Literature DB >> 33770150

Cytotoxicity of Vibrio parahaemolyticus AHPND toxin on shrimp hemocytes, a newly identified target tissue, involves binding of toxin to aminopeptidase N1 receptor.

Waruntorn Luangtrakul1, Pakpoom Boonchuen1,2, Phattarunda Jaree3, Ramya Kumar4,5, Han-Ching Wang4,5, Kunlaya Somboonwiwat1.   

Abstract

Acute hepatopancreatic necrosis disease (AHPND) caused by PirABVP-producing strain of Vibrio parahaemolyticus, VPAHPND, has seriously impacted the shrimp production. Although the VPAHPND toxin is known as the VPAHPND virulence factor, a receptor that mediates its action has not been identified. An in-house transcriptome of Litopenaeus vannamei hemocytes allows us to identify two proteins from the aminopeptidase N family, LvAPN1 and LvAPN2, the proteins of which in insect are known to be receptors for Cry toxin. The membrane-bound APN, LvAPN1, was characterized to determine if it was a VPAHPND toxin receptor. The increased expression of LvAPN1 was found in hemocytes, stomach, and hepatopancreas after the shrimp were challenged with either VPAHPND or the partially purified VPAHPND toxin. LvAPN1 knockdown reduced the mortality, histopathological signs of AHPND in the hepatopancreas, and the number of virulent VPAHPND bacteria in the stomach after VPAHPND toxin challenge. In addition, LvAPN1 silencing prevented the toxin from causing severe damage to the hemocytes and sustained both the total hemocyte count (THC) and the percentage of living hemocytes. We found that the rLvAPN1 directly bound to both rPirAVP and rPirBVP toxins, supporting the notion that silencing of LvAPN1 prevented the VPAHPND toxin from passing through the cell membrane of hemocytes. We concluded that the LvAPN1 was involved in AHPND pathogenesis and acted as a VPAHPND toxin receptor mediating the toxin penetration into hemocytes. Besides, this was the first report on the toxic effect of VPAHPND toxin on hemocytes other than the known target tissues, hepatopancreas and stomach.

Entities:  

Year:  2021        PMID: 33770150      PMCID: PMC8041169          DOI: 10.1371/journal.ppat.1009463

Source DB:  PubMed          Journal:  PLoS Pathog        ISSN: 1553-7366            Impact factor:   6.823


Introduction

Acute hepatopancreatic necrosis disease (AHPND), initially referred to as early mortality syndrome (EMS), has caused severe mortalities in farmed penaeid shrimp throughout Southeast Asia including China in 2009 before it spread to Vietnam in early 2011 and Thailand in late 2011 [1-3]. AHPND can cause up to 100% mortality within 30 days after stocking, and has also resulted in production losses of more than US $1 billion per year in the Asian shrimp farming industry [4,5]. The causative agent of AHPND was found to be a specific strain of the Gram-negative halophilic marine bacterium Vibrio parahaemolyticus [6]. AHPND-causing bacteria initially colonize in the stomach of infected shrimp [6,7] to produce observable symptoms that include lethargy, an empty stomach and midgut, and pale to white atrophied hepatopancreas. Histological analysis of the hepatopancreas reveals sloughing of tubule epithelial cells in the early stage of AHPND and massive hemocytic infiltration in the late stage of infection [6,8,9]. All AHPND-causing V. parahaemolyticus strains carry a virulent pVA1 plasmid (VPAHPND) which encodes the binary toxins PirAvp and PirBvp. These toxins are homologous to the Photorhabdus luminescens insect-related (Pir) toxins [10], and they are secreted into the extracellular environment. Reverse gavage experiments have shown that the bacteria-free supernatant of the bacterial culture is sufficient to induce typical AHPND symptoms [6], and in fact that AHPND-like symptoms can be produced by the reverse gavage injection of purified recombinant PirBvp toxin alone [10]. An analysis of the binary toxins crystal structure found that V. parahaemolyticus PirAvp and PirBvp form a heterodimer and that the overall structural topology of the PirABvp toxins is very similar to that of Bacillus thuringiensis crystal insecticidal (Cry) toxin [10]. This similarity suggested that the putative PirABvp heterodimer might have similar functional domains to the Cry protein, with the N-terminal domain of PirBvp corresponding to Cry domain I (pore-forming activity), the C-terminal domain of PirBvp corresponding to Cry domain II (receptor binding), and PirAvp corresponds to Cry domain III, which is thought to be related to receptor recognition and membrane insertion [11,12]. In the case of the B. thuringiensis Cry toxin, cell death is induced by a series of processes which include receptor binding, oligomerization and pore forming [12]. Briefly, the initial interaction is between domain III of Cry1A toxin and the GalNAc sugar on the aminopeptidase N (APN) receptor, and this facilitates further binding of domain II to another region of the same receptor [10-12]. This binding promotes the localization and accumulation of additional molecules of the activated toxins. This assemblage of toxins then binds to another receptor, cadherin, and this promotes the proteolytic cleavage of the toxin’s N-terminal α1 helix. This cleavage in turn induces the formation of the pre-pore oligomer and increases the oligomer binding affinity to the glycosylphosphatidylinositol (GPI)-anchored APN and alkaline phosphatase (ALP) receptors. The oligomer then inserts into the membrane, leading to pore formation and cell lysis [12]. The PirABvp toxins are known to mainly target the shrimp hepatopancreas. Recently, it was found that, in the brine shrimp larvae, PirABvp toxin challenge induced damage to the digestive tract upon binding to epithelial cells and produces characteristic symptoms of AHPND. The extensive necrosis and damages epithelial cells in the midgut and hindgut regions, resulting in pyknosis, cell vacuolisation, and mitochondrial and rough endoplasmic reticulum (RER) damage [13]. However, while the PirABvp binary toxins is thought to use a mechanism that is similar to that of the Cry pore forming toxin, the details of this mechanism remain unclear. In the present study we therefore investigate the role of APN, which is one of the receptors that are already known to be central to this process in insects. The APN family is composed of a class of zinc metalloproteinases that preferentially cleave single neutral amino acids from the N-terminus of polypeptides [14]. APNs are major proteins in the midgut of insect larvae, where they occur either as soluble enzymes or in association with the microvillar membrane [15]. APNs are involved in several functions in a wide range of species. For example, APNs in the lepidopteran larval midgut play an important role in the digestion of dietary protein [16]. The typical features present in classical lepidopteran APNs include a potential signal peptide at the N-terminus, a characteristic zinc-binding motif HEXXH(X)18E essential for their enzymatic activity, a highly conserved GAMEN motif forming part of the active site and a GPI anchor signal sequence at the C-terminal attaching them to the membrane [14,17]. In the present study, we retrieved LvAPN1 and LvAPN2 sequences from our transcriptomic database of VPAHPND-challenged Litopenaeus vannamei hemocytes [18]. Gene expression of LvAPN1 was analyzed after challenge with AHPND-causing bacteria and partially purified VPAHPND toxins. Next, the role and importance of the LvAPN1 receptor were investigated by using a gene silencing technique. Lastly, we provide a preliminary schematic representation that shows how LvAPN1 in hemocytes might be involved in AHPND pathogenesis.

Results

Characterization of the putative LvAPN protein

A comparison of the LvAPN1 and LvAPN2 deduced amino acid sequences showed that the encoded proteins both have high similarity to other aminopeptidases. While both LvAPNs have a Cry toxin binding region (CBR), the N-terminus of LvAPN1 but not LvAPN2 contains a transmembrane domain (Fig 1A). Considering the peptidase-M1 domain, both proteins have the HEXXH(X)18E domain which is characteristic of the zinc-dependent metalloprotease gluzincins, as well as the GAMEN domain which is normally found in other APNs (Fig 1A). Also present is an ERAP1 domain, which plays a central role in N-terminal peptide trimming. The putative N-glycosylation sites and O-glycosylation sites were also identified (S1 Fig). No glycosylphosphatidylinositol (GPI) anchor sites were found in the C-terminal region, and no signal peptide was predicted.
Fig 1

LvAPN1 characteristics analysis.

(A) Schematic presentation of specific motifs and other components in the LvAPN sequence. Predicted positions of the putative N-terminal transmembrane domain, Cry-binding region (CBR), peptidase-M1 domain, and the GAMEN and HEXXH(X)18E zinc-binding site motifs are shown in red, grey, green, yellow, blue and orange, respectively. (B) Alignment of the Cry1Aa toxin-binding region (CBR) of Litopenaeus vannamei, Bombyx mori and Manduca sexta APNs. The sequences of LvAPN1 (XP_027215499.1); LvAPN2 (XP_027218958.1); BmAPN1 (AFK85020); BmAPN2 (AB011497); BmAPN3 (AF352574); BmAPN4 (AB013400) and MsAPN (CAA66466) were compared. Perfectly conserved amino acid residues have black backgrounds. (C) Aminopeptidase N transcript expression analysis in various L. vannamei tissues by RT-PCR. The tissues examined were gill (G), heart (H), hemocyte (Hcy), lymphoid (Lym), hepatopancreas (Hep), intestine (Int) and stomach (Stm). EF1-α was used as the internal reference and PCR control. Neg is a negative control. A representative data of 3 biological replicates is shown.

