Literature DB >> 33784298

Evaluation of the basic assay performance of the GeneSoc® rapid PCR testing system for detection of severe acute respiratory syndrome coronavirus 2.

Ryosuke Watanabe1, Satomi Asai2,3, Hidehumi Kakizoe2, Hirofumi Saeki2, Atsuko Masukawa1, Miki Miyazawa3, Kazumi Ohtagawa1, Mend-Amar Ravzanaaadii2, Mika Doi2, Haruyo Atsumi2, Kazuo Umezawa4, Hayato Miyachi2,3.   

Abstract

In the ongoing coronavirus disease 2019 (COVID-19) pandemic, PCR has been widely used for screening patients displaying relevant symptoms. The rapid detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) enables prompt diagnosis and the implementation of proper precautionary and isolation measures for the patient. In the present study, we aimed to evaluate the basic assay performance of an innovative PCR system, GeneSoC® (Kyorin Pharmaceutical Co. Ltd., Tokyo, Japan). A total of 1,445 clinical samples were submitted to the clinical laboratory, including confirmed or suspected cases of COVID-19, from February 13 to August 31. Specimen types included nasopharyngeal swabs. The sampling was performed several times for each patient every 2-7 days. Using this system, sequences specific for SARS-CoV-2 RNA could be detected in a sample within 10-15 min using the microfluidic thermal cycling technology. Analytical sensitivity studies showed that GeneSoC® could detect the target sequence of the viral envelope and RNA-dependent RNA-polymerase (RdRp) genes at 5 and 10 copies/μL, respectively. The precision of the GeneSoC® measurements using clinical isolates of the virus at a concentration of 103 copies/μL was favorable for both the genes; within-run repeatability and between-run reproducibility coefficient of variation values were less than 3% and 2%, respectively; and the reproducibility of inter-detection units was less than 5%. Method comparison by LightCycler® 480 showed the positive and negative agreement to be 100% [(174/174) and (1271/1271), respectively]. GeneSoC® proved to be a rapid and reliable detection system for the prompt diagnosis of symptomatic COVID-19 patients and could help reduce the spread of infections and facilitate more rapid treatment of infected patients.

Entities:  

Mesh:

Year:  2021        PMID: 33784298      PMCID: PMC8009387          DOI: 10.1371/journal.pone.0248397

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The novel coronavirus disease was initially reported as pneumonia of unknown origin occurring in the city of Wuhan in China’s Hubei Province on December 30, 2019 [1]. After it was identified as a new type of coronavirus on January 7, 2020, it began to spread around the world, starting in Asia [2]. On February 11, 2020, the World Health Organization (WHO; https://www.who.int/) named this disease coronavirus disease 2019 (COVID-19) and gave the causal virus the official name of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2; https://talk.ictvonline.org/). The disease frequently presents with symptoms, such as fever, respiratory symptoms, headaches, and malaise, with digestive symptoms appearing in less than 10% of cases. Approximately 80% of patients recover within one week and have only mild symptoms. For the remaining 20%, pneumonia symptoms worsen in 7–10 days, requiring hospitalization. In approximately 2%–3% of patients, symptom severity increases after 10 days, eventually causing the disease to become fatal [3, 4]. Currently, most qualitative tests for the detection of SARS-CoV-2 in Japan are carried out in accordance with the protocol recommended by the National Institute of Infectious Diseases (https://www.niid.go.jp/niid/ja/) using an equipment, such as the LightCycler® 480 system (Roche Diagnostics, Basel, Switzerland). However, the amplification and detection take at least 3 h, and the nucleic acid extraction process requires 30–60 min, resulting in a long total testing time of 4–5 h. In addition, the measurement operations are so complex that dedicated personnel with relevant competence are necessary. Because the assay is a batch process, individual real-time measurements at clinical testing sites are difficult. Recently, the innovative PCR system GeneSoC® (Kyorin Pharmaceutical Co. Ltd., Tokyo, Japan) that detects specific SARS-COV-2 RNA sequences using a microfluidic thermal cycling technology, has been developed. This system is capable of detecting a sequence specific to microbial pathogens in a sample within 10–15 min and can be operated on-site in a clinical setting [5, 6]. Here, we report the results of our study conducted to evaluate the basic assay performance of this innovative GeneSoC® system for the detection of SARS-CoV-2. The performance of the GeneSoC® system will exceed that of current test methods, both in terms of rapidity and reliability.

