associated with the ameliorative effect of PSP on cognitive impairment and brain ageing.

Functional analysis of differentially expressed circular RNAs

By comparing the Model group with the Control group, we identified 271 ageing-related circRNAs (137 upregulated and 134 downregulated). A total of 37 alterations of circRNA expression were reversed following PSP treatment (Table 3); in each case, expression levels returned to levels that were similar to those of the Control group. We also used heatmaps and volcano plots to determine the differential expression of circRNAs in the three groups (Figure 3(A–D)).

Table 3.

Dysregulated circRNAs associated with the anti-brain ageing effect of PSP.

circRNA_ID	Con	Mod	PSP	log2FoldChange		P value
				Con_vs_Mod	Mod_vs_PSP	Con_vs_Mod	Mod_vs_PSP
11:21652226|21664385	2.4987	0.0000	1.5880	2.4987	−1.5880	0.0079	0.0356
10:33996667|34012137	3.2867	1.2694	3.2118	2.0174	−1.9425	0.0254	0.0351
2:29227578|29248878	2.8816	4.3125	2.8197	−1.4309	1.4928	0.0277	0.0277
1:176874564|176919686	0.0000	2.2272	0.0000	−2.2272	2.2272	0.0165	0.0157
11:29705535|29708770	5.2253	4.0147	5.1879	1.2106	−1.1732	0.0068	0.0240
2:40919136|40928022	1.1005	3.0837	0.7580	−1.9833	2.3258	0.0255	0.0325
4:106423460|106436855	0.0000	1.9829	0.0000	−1.9829	1.9829	0.0290	0.0269
8:104517907|104527449	0.0000	1.8868	0.0000	−1.8868	1.8868	0.0382	0.0354
4:44893533|44895989	2.2399	0.0000	2.0619	2.2399	−2.0619	0.0157	0.0279
1:133753089|133753749	3.0811	4.2791	2.2187	−1.1980	2.0604	0.0442	0.0011
15:81600908|81616863	1.9999	0.0000	2.0961	1.9999	−2.0961	0.0280	0.0179
5:118077577|118095729	0.0000	1.5555	0.0000	−1.5555	1.5555	0.0430	0.0392
10:105413217|105413787	2.6183	0.0000	2.0574	2.6183	−2.0574	0.0050	0.0226
12:55659048|55677265	2.5505	0.0000	1.7102	2.5505	−1.7102	0.0042	0.0353
3:88981233|89007877	2.0806	0.0000	1.8287	2.0806	−1.8287	0.0271	0.0222
2:155432816|155440785	1.9271	0.0000	2.4661	1.9271	−2.4661	0.0167	0.0097
5:118593333|118680971	0.4995	2.8826	0.0000	−2.3831	2.8826	0.0191	0.0028
1:192116269|192130460	2.0510	0.0000	2.3057	2.0510	−2.3057	0.0093	0.0203
9:110517505|110521364	0.0000	2.7886	0.0000	−2.7886	2.7886	0.0038	0.0039
17:68455693|68463020	2.0998	0.0000	2.7630	2.0998	−2.7630	0.0234	0.0028
11:104368680|104425293	1.7583	0.0000	2.3437	1.7583	−2.3437	0.0255	0.0102
18:73648885|73678039	3.4036	1.7218	3.4239	1.6818	−1.7021	0.0222	0.0309
5:25798446|25825215	1.1005	2.9398	0.0000	−1.8393	2.9398	0.0405	0.0020
12:16558723|16560981	0.0000	1.6711	0.0000	−1.6711	1.6711	0.0463	0.0422
5:107406032|107419879	0.0000	2.1166	0.0000	−2.1166	2.1166	0.0233	0.0220
19:16707327|16725693	0.0000	2.9756	0.0000	−2.9756	2.9756	0.0211	0.0180
15:99738665|99745946	0.7404	3.0031	1.0563	−2.2627	1.9468	0.0429	0.0378
10:91158748|91166069	0.0000	1.7917	0.0000	−1.7917	1.7917	0.0278	0.0376
6:83928653|83972283	1.8538	0.0000	2.0625	1.8538	−2.0625	0.0156	0.0276
11:23354845|23364512	0.0000	1.9661	0.0000	−1.9661	1.9661	0.0380	0.0349
10:109747194|109760528	0.4995	2.7214	0.0000	−2.2219	2.7214	0.0324	0.0043
1:60437056|60453762	1.1015	3.0883	1.0563	−1.9868	2.0320	0.0236	0.0240
16:52268382|52296984	2.4988	3.6868	0.5150	−1.1880	3.1718	0.0468	0.0004
5:106632925|106666845	3.5873	1.9829	3.6412	1.6044	−1.6583	0.0362	0.0409
7:84262393|84305259	0.0000	2.0461	0.0000	−2.0461	2.0461	0.0115	0.0301
9:99262546|99263809	0.0000	1.6519	0.0000	−1.6519	1.6519	0.0279	0.0483
13:83575535|83635469	0.0000	1.6695	0.0000	−1.6695	1.6695	0.0474	0.0430