LvAPN1 characteristics analysis.

(A) Schematic presentation of specific motifs and other components in the LvAPN sequence. Predicted positions of the putative N-terminal transmembrane domain, Cry-binding region (CBR), peptidase-M1 domain, and the GAMEN and HEXXH(X)18E zinc-binding site motifs are shown in red, grey, green, yellow, blue and orange, respectively. (B) Alignment of the Cry1Aa toxin-binding region (CBR) of Litopenaeus vannamei, Bombyx mori and Manduca sexta APNs. The sequences of LvAPN1 (XP_027215499.1); LvAPN2 (XP_027218958.1); BmAPN1 (AFK85020); BmAPN2 (AB011497); BmAPN3 (AF352574); BmAPN4 (AB013400) and MsAPN (CAA66466) were compared. Perfectly conserved amino acid residues have black backgrounds. (C) Aminopeptidase N transcript expression analysis in various L. vannamei tissues by RT-PCR. The tissues examined were gill (G), heart (H), hemocyte (Hcy), lymphoid (Lym), hepatopancreas (Hep), intestine (Int) and stomach (Stm). EF1-α was used as the internal reference and PCR control. Neg is a negative control. A representative data of 3 biological replicates is shown. Sequence alignment of the CBRs from LvAPNs and other APNs is shown in Fig 1B. The CBR located in the N-terminal region of the LvAPNs conformed to the specific CBR motif TxFxxTxARxAFPCxDEP that is found in the Cry-binding APNs of toxin-susceptible insects. We also found that both LvAPN1 and LvAPN2 were constitutively expressed in all tested immune-related tissue samples from healthy shrimp including stomach, hepatopancreas and hemocytes (Fig 1C).

LvAPN1 is upregulated in response to AHPND

As shown in Fig 1A, LvAPN2 has no transmembrane domain, and since it would therefore presumably be expressed only in soluble form rather than as a membrane-bound protein receptor, our subsequent experiments focused only on LvAPN1. First, we used Western blot to confirm that both PirAvp and PirBvp toxins were present in the purified proteins extracted from Thamai strain (TM) and absent from the proteins extracted from Mahachai strain (MC) (S2 Fig). Next, in order to analyze the expression of LvAPN1 that was identified from the transcriptomic data, we challenged adult L. vannamei with either the non-AHPND causing Vibrio parahaemolyticus strain S02 or the virulent AHPND-causing strain 5HP as shown in panel (i), or else with the partially purified toxins or non-toxins extracted from TM strain and MC strain as shown in panel (ii), respectively. Using qRT-PCR to analyze the expression patterns of LvAPN1 in the stomach (Fig 2A), hepatopancreas (Fig 2B) and hemocytes (Fig 2C), we found that at 12 and 24 hpi, the expression profiles of LvAPN1 in the hepatopancreas were significantly upregulated after challenge with either 5HP or the partially purified VPAHPND toxins. Similarly, in the stomach, LvAPN1 expression was upregulated at 12 hpi by the partially purified VPAHPND toxins and at 24 hpi by 5HP. Meanwhile, in hemocytes, although LvAPN1 was significantly upregulated at 12 hpi after 5HP challenge and at 24 hpi after challenge with the partially purified VPAHPND toxins, we also observed some unexpected downregulation of LvAPN1 at 12 hpi (Fig 2).
Fig 2

Expression of the LvAPN1 gene upon VPAHPND and VPAHPND toxin challenges.

(A) Stomach, (B) hepatopancreas, and (C) hemocyte of L. vannamei were collected before infection (unchallenged) and after challenge with 5HP (i) or the partially purified VPAHPND toxins (ii) at 12 and 24 h. LvAPN1 expression was analyzed by qRT-PCR using EF-1α as the internal control gene. The data represent fold change of LvAPN1 expression in the 5HP or VPAHPND producing strain challenged group compared to the S02 or non-VPAHPND toxin producing strain-challenge control. The experiments were done in triplicate. Each bar represents the mean ± standard deviation (SD). Asterisks indicate significant difference (P < 0.05).

Expression of the LvAPN1 gene upon VPAHPND and VPAHPND toxin challenges.

(A) Stomach, (B) hepatopancreas, and (C) hemocyte of L. vannamei were collected before infection (unchallenged) and after challenge with 5HP (i) or the partially purified VPAHPND toxins (ii) at 12 and 24 h. LvAPN1 expression was analyzed by qRT-PCR using EF-1α as the internal control gene. The data represent fold change of LvAPN1 expression in the 5HP or VPAHPND producing strain challenged group compared to the S02 or non-VPAHPND toxin producing strain-challenge control. The experiments were done in triplicate. Each bar represents the mean ± standard deviation (SD). Asterisks indicate significant difference (P < 0.05).

LvAPN1 as a putative VPAHPND toxin receptor

Next, to investigate the functional importance of LvAPN1 as a putative VPAHPND toxin receptor, we used an RNA interference (RNAi) approach to silence the expression of LvAPN1 by the injection of double-stranded RNA (dsRNA). At 24 h after injection of purified LvAPN1-specific dsRNA, LvAPN1 transcription levels were significantly reduced in stomach, hepatopancreas and hemocytes, relative to the dsGFP-injected and NaCl-injected controls (Fig 3A). The LvAPN1 specific dsRNA was also shown to have no effect on the expression of LvAPN2 (S3 Fig). Furthermore, Fig 3B further shows that silencing of LvAPN1 significantly increased the survival of adult L. vannamei that were challenged with the partially purified VPAHPND toxins; although none of the shrimp in the NaCl-treated and dsGFP-treated groups survived beyond 5 days, 77% of the LvAPN1 silenced shrimp survived the same challenge through to the end of the experiment at 7 days.
Fig 3

The effect of LvAPN1 silencing in AHPND-causing bacteria pathogenesis.

(A) Confirmation of LvAPN1 gene knockdown in L. vannamei. The mRNA expression levels of the LvAPN1 gene in the stomach, hepatopancreas and hemocyte of shrimp injected with 0.85% NaCl, 20 μg/g shrimp of dsGFP, or 20 μg/g shrimp of dsAPN1 were determined by qRT-PCR and expressed in relative to EF-1α. Each bar represents the mean ± SD, derived from triplicate experiments. Asterisks indicate significant difference (P < 0.05). (B) LvAPN1 silencing reduced mortality in shrimp challenged with partially purified VPAHPND toxins. Cumulative mortality was monitored in 3 groups of 10 shrimp for each of the individual experimental conditions. NaCl-injected shrimp were challenged with partially purified VPAHPND toxin (), dsGFP-injected shrimp were challenged with partially purified VPAHPND toxin (), dsAPN1-injected shrimp were challenged with partially purified VPAHPND toxin (), NaCl-injected shrimp were challenged with PBS (), dsGFP-injected shrimp were challenged with PBS (), dsAPN1-injected shrimp were challenged with PBS (). Shrimp survival was observed every 12 h post treatment for 7 days. All experiments were performed in triplicate and the survival percentage calculated as mean ± 1 standard error (SE) at each time point as shown. (C) A representative data of haematoxylin and eosin-stained hepatopancreas collected from shrimp at 24 h after challenge with VPAHPND toxin. Normal hepatopancreatic tubules (black arrow) are observed in the unchallenged group and dsAPN1-injected group, whereas typical AHPND lesions with necrotic, sloughed epithelial cells (red arrow) were found in both the dsGFP- and NaCl-injected groups.

The effect of LvAPN1 silencing in AHPND-causing bacteria pathogenesis.