Materials and methods

Materials

A total of 1,445 clinical samples were submitted to the clinical laboratory upon testing requests from in-hospital patients and the outpatient department, including confirmed or suspected cases of COVID-19, from February 13 to August 31, 2020. Specimen types included nasopharyngeal swabs. The sampling was performed several times in each patient every 2–7 days. The patients provided verbal as well as written informed consent to participate in this study. This study was approved by the review board of Tokai University (19R-321).

Specimen processing

Swab specimens were soaked and dissolved in 2.0 mL of PBS (-) immediately after collection. A total of 140 μL of this solution was applied to a QIAamp Viral RNA Mini Kit (Qiagen, Tokyo, Japan), and RNA was extracted following the manufacturer’s instructions.

PCR with GeneSoC®

GeneSoC® uses heaters to control the temperature for reverse transcription, denaturation, annealing, and extension processes, with thermal cycling performed by sending the PCR solution to and from each heater. Accordingly, this microfluidic thermal cycling through the roundtrip transport of preheated denaturation, annealing, and extension processes drastically reduces the time required for temperature changes in the sample solution. The GeneSoC® device is composed of a main unit and a detection unit. The system is expandable to run up to four detection units on a single main unit. All components of the system are integrally controlled [5, 6]. The reaction kit and polymerase used for this study were the One Step Prime Script RT-PCR kit (Takara Bio Inc., Shiga, Japan) and Speed STAR HS DNA polymerase (Takara Bio Inc.), as described in Table 1A and 1B. Reaction reagent (15 μL) was mixed with template RNA (5 μL), and the solution was dispensed onto a reaction panel chip customized for GeneSoC®. Primers and probes were targeted to E genes (hereinafter, E primer) and RdRp genes (hereinafter, RdRp primer). The primer and probe arrangement (5′ to 3′) (Table 2) [7] and PCR conditions (Table 3) were as shown.
Table 1

A. Components of high-speed RT-PCR mixtures (for the E gene).

B. Components of high-speed RT-PCR mixtures (for the RdRp Gene).

A.
ReagentsFinal concentration
2X OneStep RT-PCR Buffer IIIa1X
50X ROX solutiona0.2X
PrimeScript RT enzyme Mix IIa2 U/μL
SpeedSTARTM HS DNA Polymerase0.25 U/μL
E primer solutionForward2.0 μM
Reverse2.0 μM
E probe solution0.2 μM
B.
ReagentsFinal concentration
2X OneStep RT-PCR Buffer IIIa1X
50X ROX solutiona0.2X
PrimeScript RT enzyme Mix IIa2 U/μL
SpeedSTARTM HS DNA Polymerase0.25 U/μL
RdRp primer solutionForward2.4 μM
Reverse3.2 μM
RdRp probe solution0.4 μM

aEach reagent was included in the One Step PrimeScriptTM RT-PCR Kit (Takara Bio Inc., Shiga, Japan).

Table 2

GeneSoC® primer and probe arrangement.

PrimerPrimer and Probe Arrangement (5′ to 3′)
E gene Forward (2.0 μM)ACAGGTACGTTAATAGTTAATAGCGT
E gene Reverse (2.0 μM)ATATTGCAGCAGTACGCACACA
Probe (0.2 μM)Cy5-ACACTAGCCATCCTTACTGCGCTTCG-BHQ3
RdRp gene Forward (2.4 μM)GTGARATGGTCATGTGTGGCGG
RdRp gene Reverse (3.2 μM)CARATGTTAAASACACTATTAGCATA
Probe (0.4 μM)Cy5-CAGGTGGAACCTCATCAGGAGATGC-BHQ3
Table 3

GeneSoC® PCR conditions.

ConditionTemperature [°C]Time [s]
Reverse transcription5090
Hot start9610
Denaturation965
Annealing608
Cycle50

A. Components of high-speed RT-PCR mixtures (for the E gene).

B. Components of high-speed RT-PCR mixtures (for the RdRp Gene). aEach reagent was included in the One Step PrimeScriptTM RT-PCR Kit (Takara Bio Inc., Shiga, Japan).