Con: control; Mod: model; PSP: Polygonatum sibiricum polysaccharide.

Figure 3.

Distinct expression patterns of circRNAs and functional enrichment analyses Heatmap of the expression profiles of significantly differentially expressed (DE) circRNAs between the Control group and the Model group (A), and between the Model group and the PSP group (B). Volcano plot of the expression profiles of DE circRNAs between the Control group and the Model group (C), and between the Model group and the PSP group (D). GO enrichment analysis of circRNAs that were altered by PSP treatment (E). The ordinate represents the GO term while the abscissa represents the − log10 (p-value). BP represents the biological process, CC represents the cellular component, and MF represents the molecular function. (F) KEGG enrichment analysis of circRNAs altered by PSP. The ordinate represents the KEGG pathway, while the abscissa represents the − log10 (p-value). PSP: Polygonatum sibiricum polysaccharide.

Subsequently, we performed GO and KEGG enrichment analysis based on the source genes of 37 PSP-related circRNAs (Figure 3(E–F)). GO analysis showed that the most enriched biological processes terms were anatomical structure development, synapse organization, and the regulation of cellular component biogenesis. The most enriched cellular component terms were synapse, neuron part, and dendritic shaft. The most enriched molecular function was protein domain–specific binding, PDZ domain binding, and calcium-transporting ATPase activity. KEGG analysis indicated that bacterial invasion of epithelial cells, sulphur metabolism, and adherens junctions were the most significantly enriched KEGG pathways related to the ameliorative effect of PSP on cognitive impairment and brain ageing.

Differentially expressed microRNAs and their targets

By comparing miRNA transcriptomes from the different groups of miRNA samples, we identified 38 ageing-related miRNAs (20 upregulated and 18 downregulated in the Model group), and 13 PSP-targeting miRNAs (Table 4). Next, we constructed heatmaps and a volcano plot (Figure 4(A–D)). We attempted to analyse the functions of these miRNAs by performing functional enrichment analyses on their target genes. By extracting consensus predictions using established miRNA target prediction tools, we obtained target genes for miRNAs with high levels of confidence.

Table 4.

Dysregulated miRNAs associated with the anti-brain ageing effect of PSP.

Gene_ID	Con	Mod	PSP	log2FoldChange		p Value
				Con_vs_Mod	Mod_vs_PSP	Con_vs_Mod	Mod_vs_PSP
mmu-miR-129b-5p	5.4384	4.3598	5.4384	1.0785	−1.0629	0.0150	0.0188
mmu-miR-182-5p	7.7668	10.3368	7.7668	−2.5700	3.9824	0.0218	0.0000
mmu-miR-183-5p	7.1995	10.2440	7.1995	−3.0445	3.7345	0.0161	0.0000
mmu-miR-190a-5p	5.2352	6.8532	5.2352	−1.6180	1.8460	0.0095	0.0040
mmu-miR-1981-5p	10.2688	9.1380	10.2688	1.1309	−1.2873	0.0057	0.0027
mmu-miR-300-5p	3.8334	5.0310	3.8334	−1.1976	1.2587	0.0364	0.0235
mmu-miR-32-5p	6.8976	7.9036	6.8976	−1.0060	1.8191	0.0481	0.0006
mmu-miR-449a-5p	4.7387	5.7892	4.7387	−1.0505	1.0962	0.0248	0.0350
mmu-miR-5100	4.0377	2.9478	4.0377	1.0899	−2.0204	0.0309	0.0004
mmu-miR-5110	2.4317	0.4057	2.4317	2.0260	−2.4317	0.0114	0.0015
mmu-miR-551b-5p	4.2948	3.0900	4.2948	1.2048	−1.2390	0.0406	0.0271
mmu-miR-7044-3p	3.0497	1.3562	3.0497	1.6934	−3.0497	0.0454	0.0001
mmu-miR-96-5p	4.6470	8.2457	4.6470	−3.5987	4.3200	0.0131	0.0000

Con: control; Mod: model; PSP: Polygonatum sibiricum polysaccharide.