(A) Confirmation of LvAPN1 gene knockdown in L. vannamei. The mRNA expression levels of the LvAPN1 gene in the stomach, hepatopancreas and hemocyte of shrimp injected with 0.85% NaCl, 20 μg/g shrimp of dsGFP, or 20 μg/g shrimp of dsAPN1 were determined by qRT-PCR and expressed in relative to EF-1α. Each bar represents the mean ± SD, derived from triplicate experiments. Asterisks indicate significant difference (P < 0.05). (B) LvAPN1 silencing reduced mortality in shrimp challenged with partially purified VPAHPND toxins. Cumulative mortality was monitored in 3 groups of 10 shrimp for each of the individual experimental conditions. NaCl-injected shrimp were challenged with partially purified VPAHPND toxin (), dsGFP-injected shrimp were challenged with partially purified VPAHPND toxin (), dsAPN1-injected shrimp were challenged with partially purified VPAHPND toxin (), NaCl-injected shrimp were challenged with PBS (), dsGFP-injected shrimp were challenged with PBS (), dsAPN1-injected shrimp were challenged with PBS (). Shrimp survival was observed every 12 h post treatment for 7 days. All experiments were performed in triplicate and the survival percentage calculated as mean ± 1 standard error (SE) at each time point as shown. (C) A representative data of haematoxylin and eosin-stained hepatopancreas collected from shrimp at 24 h after challenge with VPAHPND toxin. Normal hepatopancreatic tubules (black arrow) are observed in the unchallenged group and dsAPN1-injected group, whereas typical AHPND lesions with necrotic, sloughed epithelial cells (red arrow) were found in both the dsGFP- and NaCl-injected groups. PirABvp toxins released from VPAHPND is the major cause of AHPND symptom of hepatopancreas necrosis. So, the effect of LvAPN1 knockdown on the hepatopancreas morphology of shrimp challenged with the partially purified VPAHPND toxin was observed (Fig 3C). As expected, histological examination showed that LvAPN1 silencing largely prevented the characteristic AHPND clinical signs of sloughed epithelial cells and cellular disruption, whereas in the NaCl-treated and dsGFP-treated control shrimp, both sloughing of the tubule cells and hemocyte infiltration were observed. This result suggested the putative role of LvAPN1 as a VPAHPND toxin receptor.

LvAPN1 knockdown reduced cell damage in toxin-challenged hemocytes

As observed earlier that LvAPNs were constitutively expressed in all tested immune-related tissues especially hepatopancreas and stomach that are destroyed upon VPAHPND infection. However, there is no evidence of damages on other tissues reported so far. It is well known that hemocyte is a major immune tissue producing various immune effectors to fight against infection. Here, we showed that the VPAHPND toxins significantly decreased the total hemocyte count (THC) in the NaCl-treated and dsGFP-treated shrimp at 24h (Fig 4A). By contrast, the silencing of LvAPN1 results in a THC that is similar to that of the unchallenged PBS-treated group. In addition, we also found that 83% of the hemocytes in the LvAPN1 knockdown group were alive, compared to 63% and 58% in the NaCl and dsGFP control groups, respectively (Fig 4B).
Fig 4

The effect of LvAPN1 silencing on shrimp hemocyte homeostasis.

(A) Effect of LvAPN1 silencing on the total hemocyte count after challenge with the partially purified VPAHPND toxins. Experimental groups were the same as those used in Fig 3B. PBS was used as a control. THC values for each treatment condition were derived from at least three shrimp. (B) Percentage of dead and viable hemoctyes in the LvAPN1 knockdown shrimp after partially purified VPAHPND toxins challenge was determined by trypan blue staining and observation under light microscopy. Asterisks indicate significant difference (P < 0.05). (C) The representative SEM micrograph showing morphology of LvAPN1 knockdown shrimp hemocytes after partially purified VPAHPND toxin challenge. Experimental groups were the same as those used in Fig 3B. PBS was used as a control. (D) Localization of the VPAHPND toxin on shrimp hemocyte by immunofluorescence. The VPAHPND hemocytic nuclei, cytoplasmic membrane and PirBvp toxin are visualized in blue (Hoechst 33342), red (CellBrite cytoplasmic membrane) and green (Alexa Fluor 488) colors, respectively. PBS-injected shrimp was used as a control. The scale bar corresponds to 5 μm. All experiments were done in triplicate.

The effect of LvAPN1 silencing on shrimp hemocyte homeostasis.

(A) Effect of LvAPN1 silencing on the total hemocyte count after challenge with the partially purified VPAHPND toxins. Experimental groups were the same as those used in Fig 3B. PBS was used as a control. THC values for each treatment condition were derived from at least three shrimp. (B) Percentage of dead and viable hemoctyes in the LvAPN1 knockdown shrimp after partially purified VPAHPND toxins challenge was determined by trypan blue staining and observation under light microscopy. Asterisks indicate significant difference (P < 0.05). (C) The representative SEM micrograph showing morphology of LvAPN1 knockdown shrimp hemocytes after partially purified VPAHPND toxin challenge. Experimental groups were the same as those used in Fig 3B. PBS was used as a control. (D) Localization of the VPAHPND toxin on shrimp hemocyte by immunofluorescence. The VPAHPND hemocytic nuclei, cytoplasmic membrane and PirBvp toxin are visualized in blue (Hoechst 33342), red (CellBrite cytoplasmic membrane) and green (Alexa Fluor 488) colors, respectively. PBS-injected shrimp was used as a control. The scale bar corresponds to 5 μm. All experiments were done in triplicate. To further determine if hemocytes are one of VPAHPND toxin target tissue, the morphology of the VPAHPND-challenged shrimp hemocytes was observed (Fig 4C). Scanning electron microscopy (SEM) showed a clear morphological change in the hemocyte cell surface after VPAHPND toxin challenge in the NaCl- and dsGFP-treated shrimp. These changes included cell disruption, pore formation on the cell surface and bursting. Meanwhile, in the LvAPN1 knockdown shrimp, there was no observable morphological damage to the hemocytes after VPAHPND toxin challenge. These results infer that hemocytes are a VPAHPND toxin target tissue where LvAPN1 is involved in penetration of toxins into cell.

LvAPN1 plays crucial role in toxin translocation from cell membrane to cytoplasm of hemocytes

To observe the effect of LvAPN1 silencing on the localization of VPAHPND toxins on shrimp hemocytes, we used immunofluorescence and confocal microscopy in conjunction with anti-PirBvp antibodies specific to PirBvp. Twenty-four h after challenge with the partially purified VPAHPND toxins, LvAPN1 knockdown shrimp hemocytes were collected, fixed and processed for the detection of PirBvp proteins. Nuclei were stained with Hoechst 33342 (blue) and cell membranes were stained with Cell Brite cytoplasmic membrane dye (red), while the VPAHPND toxin was visualized with Alexa Fluor 488 conjugated anti-PirBvp antibody (green). The fluorescent microscopic images revealed that while VPAHPND toxin was localized on both the hemocyte cell surface and the cytoplasm of the NaCl-treated and dsGFP-treated hemocytes, the VPAHPND toxin was only localized on the cell membrane not inside the cell of dsAPN1-treated shrimp (Fig 4D). These results suggest that in hemocytes, LvAPN1 is acting as a target receptor molecule of VPAHPND toxins and that it is a critical part of the mechanism that allows the toxins to pass through the cell membrane.

LvAPN1 gene silencing reduces the number of AHPND virulence plasmids in stomach, and prevents the appearance of gross clinical signs in hepatopancreas

To investigate the effect of LvAPN1 silencing in the stomach of L. vannamei, we performed an immersion challenge using two strains of V. parahaemolyticus, S02 and 5HP. At 24 h after infection, a PCR-based AHPND detection kit was used to test stomach samples for the presence of two sequences in the pVA1 plasmid, one that overlaps both of the Pir toxin genes, and another more stable sequence known as AP2 [19]. As shown in both panels of Fig 5 after 5HP infection, the dsAPN1-injected group showed significantly lower counts for the pVA1 plasmids than the NaCl-treated and dsGFP-treated controls. All of the above results provide further evidence of LvAPN1 involvement in AHPND pathogenesis.
Fig 5

Reducing of AHPND-causing bacteria plasmid in stomach of LvAPN1 silenced shrimp.

PCR amplification of two different sequences in the genome of the pVA1 plasmid, (A) Binary Pir toxin sequence and (B) pVA1 sequence from the stomach of shrimp injected with 0.85% NaCl, 20 μg/g shrimp of dsGFP, or 20 μg/g shrimp of dsAPN1. Shrimp stomach were collected after dsRNA injection (unchallenged) and after infection with the AHPND-causing V. parahaemolyticus 5HP strain and non-AHPND causing V. parahaemolyticus S02 at 24 h. The data represent copies of pVA1 plasmid per host genome copies. Each bar represents the mean ± standard deviation (SD) of triplicate experiments. Asterisks indicate significant difference (P < 0.05).

Reducing of AHPND-causing bacteria plasmid in stomach of LvAPN1 silenced shrimp.

PCR amplification of two different sequences in the genome of the pVA1 plasmid, (A) Binary Pir toxin sequence and (B) pVA1 sequence from the stomach of shrimp injected with 0.85% NaCl, 20 μg/g shrimp of dsGFP, or 20 μg/g shrimp of dsAPN1. Shrimp stomach were collected after dsRNA injection (unchallenged) and after infection with the AHPND-causing V. parahaemolyticus 5HP strain and non-AHPND causing V. parahaemolyticus S02 at 24 h. The data represent copies of pVA1 plasmid per host genome copies. Each bar represents the mean ± standard deviation (SD) of triplicate experiments. Asterisks indicate significant difference (P < 0.05).