PCR with LightCycler® 480

The PCR method using the LightCycler® 480 system is the major testing method used in Japan, and for this study, it was performed in accordance with the Novel Coronavirus Pathogen Detection Manual issued by the National Institute of Infectious Diseases (https://www.niid.go.jp/niid/ja/). The kit used was the QuantiTect Probe RT-PCR kit (Qiagen). Reaction reagent (15 μL) was mixed with template RNA (5 μL), and the solution was dispensed on the LightCycler® 96 well plate. Primers and probes were targeted to N2 genes. Although there are two probes for the N and N2 regions, the more sensitive probe N2 was chosen for comparison. The primer and probe arrangement (5′ to 3′) (Table 4) [8] and PCR conditions (Table 5) were as shown.
Table 4

LightCycler® 480 primer and probe arrangement.

PrimerPrimer and Probe Arrangement (5′ to 3′)
Forward (10 μM)AAATTTTGGGGACCAGGAAC
N2 Reverse (10 μM)TGGCAGCTGTGTAGGTCAAC
Probe (5 μM)FAM-ATGTCGCGCATTGGCATGGA-TAMRA
Table 5

LightCycler® 480 PCR conditions.

ModeCyclesTemp.TimeRamp RateAcquisition Mode
[°C]
[°C/s]
Reverse transcriptionNone15030 min4.4None
DenatureNone19515 min4.4None
PCRQuantification459515 s4.4None
456060 s2.2Single
CoolingNone14030 s4.4None

Analytical sensitivity

The AcroMetrixTM Coronavirus 2019 (COVID-19) RNA Control (Thermo Fisher Scientific Waltham, MA, USA) was used for the evaluation of analytical sensitivity, and a serial dilution method was carried out using RNase-free water (5 × 101, 4 × 101, 3 × 101, 2 × 101, 1× 101, 5 × 100, and 2 × 100 copies/μL). The analytical sensitivity of GeneSoC® (E primer and RdRp primer) was compared with that of LightCycler® 480 (N2 primer). The required volume of control RNA was included in each assay (in units of 5 μL). Measurements were performed in triplicate. With GeneSoC®, the output waveform was judged visually. If the fluorescent wavelength was determined to rise sharply above the baseline without falling back during measurement, a positive result was indicated, and if it remained at the baseline with no obvious rise, a negative result was indicated. For the LightCycler®, in addition to visual confirmation of a rise in the fluorescent signal, there is a built-in automated judgment function that provides the final result.

Within-run repeatability

For within-run reproducibility testing, clinically isolated viral RNA at a concentration of 103 copies/μL was used, and measurements were repeated for five consecutive runs. A comparison of Ct values was carried out using the second derivative maximum method to calculate the percent coefficient of variation (%CV).

Between-run reproducibility

For the daily rate repeatability study, clinically isolated viral RNA at a concentration of 103 copies/μL was used, and measurements were performed for three consecutive days. Comparison of Ct values was carried out using the second derivative maximum method to calculate the %CV.

Reproducibility among different detection units

To test the reproducibility among different detection units, measurements were performed with three different concentrations of clinically isolated viral RNA (104, 103, and 1 copy/μL) using three different detection units connected to the same GeneSoC® main unit. Ct values were compared using the second derivative maximum method to calculate the %CV.

Method comparison study

For the method comparison study, residual samples from a total of 1,445 clinical specimens were used. Measurements were performed with the LightCycler® 480 and GeneSoC® systems, and result judgments were made using the applicable judgment method for each detection method (https://www.niid.go.jp/niid/ja/) [8].

Statistical analysis

The positive and negative predictive rates were calculated for the comparison between methods in this study. The Microsoft Excel software (Microsoft Corporation, Redmond, WA, USA) was used.

Results

Results of the analytical sensitivity study using a dilution series of the standard showed that GeneSoC® detected the target sequence of E and RdRp genes at a concentration of 5 and 10 copies/μL, respectively (Fig 1A and 1B), whereas LightCycler® 480 detected the N2 gene at a concentration of 2 copies/μL (Table 6).
Fig 1

Results of the measurement of SARS-CoV-2 RNA standards using the GeneSoC®.