Figure 4.

Distinct expression patterns of miRNAs and functional enrichment analyses Heatmap of significantly differentially expressed (DE) miRNAs between the Control group and the Model group (A), and between the Model group and the PSP group (B). Volcano plot of the expression profiles of DE miRNAs between the Control group and the Model group (C), and between the Model group and the PSP group (D). GO enrichment analysis of miRNAs altered by PSP treatment (E). The ordinate represents the GO term while the abscissa represents the − log10 (p-value). BP represents the biological process, CC represents the cellular component, and MF represents the molecular function. (F) KEGG enrichment analysis of miRNA altered by PSP: The ordinate represents the KEGG pathway while the abscissa represents the − log10(p value). PSP: Polygonatum sibiricum polysaccharide.

GO analysis of 13 PSP-related miRNAs identified several GO terms that were highly enriched (Figure 4(E)). The most enriched biological processes were system development, anatomical structure morphogenesis, and positive regulation of the biological process. The most enriched cellular component GO terms were intracellular, intracellular part, and cytoplasm. The most enriched molecular functions were protein binding, binding, and ion binding. A series of significantly enriched KEGG pathways were also detected (Figure 4(F)); of these pathways in cancer, the Wnt-signalling pathway, and axon guidance, were the most significant.

Validation of expression profiles

Real-time qPCR analysis is usually conducted to validate the findings obtained from RNA-Seq (Zhang et al. 2019). In the present study, a total of 14 dysregulated mRNAs, miRNAs, and circRNAs, were randomly selected to validate our microarray results by real-time qPCR. As shown in Figure 5, the expression levels determined by real-time qPCR were in agreement with the RNA-Seq results. Thus, all circRNAs, miRNAs, and mRNAs, were confirmed to be targets that were closely related to PSP treatment; these molecules were therefore included in all further analyses.

Figure 5.

Differential expression of mRNAs, miRNAs, and circRNAs, as validated by real-time quantitative polymerase chain reaction (q-PCR). The miRNA expression levels detected by RNA sequencing (mmu-miR-182-5p, mmu-miR-183-5p, mmu-miR-5110, mmu-miR-7044-3p, mmu-miR-96-5p), mRNAs (Pianp, Ubl5, Stmn1, Tspyl2, Hnrnpu), and circRNAs (10:33996667|34012137, 7:84262393|84305259, 2:29227578|29248878, 11:29705535|29708770) were consistent with q-PCR results. ‘PSP’ represents brain ageing model mice treated with PSP. ‘Control’ represents untreated mice. ‘Model’ represents brain ageing model mice. PSP: Polygonatum sibiricum polysaccharide.

Prediction of circRNA–miRNA–mRNA interactions

Next, we constructed a circRNA-associated ceRNA network to reveal the novel inter-regulatory relationships between circRNAs, miRNAs, and mRNAs (Figure 6). Based on the differentially expressed RNAs between the Control group and the Model group, we constructed a circRNA-associated ceRNA network related to brain ageing (containing 19 mRNAs, 9 circRNAs, and 12 miRNAs). This network showed that by competitively binding with mmu-miR-5110, PSP can regulate two circRNAs (5:106632925|106666845, 2:29227578|29248878) and subsequently regulate nine mRNAs (Ace, Ubl5, Gab1, Cep170b, Synj1, Ccdc24, Bean1, Wdr89, Pianp). It is worth noting that PSP was able to regulate multiple RNAs (Slc6a5, Bean1, Ace, Samd4, Olfr679, Olfr372, Dhrs9, Tsc1, Slc12a6, mmu-miR-5110, mmu-miR-449a-5p, mmu-miR-1981-5p, 2:29227578|29248878, 5:106632925|106666845) in this ceRNA network, thus suggesting that circRNAs harbour miRNA response elements and play pivotal regulatory roles in the anti-ageing mechanism of PSP.

Figure 6.

A circRNA-miRNA-mRNA interaction network. The circle, square, and triangle represent mRNA, circRNA, and miRNA, respectively. Red and green represent upregulation and downregulation, respectively. The arrow represents RNAs that underwent changes in response to PSP treatment. PSP: Polygonatum sibiricum polysaccharide.