ELISA assay of protein-protein interactions between LvAPN1 and the PirAvp and PirBvp toxins

After confirming the successful expression of the recombinant proteins truncated LvAPN1, PirAvp-His, PirBvp-GST and GST in a bacterial expression system (S4 Fig), the purified truncated rLvAPN1 was found to bind directly to rPirAvp and rPirBvp in a concentration-dependent manner (Fig 6). Assuming a one-site binding model, the apparent dissociation constants (Kd) of truncated rLvAPN1 to rPirAvp and rPirBvp, as calculated from the saturation curves, were 3.2 μM and 0.5 μM, respectively. These results suggest that both VPAHPND binary toxin subunits can bind directly to LvAPN1 receptor.
Fig 6

Binding ability of rPirAvp and rPirBvp on immobilized recombinant truncated LvAPN1-His determined by ELISA.

The purified rPirAvp-His, rPirBvp-GST or rGST (0–10 μM) was added to a purified recombinant truncated LvAPN1-coated plate, followed by probing with the anti-PirBvp specific primary antibody and goat anti-rabbit-conjugated HRP secondary antibody. Finally, after addition of the tetramethylbenzidine (TMB) substrate, the absorbance at 450 nm (A450) was measured. Solid lines illustrate the fitted curves. The data are shown as the mean ± 1 Standard error of mean (SEM), derived from triplicate experiments.

Binding ability of rPirAvp and rPirBvp on immobilized recombinant truncated LvAPN1-His determined by ELISA.

The purified rPirAvp-His, rPirBvp-GST or rGST (0–10 μM) was added to a purified recombinant truncated LvAPN1-coated plate, followed by probing with the anti-PirBvp specific primary antibody and goat anti-rabbit-conjugated HRP secondary antibody. Finally, after addition of the tetramethylbenzidine (TMB) substrate, the absorbance at 450 nm (A450) was measured. Solid lines illustrate the fitted curves. The data are shown as the mean ± 1 Standard error of mean (SEM), derived from triplicate experiments.

Discussion

APNs in insects have been extensively investigated for their interactions with Bacillus thuringiensis Cry toxins [20]. In the present study, we first identified aminopeptidase N 1 and 2 (LvAPN1 and LvAPN2) from the transcriptome of VPAHPND-challenged L. vannamei hemocytes. LvAPN1 and LvAPN2, which were expressed in all immune-related and AHPND-affected tissues including stomach, hepatopancreas and hemocytes (Fig 1C), possess the hallmark characteristics of lepidopteran APNs, so they appear to belong to the APN family (Fig 1A). There are at least four classes of APN in the insect midgut, where they occur either as soluble enzymes or in association with the microvillar membrane [15]. While these four APNs are thought to differ in their amino acid specificity, they all function to cleave N-terminal amino acids from peptides, a step which is necessary for amino acid co-transport into epithelial cells [21]. Prediction of a transmembrane helix showed that LvAPN1 is potentially a membrane-bound protein (Figs 1A and S1) while LvAPN2 is not. The results of sequence alignment indicated that LvAPN1 CBR shared moderate to high protein identity with the CBRs of other APN homologs, while the protein sequences beyond this consensus domain diverged considerably from those of the APNs found in Cry-susceptible insects (Fig 1B) [22]. Nevertheless, based on the similarity of its domain structure, it seems likely that LvAPN1 would have a similar function to the APN receptors in insects. Specific binding of the Cry toxins to receptors on the epithelial cells of the midgut and hindgut is critical for their toxic effect on susceptible insects [23-25], and previous study has shown that the BmAPNs were specifically or highly expressed in the midgut of B. mori after B. bombysepticus and B. thuringenesis infection [26]. Here, we found that the expression levels of the LvAPN1 gene were increased after challenge with either the AHPND-causing bacteria or the VPAHPND toxin not only in stomach and hepatopancreas, but also in hemocytes (Fig 2). Interestingly, there are other reports in arthropods that their hemocytes are targeted by Cry toxins. For example, Cerstiaens et al., (2001) [27] demonstrated the toxicity of Cry toxins to the hemocoel in Lymantria dispar (Lepidoptera) and Neobellieria bullata (Diptera). In addition, the AjAPN1 protein of non-gut hemocoelic tissues was implicated as a Cry1Aa toxin receptor in these tissues in Achaea Janata [28]. All of these findings suggest that VPAHPND toxins targeting stomach, hepatopancreas, and hemocytes mediated by LvAPN1 is required for AHPND pathogenesis in shrimp. Silencing of HaAPN1 in Helicoverpa armigera was found to decrease the susceptibility of larvae to Cry1Ac toxins [29], while silencing of HcAPN3 was also associated with reduced susceptibility of Hyphantria cunea to Cry1Ab [30]. In the present study we likewise investigated the function of LvAPN1 by dsRNA-mediated silencing. Our results show that LvAPN1 dsRNA significantly silenced LvAPN1 in the stomach, hepatopancreas and hemocytes (Fig 3A) and knockdown of LvAPN1 reduced the mortality of VPAHPND toxins-challenged shrimp (Fig 3B). Recent research demonstrated that in the germ-free brine shrimp PirABvp toxins bind to epithelial cell of the digestive tract and damage enterocytes in the midgut and hindgut regions [18]. In the Penaeid shrimp, it is known that VPAHPND toxins cause the damage on stomach and hepatopancreas tissues whereas no evidence is available for hemocytes. In this study we would like to prove that not only stomach and hepatopancreas but also hemocytes are target tissue of VPAHPND toxins. We investigated the effect of LvAPN1 silencing on availability and morphology of hemocyte in VPAHPND toxin-challenged shrimp. We found that VPAHPND toxins cause severe damage of hemocyte leading to lowering total hemocyte number and cell death while silencing of LvAPN1 prevented these effects (Fig 4A and 4B) emphasizing the participation of LvAPN1 in VPAHPND toxin susceptibility of hemocyte. Immunofluorescence assay further revealed that the VPAHPND toxins passed through the cell membrane and localized inside the cell, but when LvAPN1 was silenced, the VPAHPND toxin was unable to gain entry and remained localized on the cell membrane (Fig 4D). Although these effects were observed in circulating hemocytes, the VPAHPND toxins presumably damages the hemocytes in the hepatopancreas in the same way. If so, then the hemocyte infiltration that occurs in the late stage of infection would include hemocytes that have already been damaged by the VPAHPND toxins [31]. In insects, binding of the Cry toxins to receptors leads to membrane insertion into the host cell [14,28,31]. Thus, for example Cry toxins form pores in the apical membrane of larvae midgut cells, destroying the cells and killing the larvae [11]. Our results showed that while challenge with the partially purified VPAHPND toxins led to cell death and pore formation in hemocytes in unsilenced shrimp, knockdown of LvAPN1 not only inhibited pore formation by the VPAHPND toxins (Fig 4C), it also reduced both shrimp mortality (Fig 3B), and led to a reduction in the number of AHPND-causing bacteria in the stomach (Fig 5). The reason for reduction is still unclear, but one possibility is that the lack of LvAPN1 receptors might somehow reduce susceptibility of hemocyte, stomach, and hepatopancreas cells to VPAHPND toxins. Binding specificity between the receptor and the toxin is also critically important for Cry toxicity. In a previous report, ligand blotting showed that in B. mori and H. cunea, the APN receptors specifically bind to Cry1Aa toxins [32]. Similarly, here we used ELISA to determine the binding of VPAHPND toxins and LvAPN1 receptor. We found that the recombinant His-tagged N-terminal of LvAPN1 was able to directly bind to both the rPirAvp and rPirBvp toxins, and that it showed a slightly higher binding affinity to PirBvp than to PirAvp (Fig 6), suggesting that PirBvp is probably responsible for the binding to LvAPN1 receptor on hemocytes. The role of PirBvp as a ligand for cell surface receptor of shrimp target cells has been recently suggested as well. Victorio-De Los Santos et al [33] suggested that PirBvp subunit is a lectin that can bind to amino sugar ligand and exhibits the hemagglutinating activity as the PirABvp complex [33]. Taken together, our data suggests that LvAPN1 is likely to facilitate AHPND pathogenesis by functioning as a receptor for VPAHPND toxins, and that it is therefore likely to be involved in pore-formation and membrane insertion. Lastly, we note that the ability of the VPAHPND toxins to enter and damage hemocytes (Fig 4) suggests that the pathological effects of AHPND are not limited to the stomach and hepatopancreas, but also extend to the hemocytes. Taking all of the results presented here we propose a model for the role of LvAPN1 in shrimp hemocytes (Fig 7). According to this model, the AHPND-causing V. parahaemolyticus enter into the shrimp. At the same time, the AHPND-causing V. parahaemolyticus release of PirABvp toxins. Next, the PirABvp toxins bind to LvAPN1 receptor located on cell membrane of shrimp hemocytes and then might induce PirABvp toxin oligomerization. This interaction enhanced pore formation and membrane insertion which led to the hemocyte morphology changes and hemocyte lysis.
Fig 7

Schematic representation of AHPND pathogenesis showing the proposed role of LvAPN1 in hemocyte.