E (A) and RdRp (B) Primers. The concentrations of the SARS-CoV-2 RNA standards were 5 × 101, 4 × 101, 3 × 101, 2 × 101, 1× 101, 5 × 100, and 2× 100 copies/μL. For 5 × 101, 4 × 101, 3 × 101, 2 × 101, and 1 × 101 copies/μL, a rising waveform was observed, and positive results were confirmed for both the E and RdRp primers. For 5 × 100 copies/μL, a rising waveform was only observed with the E primer. For 2× 100 copies/μL, no rising waveform could be identified with both E and RdRp primers. E primer (E), RdRp primer (RdRp).

Table 6

Comparison of the primer detection sensitivity of GeneSoC® and LightCycler®.

Primer (copies/μL)5 × 104 × 103 × 102 × 101 × 105 × 1002 × 100
N2 (LightCycler® 480)+++++++
E (GeneSoC®)++++++-
RdRp (GeneSoC®)+++-+--

Results of the measurement of SARS-CoV-2 RNA standards using the GeneSoC®.

E (A) and RdRp (B) Primers. The concentrations of the SARS-CoV-2 RNA standards were 5 × 101, 4 × 101, 3 × 101, 2 × 101, 1× 101, 5 × 100, and 2× 100 copies/μL. For 5 × 101, 4 × 101, 3 × 101, 2 × 101, and 1 × 101 copies/μL, a rising waveform was observed, and positive results were confirmed for both the E and RdRp primers. For 5 × 100 copies/μL, a rising waveform was only observed with the E primer. For 2× 100 copies/μL, no rising waveform could be identified with both E and RdRp primers. E primer (E), RdRp primer (RdRp). The %CV values acquired from five consecutive measurements of 103 copies/μL RNA were 1.48% and 2.89% for the E and RdRp primers, respectively (Table 7). Both were within 3%, indicating a good reproducibility.
Table 7

Within-run reproducibility.

Ct values
nE PrimerRdRp Primer
130.032.0
231.034.5
330.034.0
430.034.0
530.034.0
Average30.2033.70
SD0.450.97
%CV1.482.89

Standard deviation (SD); Coefficient of variation (CV).

Standard deviation (SD); Coefficient of variation (CV). The %CV values acquired from three consecutive days of measurements of 103 copies/μL RNA were 1.84% and 0.84% for the E primer and RdRp primers, respectively (Table 8). Both were within 2%, indicating a good reproducibility.
Table 8

Between-run reproducibility.

Ct values
DayE PrimerRdRp Primer
132.0034.00
231.0034.00
331.0034.50
Average31.3334.17
SD0.580.29
%CV1.840.84

Standard deviation (SD); Coefficient of variation (CV).

Standard deviation (SD); Coefficient of variation (CV). No major differences were observed between the detection units in the measurement of different concentrations of RNA using the E and RdRp primers (Table 9). The %CV values were as follows: (a) 104 copies/μL, E primer 2.04% and RdRp primer 4.72%; (b) 103 copies/μL, E primer 0.00% and RdRp primer 1.68%; and (c) 101 copy/μL, the test results were negative for both the genes. For the detectable RNA concentrations (104 copies/μL and 103 copies/μL), %CV was within 5% for both the genes, indicating no significant difference among detection units.
Table 9

Reproducibility of GeneSoC® among different detection units.

Ct values
Detection Unit104 copies/μL103 copies/μL1 copy/μL
ERdRpERdRpERdRp
PrimerPrimerPrimerPrimerPrimerPrimer
129.031.032.035.0--
228.032.032.034.0--
328.034.032.034.0--
Average28.3332.3332.0034.33--
SD0.581.530.000.58--
%CV2.044.720.001.68--

Standard deviation (SD); Coefficient of variation (CV).

Standard deviation (SD); Coefficient of variation (CV). The method comparison of the GeneSoC® with the LightCycler® 480 system for testing 38 clinical samples revealed positive and negative agreement of 100% [(174/174) and (1271/1271), respectively] (Table 10).
Table 10

Comparison of clinical sample detection between GeneSoC® and LightCycler® 480.