Discussion

Brain ageing is a process in which the brain gradually loses its ability to adapt to the environment as age increases. It has been established that the long-term systemic administration of high levels of d-gal induces behavioural and neurobiological changes that are similar to natural brain ageing (Pourmemar et al. 2017; Nam et al. 2019). In our study, the chronic injection of d-gal prolonged the escape latency and swimming distance of mice in an established behavioural test, thus indicating that the d-gal model is a well-established method for investigating anti-ageing pharmacological therapy. PSP is known to exhibit anti-ageing properties (Zheng 2020). In the present study, we found that the administration of PSP could reverse the dysfunction in learning and memory abilities caused by d-gal interference. Thus, as also reported by other groups, we documented evidence for the brain-protective effect of PSP on the d-gal-induced mouse model of ageing.

ncRNAs and ncRNA-regulatory processes are known to be important determinants in the pathogenesis of brain ageing and neurodegeneration (Esteller 2011; Szafranski et al. 2015). Thus, we focussed exclusively on ncRNA in order to elucidate the protective mechanisms of PSP on brain ageing. To the best of our knowledge, this is the first study to create a circRNA-associated ceRNA network and reveal regulator pathways relating to the protective effects of PSP on memory dysfunction in a mouse model of brain ageing induced by d-gal. We identified 37 DE circRNAs, 13 DE miRNAs, and 679 DE mRNAs, that were related to the protective function of PSP; these results were also validated by real-time qPCR. Next, we constructed a circRNA–miRNA–mRNA network. GO enrichment analysis and KEGG pathway analysis were also performed to functionally annotate the predicted target genes. Overall, these analyses provided clues to the mechanisms that underlie the ameliorative effect of PSP on the learning and memory abilities of mice experiencing brain ageing. This approach could shed new light on the prevention of neurodegenerative disorders.

First, we focussed on the DE coding genes. A total of 1175 upregulated and 1250 downregulated ageing-related mRNAs were detected. We also found that 679 mRNAs were potentially related to the protective effect of PSP against brain ageing. Earlier reports on the pathogenesis of ageing have already reported some of these RNAs. For example, the CD82-TRPM7-Numb signalling axis was previously shown to participate in the progression of age-related cognitive impairment. The upregulated expression of TRPM7 α-kinase cleavage and the phosphorylation of Numb were both associated with ageing and resulted in increased levels of Aβ secretion (Zhao et al. 2020). In another study, Carbajosa et al. (2018) investigated the impact of TREM2 deficiency using RNA-Seq and identified disruption in the gene networks related to endothelial cells that was more apparent in younger mice than aged mice. Interestingly, our findings indicate that PSP treatment can reduce the upregulated levels of TRPM2 and Numb caused by brain ageing. The SNX8, TSC1, and Sirt3, genes play important roles in ageing and age-associated diseases. A moderate increase in TSC1 expression is known to enhance overall health status (Zhang et al. 2017). An increase in SNX8 expression is also known to alleviate cognitive impairment in AD mice (Xie et al. 2019). The overexpression of Sirt3 in several tissues also suggested improved levels of protection against ROS-induced ageing (Tong et al. 2005; Qiu et al. 2010; Hallows et al. 2011). In the present study, we observed downregulated levels of SNX8, TSC1, and Sirt3, in the Dal-induced mouse when compared with controls. Interestingly, the expression levels of these genes were upregulated following PSP treatment. Current research is increasingly focussing on the role of synaptic organization in brain ageing. Interestingly, we also found that synapse-related genes were associated with mechanisms underlying the effects of PSP treatment. For example, abnormal expression levels of STXBP1 are known to impair synaptic neurotransmission; thus, STXBP1 has been identified as a new interventional target to protect the ageing brain (Lee et al. 2019). Other research has shown that Tcf4 is involved in synaptic plasticity in mature neurons, and that the functional loss of Tcf4 may contribute to neurological symptoms in Pitt–Hopkins syndrome (Crux et al. 2018). We observed downregulated expression levels of STXBP1 and upregulated expression levels of Tcf4, in the Dal-induced mouse compared with the Control group and showed that PSP treatment could reverse these changes.