(1) VPAHPND bacteria enter the shrimp and release PirABvp toxin. (2) The binary VPAHPND toxins bind to LvAPN1 receptor which is embeded in cell membrane of shrimp hemocyte. (3) This interaction might induce VPAHPND toxins oligomerization. (4) VPAHPND toxins induce pore formation and insert into membrane. (5) Hemocyte is lyzed and damaged causing by pore formation and membrane insertion.

Schematic representation of AHPND pathogenesis showing the proposed role of LvAPN1 in hemocyte.

(1) VPAHPND bacteria enter the shrimp and release PirABvp toxin. (2) The binary VPAHPND toxins bind to LvAPN1 receptor which is embeded in cell membrane of shrimp hemocyte. (3) This interaction might induce VPAHPND toxins oligomerization. (4) VPAHPND toxins induce pore formation and insert into membrane. (5) Hemocyte is lyzed and damaged causing by pore formation and membrane insertion.

Materials and methods

Ethics statement

The experiments involving animals received ethical approval from Chulalongkorn University Animal Care and Use Committee (protocol review No. 1923019). The biosafety concerns of experiments performed was approved by the Institutional Biosafety Committee of Chulalongkorn University (SCCU-IBC-008/2019).

DNA sequence analysis

L. vannamei APN genes (LvAPN1 and LvAPN2) were found in our transcriptomic database of VPAHPND-challenged L. vannamei hemocytes [18]. The full-length sequences of LvAPN1 was retrieved from the in-house transcriptomic database and deposited into GenBank database (accession number MW259048) whereas that of LvAPN2 was retrieved from GenBank database (accession number XP_027218958). The amino acid sequence alignment was performed using the aminopeptidase N of various species from previous reports [34]. The amino acid sequences of the two LvAPN proteins were analyzed for conserved motifs by SMART (http://smart.embl-heidelberg.de) scanning. Prediction of a signal peptide at the N-terminus of each protein was conducted with SignalP 4.1 [35]. A GPI anchor signal at the C-terminus was predicted using PredGPI, FragAnchor, and big-PI Predictor. N-glycosylation and O-glycosylation sites were predicted by the NetNglyc 1.0 Server [36] and NetOglyc 4.0 Server [37], respectively. Transmembrane helices of LvAPN amino acids were predicted by the TMHMM 2.0 Server (http://www.cbs.dtu.dk/services/TMHMM/).

Tissue distribution analysis

Tissue distribution for the LvAPN1 and LvAPN2 genes was analyzed in 7 tissues (gill, heart, hemocytes, lymphoid organ, hepatopancreas, intestine, stomach) from three individuals. Total RNA was isolated from these tissues using GENEzol reagent (Geneaid). RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) was used for reverse transcription. Gene expression analysis was done by semi-quantitative RT-PCR using specific primers for LvAPN1, LvAPN2 and EF-1α. The sequences for all primer sets are listed in Table 1. Among three biological replicates, a representative result is shown.
Table 1

Primers used in this study.

UsageGenePrimer namePrimer sequence (5′-3′)
Real-time PCR/ PCRLvAPN1LvAPN1-FGGGCAAGGAGGTCAAATGGA
LvAPN1-RCAACGCCACTGTTGCATTGA
LvAPN2LvAPN2-FGACGTCACGACCTCGGCTG
LvAPN2-RGCCAGGTACCTTGTCTTCCC
LvEF-1αEF-1α-FCGCAAGAGCGACAACTATGA
EF-1α-RTGGCTTCAGGATACCAGTCT
dsRNA synthesisLvAPN1dsAPN1_knd_F_XbaICATTCTAGAAGAGAAAAGGTATATCGCTACCACC
dsAPN1_knd_R_NcoICATCCATGGCTACAAGGTATGTGCTCATTTCCAC
dsAPN1_knd_F_BamHICATGGATCCAGAGAAAAGGTATATCGCTACCACC
dsAPN1_knd_R_NdeITCTCATATGCTACAAGGTATGTGCTCATTTCCAC
EGFPdsEGFP_knd_F_XbaICATTCTAGAATCATGGCCGACAAGCAGAA
dsEGFP_knd_R_NcoICATCCATGGAACTCCAGCAGGACCATGTG
dsEGFP_knd_F_BamHICATGGATCCATCATGGCCGACAAGCAGAA
dsEGFP_knd_R_NdeITCTCATATGAACTCCAGCAGGACCATGTG
Recombinant protein expressionLvAPN1APN1_CBR_BamHI-FCGTCAGGATCCGGATGAGATTTTACGTCGAGGAAG
APN_CBR_SalI-RAGACGTCGACGATTACTACTACTACTACTACCACGAGTCCATCCTCCAAGC

APN, aminopeptidase N, EF, Elongation factor, knd, knockdown, EGFP, enhanced green florescent protein, CBR, Cry toxin binding region.

APN, aminopeptidase N, EF, Elongation factor, knd, knockdown, EGFP, enhanced green florescent protein, CBR, Cry toxin binding region.

Bacterial strains

For VPAHPND challenge by immersion, V. parahaemolyticus strains 5HP (AHPND-causing strain) and S02 (non-AHPND-causing strain) were used. In case of VPAHPND toxin challenge, the VPAHPND strain TM isolated from a shrimp culture farm in Thamai, Chanthaburi province, Thailand, was used for VPAHPND toxin purification. The non-AHPND causing strain, the non-VPAHPND strain MC isolated from a shrimp culture farm in Mahachai, Samut Sakhon province, Thailand, was used for non-VPAHPND toxin purification. All V. parahaemolyticus strains were cultured and maintained on thiosulfate citrate bile salts sucrose medium (TCBS) (BD Biosciences) [7,8].

Preparation of the partially purified VPAHPND toxin

To prepare the partially purified VPAHPND toxins and non-VPAHPND toxins, bacterial suspension of either the AHPND-causing (TM) or non-AHPND-causing strains (MC) of V. parahaemolyticus, was cultured in tryptic soy broth (TSB) supplemented with 1.5% NaCl incubated at 30°C with shaking for 16 h. Subsequently, the bacterial culture was inoculated 1:100 in 400 ml TSB and cultivation continued with shaking for approximately 2–3 h until the OD600 reached 2 (equivalent to 108 colony forming unit; CFU per ml). After centrifugation at 8,000 ×g for 15 min at 4°C, the supernatant was collected and subjected to ammonium sulfate precipitation (AS) as described by Sirikharin et al. (2015) [38]. Total protein concentration of the partially purified VPAHPND toxins derived from TM strain and non-VPAHPND toxins derived from MC strain was determined using Bradford reagent (Bio-Rad) and stored at -80°C. The protein quality was analyzed by SDS-PAGE and Western blot analysis using specific antibodies to PirAvp and PirBvp proteins.

Challenge with VPAHPND bacteria and the partially purified VPAHPND toxins

After acclimatization, shrimp were challenged with V. parahaemolyticus strain 5HP and S02 by immersion in tanks that were inoculated with a bacterial suspension as described by Boonchuen et al., (2018) [39]. The median lethal dose (LD50) of the 5HP bacterial inoculant at 24 h was determined in 10 shrimp, and this resulted in a final bacterial concentration of 2.5×105 CFU/ml in the immersion tanks. The LD50 at 24 h for the partially purified VPAHPND toxins was similarly determined as 0.25 μg/g shrimp. The VPAHPND toxins were diluted in 1×PBS mixed with a red food-grade dye and intramuscular injected into shrimp. The red food-grade dye was used to make sure that VPAHPND toxins was properly entered into the shrimp muscle. The effect of all the above challenges was also confirmed by observation of morphological changes in the hepatopancreas such as paling and atrophy as well as lethargy in shrimp.