LightCycler® 480
PositiveNegativeTotal
GeneSoC®Positive1740174
Negative012741274
Total17412741445

Discussion

This study evaluated the basic assay performance of the GeneSoC® system for the detection of SARS-CoV-2 RNA. The GeneSoC® system uses a microfluidic thermal cycling technology that can rapidly produce a nucleic acid amplification reaction as quickly as within 10–15 min. Precision study results were favorable for both within and between runs at RNA concentrations of 103 copies/μL with a CV within 3%, and between units with a CV within 5%, indicating stable detection performance. The time required for SARS-CoV-2 RNA PCR testing can be reduced using the GeneSoC® system. When the GeneSoC® results of 1445 clinical samples were compared with those of LightCycler® 480, positive and negative agreement was 100%. This suggests that the GeneSoC® system could be effective as a rapid confirmatory diagnostic method for symptomatic cases normally having a high viral load. The GeneSoC® system uses a microfluidic thermal cycling technology to drive the nucleic acid amplification reaction. As a result, the amplification efficiency is almost the same, with analytical sensitivity not significantly lower as compared to standard PCR methods. The analytical sensitivity study revealed that the GeneSoC® system targeting E and RdRp genes was slightly inferior to the LightCycler® 480 system targeting the N2 gene, which is the method recommended by the National Institute of Infectious Diseases. Although the GeneSoC® system was shown to have a tendency toward false negatives when the viral load of a sample was very low, no clinical samples yielded a negative result. Virus multiplication and infectivity reportedly declines from the 9th day after the onset of illness [9], and the national guidance for the isolation of patients in Japan has been revised to reflect this. In a clinical setting, the need for negative confirmation testing is no longer mandatory. Accordingly, difficulty in negative confirmation with the GeneSoC® system is unlikely to be an impediment in using it in a clinical setting. Causes for clinical samples with a low viral load leading to a failure of viral detection include improper sample collection, specimen types, and collection timing in the clinical course. When COVID-19 is strongly suspected in pneumonia patients but the virus is not detected with nasopharyngeal swabs, the use of specimens from the lower respiratory tract, such as sputum samples, should be considered [10, 11]. For COVID-19, GeneSoC® is an effective method for the rapid detection of early-stage symptomatic cases with high viral load. The reproducibility among different detection units was confirmed to be favorable, and because multiple detection units can be fitted to a single main unit, the system can be used for the rapid and simultaneous measurement of multiple samples. Including the time required for nucleic acid extraction procedures, the test can be completed in as little as 40 min. Furthermore, a direct real-time RT-PCR method, based on exclusion of the interfering substances, are investigated. According to the preliminary study using a probe for the N2 gene, this method shows high sensitivity and the results are obtained in 20–30 min, including the time taken for the addition of reagents. Accordingly, the system would allow us to report test results in a rapid and real-time manner. Multiple specimen processing could reduce the burden on testing sites. When a simple and rapid procedure for RNA extraction, such as inhibitor inactivation, can be incorporated, the total assay time could be shortened to 20 min. Such an assay will become more useful, especially considering the recent trend of increasing numbers of COVID-19 cases as a resurgence of the epidemic has been observed, as well as the expected increase in the number of cases in the coming winter months, owing to seasonal factors in Japan. For an emergency case, warranting immediate hospitalization and isolation, a chest CT scan is necessary regardless of test availability and its result. When rapidity is not an issue, the use of nucleic acid amplification detection methods with a higher analytical sensitivity, such as LightCycler® 480 targeting the N2 gene, should be considered. In the GeneSoC® detection system, test results are judged based on a visual procedure analyzing the output waveform, which determines a final positive or negative result to be released. However, if the sample viral load is near the analytical sensitivity limit, judging the rising waveform can be difficult in some cases. In addition, currently, there are no positive or internal controls in use, and thus, a positive result due to contamination or a possible false negative result due to inhibitors cannot be ruled out. Based on these points, the development of clear judgment standards and automated judgment of results are desirable for the future. Currently, the development of a fully automated system of all processes, including automated extraction for the improvement of the analytic sensitivity of measurements and overall process speed, as well as automated judgment of the output waveform, is underway. In conclusion, the GeneSoC® system is beneficial for a rapid, reliable, and highly sensitive real-time testing of SARS-CoV-2. Further applications in a wide range of situations in medical settings are warranted, along with improvements in the performance of the assay. 