Recent research on circRNAs has proved essential in revealing many of the molecular mechanisms that underlie the development and pathology of certain diseases, including ageing and age-related diseases (Knupp and Miura 2018). Drugs that target circRNAs potentially represent novel therapeutics for brain ageing in neurodegenerative diseases. In our research, we identified a total of 271 circRNAs that were related to brain ageing; of these, 38 circRNAs were found to play critical roles in the anti-brain ageing effects of PSP. GO analysis and KEGG analysis were performed to predict their function. It was evident that a significant number of GO terms were related to neuronal synapse (e.g., synapse, synapse organize, neuron to neuron synapse, and asymmetric synapse). Previous studies on brain tissue from a variety of mammalian species have concluded that the most consistent correlates with ageing are a reduced number of synaptic connections among neurons (Brunso-Bechtold et al. 2000; Peters et al. 2008; Soghomonian et al. 2010; VanGuilder et al. 2010) and cognitive decline (Dickson et al. 1995; VanGuilder et al. 2011). The balance between excitatory and inhibitory synaptic systems is a particularly hot topic in the field of brain ageing at present (Bishop et al. 2010; Deak & Sonntag 2012). Existing data, together with our present findings, indicate that pathological processes associated with synaptic dysfunction are most likely to lead to cognitive impairment in brain ageing. Further molecular and electrophysiological studies are now required to identify the specific molecular pathways that contribute to the specific effects of PSP at the synapse. It is also important that we identify the mechanisms that regulate learning and memory in brain ageing.

The regulation of brain ageing is associated with the differential expression of miRNAs, as revealed by previous studies involving RNA transcriptome analysis in the whole mouse brain (Eacker et al. 2011; Inukai et al. 2012). In the present study, a total of 38 miRNAs were associated with brain ageing. We also identified a limited number of miRNAs that play important roles in the anti-ageing effects of PSP. Previous research showed that the transfection of synthetic miR-182-5p and miR-183-5p mimics led to increased neurite outgrowth and the neuroprotection of dopaminergic neurons in vitro and in vivo, thus mimicking the effects of Glial cell line-derived neurotrophic factor (Roser et al. 2018). In the present study, we identified elevated levels of miR-182-5p and miR-183-5p in PSP-treated mice when compared with mice experiencing brain ageing. KEGG analysis further showed that the Wnt-signalling pathway is potentially a critical pathway and shows a strong association with the mechanism responsible for the ameliorative effects of PSP on brain ageing. Accumulating evidence now supports the hypothesis that dysfunctional Wnt signalling could be closely related to the pathogenesis of ageing-related brain diseases (Caricasole et al. 2004; Berwick and Harvey 2014; Smith-Geater et al. 2020). During the process of ageing, changes in the expression of Wnt-related molecules may lead to a reduction in the accumulation of presynaptic and postsynaptic proteins. Combined with other factors, this process will result in a decline in ability with regards to performing the morphometric adjustments required for neuronal plasticity, thus leading to cognitive decline in the elderly (Libro et al. 2016). These findings indicated that PSP potentially attenuates brain ageing by regulating Wnt signalling and synaptic activity.

Perturbations in ceRNA regulatory networks, including mRNAs, miRNAs, and circRNAs, are considered to play an essential role in the pathogenesis of ageing-related brain diseases (Wang et al. 2018). A circRNA-miRNA-mRNA regulatory network has already been constructed and used to elucidate the mechanisms underlying AD (Wang et al. 2018). Furthermore, the circDLGAP4/miR-134-5p/CREB-signalling pathway has been reported to exert functionality in the progression of PD (Feng et al. 2020). In the present study, we used ceRNA regulatory network analysis to generate a putative circRNA–miRNA–mRNA co-expression network during brain ageing. Moreover, we identified certain circRNAs that may act as sponges and play a role in the protective effect of PSP against brain ageing. We found that PSP-targeted circRNAs could competitively bind to mmu-miR-5110 and subsequently regulate the expression of nine mRNAs. These observations need to be investigated further.

Conclusions

We investigated whether PSP could improve learning and memory impairment in mice experiencing brain ageing induced by d-gal. We found that PSP could effectively ameliorate cognitive dysfunction during brain ageing. We also used high-throughput RNA sequencing to evaluate brain ageing-related mRNAs, circRNAs, and miRNAs, and identified the profiles of a range of RNAs that were dysregulated and targeted by PSP. We also constructed a circRNA–miRNA–mRNA network associated with brain ageing and PSP interventions. This network will help us to understand the transcriptional mechanisms associated with brain ageing and the pharmacological mechanisms of PSP. The corresponding roles and molecular mechanisms associated with these ncRNAs and mRNAs need to be investigated further.