Quantitative real-time RT-PCR (qRT-PCR) analysis of LvAPN1 expression after challenge with AHPND-causing bacteria and the partially purified VPAHPND toxins

Shrimp (n = 12 per group) were challenged with V. parahaemolyticus strain 5HP or VPAHPND toxins as described above, and the stomach, hepatopancreas and hemocytes were collected from three shrimp in each experimental group at either unchallenge, 12 or 24 h post challenge. Total RNA was isolated, and cDNA was synthesized using REzol C&T reagent (Protech Technology Enterprise Co., Ltd.) as per the manufacturer’s protocol and a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) was used to synthesize the cDNA. The cDNA samples were used as templates in the qRT-PCR reaction. The S02-infected and non-VPAHPND toxin-injected shrimp were used as controls. To determine the expression level of LvAPN1 gene and EF-1α internal control gene, the qRT-PCR analysis was performed using an appropriate amount of cDNA for each gene, specific oligonucleotide primers (Table 1) and qPCR Master Mix (KAPA Biosystem) in CFX96 Touch RealTime PCR System (Bio-Rad) under the following conditions: 95°C for 3 min, 40 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. The experiments were done in three biological replicates. Relative expression level was calculated using the mathematical model of Pfaffl (2001) [40]. Data were analyzed using one-way ANOVA followed by Duncan’s new multiple ranges test and presented as means ± standard deviations (SD). The level of statistical significance was set at P-value < 0.05

dsRNA silencing of LvAPN1 expression

To investigate the functional importance of LvAPN1 as a putative VPAHPND toxin receptor, we used an RNA interference (RNAi) approach to silence the expression of LvAPN1 by the injection of double-stranded RNA (dsRNA). For dsRNA production using bacteria system, the recombinant plasmid pET-19b containing a 230 bp sense-antisense construct targeted to LvAPN1 mRNA was transformed into the ribonuclease III-deficient Escherichia coli strain HT115 (DE3) [37] to produce dsRNA-LvAPN1 (dsAPN1) and the recombinant plasmid pET-19b containing a 400 bp sense-antisense construct targeted to EGFP mRNA was used to produce dsRNA-GFP (dsGFP), a dsRNA control. The dsRNAs were expressed and extracted as by described in Posiri et al. (2013) [41]. 20 μg of dsAPN1, dsGFP or 0.85% NaCl were injected into each shrimp (~5 g body weight), and 24 h later, the shrimp were injected with 0.25 μg/g shrimp of VPAHPND toxins or 1×PBS pH 7.4 for the control. The stomach, hepatopancreas and hemocytes were collected at 24 h post VPAHPND toxin injection from three shrimp in each experimental group. Total RNA was isolated and cDNA was synthesized. Also, the gene expression level of LvAPN1 and EF-1α, internal control gene, was analyzed by the qRT-PCR as described above to verify the efficiency of dsRNA silencing.

Susceptibility of VPAHPND toxin-challenged L. vannamei after LvAPN1 silencing

Shrimp (3 groups of 10 individuals) were injected intramuscularly with dsAPN1, dsGFP or 0.85% NaCl, respectively, in the lateral area of the fourth abdominal segment. Twenty-four h later, the treated shrimp were injected with 50 μL of 0.25 μg/g shrimp of VPAHPND toxins using a syringe with a 29-gauge needle. In the corresponding control groups (3 groups of 10 individuals), the shrimp were injected with 1×PBS pH 7.4 instead of VPAHPND toxins. After the last injection, the shrimp mortality was monitored twice daily for 7 days. The experiments were done in three replicates.

Effect of LvAPN1 silencing on the hepatopancreas damage caused by VPAHPND toxin

Individual live shrimp samples (n = 3) were also taken from each group dsAPN1-, dsGFP-, and NaCl-injected shrimp at 0, 3, 12, and 24 h post the partially purified VPAHPND toxin injection. Individual shrimp were fixed with Davison’s fixative 48 h and subsequently stored in ethanol as described by Lightner (1996) [1]. The cephalothorax was then sectioned and stained with H&E stain following standard histological methods. Hepatopancreatic structures were examined using light microscopy, and necrosis of hepatopancreas tubules and hemocytic infiltration in the hepatopancreas were evaluated. Among 3 individuals examined, the representative result is shown.

Total Hemocyte Count (THC)

Prior to counting, the pooled samples of the hemolymph/anticoagulant mixture of each experimental knockdown group (NaCl, dsGFP and dsAPN1) after 24 h-VPAHPND toxin challenge that were set aside from the immunofluorescence assay were kept on ice. To conduct the total hemocyte count, 4% (w/v) paraformaldehyde was added at the ratio 1:1 to immobilize the hemocytes, and the hemocytes were then counted using hemocytometer and a phase contrast microscope (Nikon, Japan). The observed number of hemocytes on the hemocytometer plate, the total hemocyte count in 1 mL hemolymph was then calculated. To determine the proportion of dead vs alive hemocytes, the cells were stained with 0.4% trypan blue prior to immobilization to distinguish between viable and non-viable cells. The experiments were done in three replicates.

Effect of LvAPN1 silencing on the morphology of VPAHPND toxin-challenged shrimp hemocytes by SEM

To investigate the direct effect of the partially purified VPAHPND toxins on hemocyte morphology in shrimp either with or without LvAPN1 silencing, 20 μg of dsAPN1, dsGFP, or NaCl were injected into each shrimp (~5 g body weight), and 24 h later, the shrimp were injected with 0.25 μg/g shrimp of VPAHPND toxins or 1×PBS, pH 7.4 for the control. At 24 h post challenge, shrimp hemolymph was collected using a sterile 1-ml syringe with anticoagulant. The hemocytes were collected, fixed in 2% glutaraldehyde and the hemocyte morphology was then observed under scanning electron microscope. The experiments were done in triplicate and the representative result is shown.

Determination of partially purified VPAHPND toxins localization on shrimp hemocytes by immunofluorescence

To investigate the localization of the VPAHPND toxins on hemocytes, three individual shrimp in each experimental knockdown group (NaCl, dsGFP, and dsAPN1) were challenged with VPAHPND toxins, and after 24 h, approximately 1.0 ml of L. vannamei hemolymph was collected from each shrimp under equal volume of an anticoagulant. After seeding aside some of the pooled hemolymph for the THC assay (see above), the hemocytes in these samples were isolated by centrifugation (800×g; 10 min; 4°C), with the hemocyte pellet being immediately fixed in 4% (w/v) paraformaldehyde in 1×PBS pH 7.4 at ratio of 1:1 and kept at 4°C until use. Cells (5×105 cells/ml) were fixed onto the poly-L-lysine (Sigma) coated-coverslips in a 24-well plate and washed three times with 0.02% Triton X-100 in 1×PBS pH 7.4 followed by cell membrane staining with Cell Brite cytoplasmic membrane dye (Biotium) at the ratio of 1:200 in blocking solution (0.02% Triton X-100, 10% FBS and 1% BSA in 1×PBS pH 7.4) for 10 min. Cells were washed three times and permeabilized with 1×PBS pH 7.4 containing 0.2% gelatin, 1% BSA and 0.02%Triton X-100 for 30 min. Cells were then washed three times and blocked with 1× PBS pH 7.4 containing 10% FBS and 0.02% Triton X-100 for 2 h. Cells were washed again and probed with the rabbit anti-PirBvp primary antibody at ratio of 1:5 000 in 1×PBS pH 7.4 containing 10% FBS and 0.02% Triton X-100 at 4°C overnight, followed by washing and incubation with anti-rabbit secondary antibody conjugated with Alexa Fluor 488 (ratio 1:5 000) at room temperature for 2 h. The nuclei were stained with Hoechst 33342 (Thermo Scientific). The coverslips were mounted with EverBrite Mounting Medium (Biotium) and sealed on glass slides. Fluorescence images were detected with an LSM 800 laser scanning confocal microscope (Carl Zeiss). The experiments were done in triplicate and the representative result is shown.

Effect of LvAPN1 silencing on stomach colonization by AHPND-causing bacteria

At 24 h after LvAPN1 knockdown, shrimp stomach was collected before (unchallenge) and after challenge with the 5HP (AHPND-causing) or S02 (non-AHPND causing) strains of V. parahaemolyticus, stomach samples were collected for DNA extraction using a DTAB/CTAB DNA extraction kit (GeneReach Biotechnology Corp.). The DNA isolated from shrimp stomach was screened for the presence of both the Toxin 1 sequence (which includes parts of both PirAvp and PirBvp genes) and the part of pVA1 sequence (which lies elsewhere on the pVA1 AHPND plasmid) using an IQ REAL AHPND/EMS Quantitative System on a CFX96 real-time machine (Bio-Rad) according to the supplier’s instructions. The IQ REAL system included artificial DNA that contained partial sequences of the PirABvp gene (Toxin 1) and the part of pVA1 region, which were used as standards to obtain standard curves. Copy numbers of the binary Pir toxin sequence and the pVA1 sequence were normalized against the number of host genome copies as measured by an IQ REAL WSSV Quantitative System (Gene Reach Biotechnology Corp). The data are represented as the mean±SD of triplicate tests.