30 Dec 2020 PONE-D-20-38418 Evaluation of the basic assay performance of the GeneSoC® Rapid PCR Testing System for detection of Severe Acute Respiratory Syndrome Coronavirus 2 PLOS ONE Dear Dr. Asai, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The comments raised by the reviewers seem minor. I hope you can revise your manuscript easily. Please submit your revised manuscript by Feb 13 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Etsuro Ito Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This paper deals with the evaluation of a new PCR system, GeneSoc, for detection of SARS-CoV-2 from clinical specimens. The authors present a careful and thorough analysis of this system while comparing with another system, LightCycler 480, that is the major testing tool used in Japan. The aim addressed is interesting and important. I would recommend it for acceptance after the minor points listed below. Comments: 1. GeneSoc PCR system uses the primers and probes targeted to two genes (E and RdRp genes). Why these genes were chosen? Does the employment of these genes in this system have an advantage over LightCycler 480 system where one gene (N2 gene) is used as primer and probe? 2. As shown in Table 6, LightCycler 480 system was superior to GeneSoc system in term of the sensitivity for the detection of SARS-CoV-2. It is important not to miss the patients with a low viral load for preventing the spread of SARS-CoV-2 infection. Is there any room for improvement in the sensitivity of viral detection? 3. In specimen processing, the authors used a QIAamp Viral RNA Mini Kit. How long does it take to extract viral RNA? Is there a possibility of further time saving? Reviewer #2: In this study, RT-PCR assay for SARS-CoV-2 by GeneSoC® was completed in 15 min using the system described by the authors. The positive conformity ratio for SARS-CoV-2 of the GeneSoC® was similar to that obtained with the LightCycler®480 system. The quality control guidelines of this system were well described. The system is appropriate for medical and clinical use. The following minor changes are necessary so that this thesis is accepted. Q1. You targeted only the N2 region on the LightCycler® 480, why did you not target the N1 region. Q2. RNA extraction takes more than 30 min. further, development of such as the direct RT-PCR assay method is needed. Do you have any other suggestions? Q3. How was the reproducibility of the three negative samples? Q4. Please emphasize that it is more useful even if it is less sensitive than the light cycler. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Comments PLOS ONE 20201224.docx Click here for additional data file. 21 Feb 2021 Responses to the reviewer’s comments This paper deals with the evaluation of a new PCR system, GeneSoc, for detection of SARS-CoV-2 from clinical specimens. The authors present a careful and thorough analysis of this system while comparing with another system, LightCycler 480, that is the major testing tool used in Japan. The aim addressed is interesting and important. I would recommend it for acceptance after the minor points listed below. Comments: 1. GeneSoc PCR system uses the primers and probes targeted to two genes (E and RdRp genes). Why these genes were chosen? Does the employment of these genes in this system have an advantage over LightCycler 480 system where one gene (N2 gene) is used as primer and probe? Response As mentioned in the main text, the N region is recommended by the (Japanese) National Institute of Infectious Diseases. Two types of primers and probes, N and N2, are available for this region. The system presents a positive result if either N or N2 is positive. However, owing to the better sensitivity obtained with N2, many facilities in Japan only use the N2 probe for detection. We have explained this in the revised manuscript for the benefit of the readers (Lines 129-130). Although tests using the N gene are popular in Japan, when GeneSoC® was first developed in 2020, tests using E and RdRp genes were also common in other countries, and Roche has also released PCR reagents for these genes in the Japanese market. Meanwhile, GeneSoC® has also developed an RT-PCR for the N2 region, which is being prepared for launch. This test has been demonstrated to have a better sensitivity and specificity, which has been included at the end of the Discussion section (Lines 259-266). Of note, the primers and probes are designed, developed, and used by each manufacturer and institution; importantly, the use of primers and probes for E and RdRp genes has an equivalent advantage over the use of the primer and probe for a single (N2) gene in the LightCycler 480 system. 