ELISA assay of interaction between recombinant truncated rLvAPN1 protein and the recombinant PirAvp and PirBvp toxins

To investigate the direct binding affinity between the PirAvp and PirBvp toxins subunits and LvAPN1, the recombinant protein of PirAvp-His, PirBvp-GST, GST, and truncated LvAPN1-His (rLvAPN1) was prepared. The recombinant PirAvp-His and PirBvp-GST proteins were produced from E. coli BL-21 CodonPlus (DE3) clones harbouring plasmids to express the tagged PirAvp or PirBvp proteins; these were kindly provided by Dr. Kallaya Dangtip, Center of Excellence for Shrimp Molecular Biology and Biotechnology (CENTEX SHRIMP, Mahidol University, Thailand). The recombinant His tagged rPirAvp and the GST-tagged rPirBvp were overproduced and then purified using Ni-NTA and Glutathione-beads, respectively [22]. The recombinant truncated LvAPN1-His is N-terminal region of LvAPN1 composing of CBR and the active site of peptidase-M1 domain fused with 6×-His tag. The E. coli BL-21 (DE3) clone harbouring pET-28b-His-truncated LvAPN1was constructed by cloning the LvAPN1 fragment encoding for 388 amino acids truncated LvAPN1 containing a CBR (205Aspatic acid to 591Valine) to pET-28b-His vector. It was further expressed in LB broth at 37°C and induced with 1 mM IPTG at 30°C for 3 h. The crude rLvAPN1 was then purified by Ni-NTA. The purified truncated rLvAPN1-His, rPirAvp-His, rPirBvp-GST and rGST were then dialyzed against 1×PBS, pH 7.4. Western blots using anti-His (Bioman Scientific) and anti-GST (Cell Signaling Technology) antibodies were used to confirm the expression of the respective proteins. The interaction of toxin proteins (rPirAvp and rPirBvp) and purified truncated rLvAPN1 was determined by ELISA technique as described by Boonchuen et al. (2018) [24] with modifications. Briefly, 20 μg of the purified truncated rLvAPN1 was coated overnight with 0.1 M carbonate/bicarbonate buffer pH 9.6 in 96-well microtiter plate at 4°C. The wells were washed 3 times with TBS (20 mM Tris-HCl, 150 mM NaCl; pH 8.0) containing 0.1% (v/v) Tween 20 (TBST) for 15 min at room temperature. After that, the coated truncated LvAPN1 was blocked with TBS, pH 8.0 containing 0.5% (w/v) BSA (Sigma Aldrich) for 3 h. After washing 3 times with TBST, 100 μl of either rPirAvp, rPirBvp or rGST at various concentration (0–10 μM in TBS) were incubated with the truncated rLvAPN1-coated 96-well plate and incubated at 4°C overnight. The wells were then washed with TBST. The bound proteins (rPirAvp and rPirBvp) were detected using 1: 5 000 specific primary antibodies; (rabbit anti-PirAvp polyclonal antibody and rabbit anti-PirBvp polyclonal antibody, respectively) and a secondary antibody, HRP-conjugated goat anti-rabbit antibody, diluted 1:5 000 fold. The HRP substrate was added and A450 was measured by spectrophotometry. The specific antibodies for PirAvp and PirBvp were gifts from Professor Dr. Chu Fang Lo, Department of Biotechnology and Bioindustry Sciences, National Cheng Kung University, Tainan, Taiwan. All assays were performed in triplicate. rGST was used instead of rPirAvp and rPirBvp for the negative control, which was detected by anti-GST antibody. GraphPad Prism 6 software (Graph-Pad Software, Inc.), was used to analyzed and graphically present the data. The data were fitted to a one-site binding-specific binding model and the Kd value was determined from the nonlinear curve fitting as A = Amax [L]/(Kd + [L]), where A is the absorbance, which is proportional to the bound concentration, Amax is the maximum binding, and [L] is the concentration of the recombinant proteins. The data are represented as the mean±SD of triplicate tests.

Characterization of the putative LvAPN1 protein.

The putative N-terminal transmembrane domain is boxed. The GAMEN and HEXXH(X)18E zinc-binding site motifs are shown in bold with a grey background. The predicted Cry toxin binding region is highlight in yellow. Two conserved domains, the peptidase M1 domain and ERAP1-like C-terminal domain, are underlined and dash-underlined, respectively. Putative N-glycosylated asparagine residues predicted by the NetNGlyc 1.0 server, and putative O-glycosylated threonines and serine residues predicted by the NetOGlyc 3.1 server are shown in black. (TIF) Click here for additional data file.

Partially purification of VPAHPND toxin.

(A) SDS-PAGE analysis and (B) Western blot analysis with PirABvp polyclonal antibodies of the partially purified ammonium sulfate fractions from the culture medium of the non-AHPND isolate S02 and the VPAHPND isolate 5HP. The 2 major toxin bands (PirAvp at ~16 kDa and PirBvp at ~50 kDa) in lanes for partially purified 5HP proteins are absent from the proteins derived from S02. (TIF) Click here for additional data file.

The mRNA expression levels of the LvAPN2 gene in hemocyte of LvAPN1 knockdown shrimp.

Shrimp were injected with 0.85% NaCl, 20 μg/g shrimp of dsGFP, or 20 μg/g shrimp of dsAPN1 were determined by qRT-PCR. Relative expression of LvAPN2 gene is shown here in relative to that of EF-1α. (TIF) Click here for additional data file.

Recombinant protein purification analysis.

(A) SDS-PAGE analysis and (B) Western blot analysis with anti-His and anti-GST antibodies of recombinant truncated LvAPN1-His, rPirAvp-His, rPirBvp-GST and rGST protein overexpressed in E. coli. The His-tagged rLvAPN1 and rPirAvp were purified by Ni-NTA affinity chromatography. The deduced molecular weight for recombinant truncated LvAPN1-His and PirAvp-His were 53 and 16 kDa, respectively. The rPirBvp-GST fusion protein and rGST were purified by Sepharose 4B Glutathione beads. The estimated molecular weights for rPirBvp-GST and rGST were approximately 70 and 23 kDa, respectively. (TIF) Click here for additional data file. 10 Jan 2021 Dear Dr. Somboonwiwat, Thank you very much for submitting your manuscript "Cytotoxicity of Vibrio parahaemolyticus AHPND toxin on shrimp hemocytes, a newly identified target tissue, involves binding of toxin to aminopeptidase N1 receptor" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. In particular, additional experimental data have been requested, as well as revisions within the text of manuscript to improve interpretability and clarity. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Steven R. Blanke Associate Editor PLOS Pathogens Karla Satchell Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************** Reviewer's Responses to Questions Part I - Summary Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship. Reviewer #1: This manuscript provides compelling data that the aminopeptidase N1 (APN1) protein of shrimp hemocytes, stomach, and hepatopancreas serves as the receptor for the AHPND toxin from Vibrio parahaemolyticus (Vp). This was somewhat anticipated by prior work indicating the homology between the toxin and Cry toxin and the knowledge that APN1 serves as a receptor for Cry. This toxin is unique however in that it is a binary toxin and the data provided in this paper indicate that both components are part of the receptor binding interaction. This is also a significant interaction to have documented as the toxin is responsible for acute hepatopancreatic necrosis disease, which has significantly impacted shrimp production. Reviewer #2: The title and abstract of the article are relevant and informative. The study method is valid and reliable with well-defined variables. The findings obtained were presented in an organized way and discussed from multiple angles and placed into the context without being over interpreted. ********** Part II – Major Issues: Key Experiments Required for Acceptance Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions. Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject". Reviewer #1: While most of my comments are minor, it is important that the authors include data on how many replicates for each experiment. This was not consistently described. While not essential for the conclusions of the paper, it would definitely have been nice to see a binding curve for truncated rLvAPN1 with the heterodimer. Reviewer #2: Authors have not done paper review properly 1. The B Subunit of PirABvp Toxin Secreted from Vibrio parahaemolyticus Causing AHPND Is an Amino Sugar Specific Lectin 2. PirABVP Toxin Binds to Epithelial Cells of the Digestive Tract and Produce Pathognomonic AHPND Lesions in Germ-Free Brine Shrimp Especially the later paper demonstrate that PirABVP toxin are not specific to hepatopancreas but it can target and binds to midgut and hindgut region of digestive tract. So I think these paper can be used for writing more interesting discussion. ********** Part III – Minor Issues: Editorial and Data Presentation Modifications Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. Reviewer #1: Minor Points 1. Figures 1 and 2 are mis-ordered. 2. Move Fig S4 to Fig S3 to stay consider with order of presentation in manuscript.. 3. Symbols in panel 3B almost completely illegible. Use color. 4. Fig. 3C. Use of two different types of arrow heads would be clearer than the # and * symbols in pointing the eye to the relevant features. 5. Lines 233-234: “Assuming a one-site binding model, the apparent dissociation constants (Kd) of truncated rLvAPN1 to rPirAvp and rPirBvp, as calculated from the saturation curves, were 3.157Å~10-6 M and 0. 499Å~10-6 M, respectively.” I think stating the apparent Kd as 3.2 uM and 0.5 uM would be more appropriate as ELISA’s are not high precision measurements. 6. The cartoon in Figure 7 might lead readers to think that only the first toxin requires a receptor. Once one is bound, the remain toxins bind by oligomerization. Assuming this is not the intended implication, I recommend removing the receptor for the toxin once the toxin is drawn in its oligomerized form. Authors can note that it is not clear if the receptor remains bound. 7. Western blots using anti-His and anti-GST antibodies were used to confirm the expression of the respective proteins. Authors should state the source of the antibodies. If commercial, include the company or catalog number. Fig 2c. How many replicates were performed? Fig. 1: How many replicates were performed? Fig. 5: How many replicates were performed? Reviewer #2: Line 78- they are homologous to Photorhabdus luminescens insect-related (Pir) toxins PirA/PirB not PirAvp/PirBvp. Superscript Vp comes from Vibrio parahaemolyticus. Line 354 Why for bacterial challenge and toxin challenge assay different AHPND and non-AHPND strains were used? Line 349 If the strain is non-AHPND then how it will be VPAHPND strain, (MC)? ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Vikash kumar Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at . Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see 24 Feb 2021 Submitted filename: Submit response to reviewers plos pathogen.docx Click here for additional data file. 9 Mar 2021 Dear Dr. Somboonwiwat, We are pleased to inform you that your manuscript 'Cytotoxicity of Vibrio parahaemolyticus AHPND toxin on shrimp hemocytes, a newly identified target tissue, involves binding of toxin to aminopeptidase N1 receptor' has been provisionally accepted for publication in PLOS Pathogens. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Steven R. Blanke Associate Editor PLOS Pathogens Karla Satchell Section Editor PLOS Pathogens Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064 *********************************************************** Reviewer Comments (if any, and for reference): 23 Mar 2021 Dear Dr. Somboonwiwat, We are delighted to inform you that your manuscript, "Cytotoxicity of Vibrio parahaemolyticus AHPND toxin on shrimp hemocytes, a newly identified target tissue, involves binding of toxin to aminopeptidase N1 receptor," has been formally accepted for publication in PLOS Pathogens. We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens. Best regards, Kasturi Haldar Editor-in-Chief PLOS Pathogens ​orcid.org/0000-0001-5065-158X Michael Malim Editor-in-Chief PLOS Pathogens orcid.org/0000-0002-7699-2064
  37 in total

Review 1.  Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence.

Authors:  Nikolaj Blom; Thomas Sicheritz-Pontén; Ramneek Gupta; Steen Gammeltoft; Søren Brunak
Journal:  Proteomics       Date:  2004-06       Impact factor: 3.984

2.  Bile acid and bile acid transporters are involved in the pathogenesis of acute hepatopancreatic necrosis disease in white shrimp Litopenaeus vannamei.

Authors:  Ramya Kumar; Tze Hann Ng; Che-Chih Chang; Teng-Chun Tung; Shih-Shun Lin; Chu-Fang Lo; Han-Ching Wang
Journal:  Cell Microbiol       Date:  2019-11-13       Impact factor: 3.715

3.  Detection of acute hepatopancreatic necrosis disease (AHPND) in Mexico.

Authors:  Linda Nunan; Donald Lightner; Carlos Pantoja; Silvia Gomez-Jimenez
Journal:  Dis Aquat Organ       Date:  2014-08-21       Impact factor: 1.802

Review 4.  Pore formation by Cry toxins.

Authors:  Mario Soberón; Liliana Pardo; Carlos Muñóz-Garay; Jorge Sánchez; Isabel Gómez; Helena Porta; Alejandra Bravo
Journal:  Adv Exp Med Biol       Date:  2010       Impact factor: 2.622

5.  Development of clenbuterol reference materials: lyophilized bovine eye samples free of clenbuterol (CRM 673) and containing clenbuterol (CRM 674). Part 1. Preparation, homogeneity and stability.

Authors:  M W Pfaffl; L A van Ginkel; J D McEvoy; G Maghuin-Rogister; H H Meyer
Journal:  Fresenius J Anal Chem       Date:  2001-12

6.  Effect of Bacillus thuringiensis Cry1 toxins in insect hemolymph and their neurotoxicity in brain cells of Lymantria dispar.

Authors:  A Cerstiaens; P Verleyen; J Van Rie; E Van Kerkhove; J L Schwartz; R Laprade; A De Loof; L Schoofs
Journal:  Appl Environ Microbiol       Date:  2001-09       Impact factor: 4.792

7.  Molecular characterization of four midgut aminopeptidase N isozymes from the cabbage looper, Trichoplusia ni.

Authors:  Ping Wang; Xin Zhang; Jie Zhang
Journal:  Insect Biochem Mol Biol       Date:  2005-03-17       Impact factor: 4.714

8.  Analysis of Homologs of Cry-toxin Receptor-Related Proteins in the Midgut of a Non-Bt Target, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

Authors:  Ensi Shao; Li Lin; Sijun Liu; Jiao Zhang; Xuelin Chen; Li Sha; Zhipeng Huang; Biwang Huang; Xiong Guan
Journal:  J Insect Sci       Date:  2018-02-05       Impact factor: 1.857

9.  MicroRNA and mRNA interactions coordinate the immune response in non-lethal heat stressed Litopenaeus vannamei against AHPND-causing Vibrio parahaemolyticus.

Authors:  Pakpoom Boonchuen; Benedict A Maralit; Phattarunda Jaree; Anchalee Tassanakajon; Kunlaya Somboonwiwat
Journal:  Sci Rep       Date:  2020-01-21       Impact factor: 4.379

10.  PirABVP Toxin Binds to Epithelial Cells of the Digestive Tract and Produce Pathognomonic AHPND Lesions in Germ-Free Brine Shrimp.

Authors:  Vikash Kumar; Lobke De Bels; Liesbeth Couck; Kartik Baruah; Peter Bossier; Wim Van den Broeck
Journal:  Toxins (Basel)       Date:  2019-12-09       Impact factor: 4.546

View more
  5 in total

1.  Haloalkaline Lipase from Bacillus flexus PU2 Efficiently Inhibits Biofilm Formation of Aquatic Pathogen Vibrio parahaemolyticus.

Authors:  Esakkiraj Palanichamy; Ayyanna Repally; Natwar Jha; Arul Venkatesan
Journal:  Probiotics Antimicrob Proteins       Date:  2022-03-14       Impact factor: 4.609

2.  Identification and Expression Analysis of an Interacting Protein (LvFABP) that Mediates Vibrio parahaemolyticus AHPND Toxin Action.

Authors:  Xiaoqian Gu; Mei Liu; Baojie Wang; Keyong Jiang; Lei Wang
Journal:  Front Immunol       Date:  2022-07-04       Impact factor: 8.786

Review 3.  New Insights into the Mechanism of Action of PirAB from Vibrio Parahaemolyticus.

Authors:  Sonia A Soto-Rodriguez; Rodolfo Lozano-Olvera; Gabriela Ramos-Clamont Montfort; Edgar Zenteno; José Luis Sánchez-Salgado; Norberto Vibanco-Pérez; Karla G Aguilar Rendón
Journal:  Toxins (Basel)       Date:  2022-03-30       Impact factor: 5.075

4.  The Hippo-Yki Signaling Pathway Positively Regulates Immune Response against Vibrio Infection in Shrimp.

Authors:  Linwei Yang; Zi-Ang Wang; Ran Geng; Shengwen Niu; Hongliang Zuo; Zhixun Guo; Shaoping Weng; Jianguo He; Xiaopeng Xu
Journal:  Int J Mol Sci       Date:  2022-10-07       Impact factor: 6.208

5.  Expression of the AHPND Toxins PirAvp and PirBvp Is Regulated by Components of the Vibrio parahaemolyticus Quorum Sensing (QS) System.

Authors:  Shin-Jen Lin; Jiun-Yan Huang; Phuoc-Thien Le; Chung-Te Lee; Che-Chang Chang; Yi-Yuan Yang; Emily Chia-Yu Su; Chu-Fang Lo; Hao-Ching Wang
Journal:  Int J Mol Sci       Date:  2022-03-07       Impact factor: 5.923

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.