2. As shown in Table 6, LightCycler 480 system was superior to GeneSoc system in term of the sensitivity for the detection of SARS-CoV-2. It is important not to miss the patients with a low viral load for preventing the spread of SARS-CoV-2 infection. Is there any room for improvement in the sensitivity of viral detection? Response As you pointed out, when we were preparing this manuscript, this system was not as sensitive as the LightCycler® 480. Because the kit has since been optimized by the manufacturer, all positive samples were retested. We also confirmed that the sensitivity for the Standards has increased to detect 2 copies/assay. The results showed that the E and RdRp probes detected 5 and 10 copies/assay, respectively. The LightCycler® 480 detected 2 copies/assay. Based on these results, we have replaced the Table, the results including the graphs, and the discussion of the results (Lines 33, 38, 140-141, 188-191, 195-197, 199, 237, 253-257, and 259-266, Table 6, Table 10, and Figure 1). Importantly, the difference in the sensitivity was found not to have any implications in the context of clinical applications (Lines 194-201). 3. In specimen processing, the authors used a QIAamp Viral RNA Mini Kit. How long does it take to extract viral RNA? Is there a possibility of further time saving? Response RNA extraction using a column-based method, such as the QIAamp Viral RNA Mini Kit, requires 35–50 minutes. RT-PCR of the extracted RNA can be completed in less than 15 minutes with GeneSoC®. Thus, the process from extraction to the acquisition of results takes approximately 60 minutes. Thus, GeneSoC® may be more useful than the LightCycler® 480 system in situations where rapid testing is required, particularly with patients who have been brought in to the emergency room or are suspected of being infected. In fact, we use the GeneSoC® system in such cases at our facility. A direct real-time RT-PCR method, based on exclusion of the interfering substances, using a probe for the N2 gene region has been developed for GeneSoC®. Using this method, the sensitivity is the same as that of the current method (high sensitivity), and the results can be obtained in 25–30 minutes, including the time taken for the addition of reagents (Lines 281-284). This method is scheduled to be launched soon. After incubating clinical specimens at room temperature for 10 minutes, the GeneSoC® RT-PCR method can be completed in approximately 15 minutes, and all the processes will be completed in 25 minutes (Data and comments are not shown in this manuscript and would be presented in our next paper, which is under preparation). The following minor changes are necessary so that this thesis is accepted. Q1. You targeted only the N2 region on the LightCycler® 480, why did you not target the N1 region. Response Please refer to our response to Comment 1. As mentioned in the main text, the N region is recommended by the (Japanese) National Institute of Infectious Diseases. Two types of primers, N and N2, are available for this region. The system presents a positive result if either N or N2 is positive. However, owing to the better sensitivity obtained with N2, many facilities in Japan only use the N2 primer for diagnosis. We have explained this in the revised manuscript for the benefit of the readers (Lines 129-130). Q2. RNA extraction takes more than 30 min. further, development of such as the direct RT-PCR assay method is needed. Do you have any other suggestions? Response. Please refer to our response to Comment 3. A direct real-time RT-PCR method using a probe for the N2 gene region has been developed for GeneSoC®. According to this method, the sensitivity is the same as that of the current method (high sensitivity), and the results can be obtained in 25–30 minutes, which includes the time taken for the addition of reagents (Lines 281-284). This method is scheduled to be launched soon. After incubating clinical specimens at room temperature for 10 minutes, the GeneSoC® RT-PCR method can be completed in approximately 15 minutes, and all the processes will be completed in 25 minutes (Data and comments are not shown in this manuscript and would be presented in our next paper, which is under preparation). Q3. How was the reproducibility of the three negative samples? Response No samples tested negative in the retesting using the improved kit that is available now. Q4. Please emphasize that it is more useful even if it is less sensitive than the light cycler. Response Thank you very much for this suggestion. In our discussion of the usefulness of GeneSoC®, we have emphasized that it offers high speed, reliability, and sensitivity (Line 309-310). 26 Feb 2021 Evaluation of the basic assay performance of the GeneSoc® Rapid PCR Testing System for detection of Severe Acute Respiratory Syndrome Coronavirus 2 PONE-D-20-38418R1 Dear Dr. Asai, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Etsuro Ito Academic Editor PLOS ONE 22 Mar 2021 PONE-D-20-38418R1 Evaluation of the basic assay performance of the GeneSoc® Rapid PCR Testing System for detection of Severe Acute Respiratory Syndrome Coronavirus 2 Dear Dr. Asai: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Etsuro Ito Academic Editor PLOS ONE
  8 in total

1.  Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

Authors:  Shunsuke Furutani; Nahoko Naruishi; Yoshihisa Hagihara; Hidenori Nagai
Journal:  Anal Bioanal Chem       Date:  2016-06-07       Impact factor: 4.142

2.  Temporal dynamics in viral shedding and transmissibility of COVID-19.

Authors:  Xi He; Eric H Y Lau; Peng Wu; Xilong Deng; Jian Wang; Xinxin Hao; Yiu Chung Lau; Jessica Y Wong; Yujuan Guan; Xinghua Tan; Xiaoneng Mo; Yanqing Chen; Baolin Liao; Weilie Chen; Fengyu Hu; Qing Zhang; Mingqiu Zhong; Yanrong Wu; Lingzhai Zhao; Fuchun Zhang; Benjamin J Cowling; Fang Li; Gabriel M Leung
Journal:  Nat Med       Date:  2020-04-15       Impact factor: 53.440

3.  Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study.

Authors:  Nanshan Chen; Min Zhou; Xuan Dong; Jieming Qu; Fengyun Gong; Yang Han; Yang Qiu; Jingli Wang; Ying Liu; Yuan Wei; Jia'an Xia; Ting Yu; Xinxin Zhang; Li Zhang
Journal:  Lancet       Date:  2020-01-30       Impact factor: 79.321

4.  Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR.

Authors:  Victor M Corman; Olfert Landt; Marco Kaiser; Richard Molenkamp; Adam Meijer; Daniel Kw Chu; Tobias Bleicker; Sebastian Brünink; Julia Schneider; Marie Luisa Schmidt; Daphne Gjc Mulders; Bart L Haagmans; Bas van der Veer; Sharon van den Brink; Lisa Wijsman; Gabriel Goderski; Jean-Louis Romette; Joanna Ellis; Maria Zambon; Malik Peiris; Herman Goossens; Chantal Reusken; Marion Pg Koopmans; Christian Drosten
Journal:  Euro Surveill       Date:  2020-01

5.  Radiological findings from 81 patients with COVID-19 pneumonia in Wuhan, China: a descriptive study.

Authors:  Heshui Shi; Xiaoyu Han; Nanchuan Jiang; Yukun Cao; Osamah Alwalid; Jin Gu; Yanqing Fan; Chuansheng Zheng
Journal:  Lancet Infect Dis       Date:  2020-02-24       Impact factor: 25.071

6.  SARS-CoV-2 Viral Load in Clinical Samples from Critically Ill Patients.

Authors:  Yongbo Huang; Sibei Chen; Zifeng Yang; Wenda Guan; Dongdong Liu; Zhimin Lin; Yu Zhang; Zhiheng Xu; Xiaoqing Liu; Yimin Li
Journal:  Am J Respir Crit Care Med       Date:  2020-06-01       Impact factor: 21.405

7.  Outbreak of pneumonia of unknown etiology in Wuhan, China: The mystery and the miracle.

Authors:  Hongzhou Lu; Charles W Stratton; Yi-Wei Tang
Journal:  J Med Virol       Date:  2020-02-12       Impact factor: 2.327

8.  Pneumonia of unknown aetiology in Wuhan, China: potential for international spread via commercial air travel.

Authors:  Isaac I Bogoch; Alexander Watts; Andrea Thomas-Bachli; Carmen Huber; Moritz U G Kraemer; Kamran Khan
Journal:  J Travel Med       Date:  2020-03-13       Impact factor: 8.490

  8 in total
  1 in total

Review 1.  Microfluidics-based strategies for molecular diagnostics of infectious diseases.

Authors:  Xin Wang; Xian-Zhe Hong; Yi-Wei Li; Ying Li; Jie Wang; Peng Chen; Bi-Feng Liu
Journal:  Mil Med Res       Date:  2022-03-18
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.