Yanli Zhao1, Qi Zheng2, Hanchao Gao1, Mengtao Cao1, Huiyun Wang1, Rong Chang1,3, Changchun Zeng1. 1. Department of Medical Laboratory, Shenzhen Longhua District Central Hospital, Affiliated Central Hospital of Shenzhen Longhua District, Guangdong Medical University, Shenzhen 518110, China. 2. School of Life Sciences, Shandong University, Qingdao 266237, China. 3. Department of Cardiovascular Medicine, Shenzhen Longhua District Central Hospital, Affiliated Central Hospital of Shenzhen Longhua District, Guangdong Medical University, Shenzhen 518110, China.
Abstract
Cardiac hypertrophy is an adaptive response to all forms of heart disease, including hypertension, myocardial infarction, and cardiomyopathy. Cyclooxygenase-2 (COX-2) overexpression results in inflammatory response, cardiac cell apoptosis, and hypertrophy in adult heart after injury. However, immune response-mediated cardiac hypertrophy and fibrosis have not been well documented in injured neonatal heart. This study showed that cardiac hypertrophy and fibrosis are significantly attenuated in celecoxib (a selective COX-2 inhibitor)-treated P8 ICR mice after cryoinjury. Molecular and cellular profiling of immune response shows that celecoxib inhibits the production of cytokines and the expression of adhesion molecular genes, increases the recruitment of M1-like macrophage at wound site, and alleviates cardiac hypertrophy and fibrosis. Furthermore, celecoxib administration improves cardiac function at 4 weeks after injury. These results demonstrate that COX-2 inhibition promotes the recruitment of M1-like macrophages during early wound healing, which may contribute to the suppression of cardiac hypertrophy and fibrosis after injury.
Cardiac hypertrophy is an adaptive response to all forms of heart disease, including hypertension, myocardial infarction, and cardiomyopathy. Cyclooxygenase-2 (COX-2) overexpression results in inflammatory response, cardiac cell apoptosis, and hypertrophy in adult heart after injury. However, immune response-mediated cardiac hypertrophy and fibrosis have not been well documented in injured neonatal heart. This study showed that cardiac hypertrophy and fibrosis are significantly attenuated in celecoxib (a selective COX-2 inhibitor)-treated P8 ICR mice after cryoinjury. Molecular and cellular profiling of immune response shows that celecoxib inhibits the production of cytokines and the expression of adhesion molecular genes, increases the recruitment of M1-like macrophage at wound site, and alleviates cardiac hypertrophy and fibrosis. Furthermore, celecoxib administration improves cardiac function at 4 weeks after injury. These results demonstrate that COX-2 inhibition promotes the recruitment of M1-like macrophages during early wound healing, which may contribute to the suppression of cardiac hypertrophy and fibrosis after injury.
Myocardial infarction (MI) is the leading cause of mortality. The process of MI contributes to pathological cardiac hypertrophy, including individual cardiomyocyte enlargement and increase in left ventricular wall thickness (Nakamura and Sadoshima, 2018). During cardiac hypertrophy, a series of pathological changes occur, such as cardiomyocyte death, cardiac muscle contraction, dilated cardiomyocytes, and other cardiac diseases, which contribute to heart dysfunction. Non-regenerating mice (P7, at postnatal day 7) lack regenerative capacity with age; thus immune cells (e.g., CD4+ T cells, regulatory T cells, and macrophages) and non-immune cells (e.g., cardiac fibroblast, cardiac endothelial cells, and remaining cardiomyocytes) are important mediators of cardiac hypertrophy and fibrosis after injury (Frieler and Mortensen, 2015; Kvakan et al., 2009; Lai et al., 2019; Ma et al., 2019). In addition, hypertrophic gene expression and inflammatory response have been reported during cardiac fibrosis (Manabe et al., 2002). Thus, deciphering the role of immune response mediating cardiac fibrosis could provide novel insights into cardiac hypertrophy after injury.Selective cyclooxygenase-2 inhibitors are non-steroidaal anti-inflammatory drugs belonging to the COX family (cyclooxygenase-1 [COX-1], cyclooxygenase-2 [COX-2], and cyclooxygenase-3 [COX-3]) for acute or chronic inflammation and pain in clinical settings (Nissen et al., 2016). Inducible COX-2 is increased in inflammatory diseases, transplantation, and heart diseases with inflammation progress, such as airway inflammation (Rumzhum and Ammit, 2016), chronic pancreatitis (Huang et al., 2019), diabetes (Robertson, 2017), hypertension (Wong et al., 2013), cardiac allograft transplantation (Yang et al., 2000), and coronary artery disease (Chenevard et al., 2003). Upregulated COX-2 and its products also contribute to vascular dysfunction and heart failure after injury. In vascular endothelial cells, COX-2 inhibitor attenuates C-reactive protein (CRP) and inhibits interleukin-6 (IL-6) and tissue factor production (Al-Rashed et al., 2018;(Steffel et al., 2005) Chenevard et al., 2003). In cardiac function, COX-2 inhibitors reduce myocardial damage and inflammation after cardiac allograft transplantation (Ma et al., 2002). Intriguingly, COX-2 inhibitors or knockout mice improve cardiac hypertrophy and dysfunction after injury or stimulation in different adult models, such as MI, ischemia with reperfusion, abdominal aortic constrictions, and Ang II- and aldosterone-induced cardiac hypertrophy (Camitta et al., 2001; Chi et al., 2017; Feniman De Stefano et al., 2016; Wu et al., 2005; Zhang et al., 2016).After injury, pro-inflammatory response suppresses wound healing because of the migration and recruitment of many inflammatory cells at the wound site (Epelman et al., 2015). Anti-inflammatory regulatory cells contribute to heart regeneration and cardiac cell survival, such as regulatory macrophages, Tregs, and invariant natural killer T cells (Aurora et al., 2014; Homma et al., 2013; Sobirin et al., 2012; Zacchigna et al., 2018). Emerging studies have shown that macrophages play a vital role in tissue regeneration after injury (Aurora et al., 2014; Simoes et al., 2020; Wynn and Vannella, 2016). Macrophages induce angiogenesis after MI, promoting cardiac regeneration in mice (Aurora et al., 2014). Consequently, macrophages enhance collagen deposition and fibrosis to scar formation in non-regenerating mice (Simoes et al., 2020). Macrophages also secrete cytokines (TNF-α, IL-1β, and IL-10), matrix metallopeptidase, chemokines (CCL2, CCR7, CXCL9, and CXCL10), and growth factors (transforming growth factor [TGF-β], vascular endothelial growth factor, epidermal growth factor, and fibroblast growth factor) to promote or inhibit wound healing (Braga et al., 2015; Ding et al., 2019; Mantovani et al., 2004). Interestingly, COX-2 regulates pro-inflammatory and anti-inflammatory responses to modulate tissue repair (Kaushik and Das, 2019; Li et al., 2018). Recent studies have shown that celecoxib (a selective cyclooxygenase-2 inhibitor) reduces the production of pro-inflammatory cytokines (TNF-α, IL-6, IL-1β, and IL-17), iNOS expression, and the recruitment of F4/80 + macrophages and CD4+ T cells, thereby promoting wound healing in skin repair (Geesala et al., 2017; Romana-Souza et al., 2016). Low levels of COX-2 and PGE2 also limit scar formation in fetal skin wound by reducing TGF-β1 expression and suppressing inflammatory response (Wilgus et al., 2004). Intriguingly, emerging studies demonstrated that COX-2 deficiency or inhibition can reduce myocardial fibrosis, infarcted myocardial wall thickness, and infarct collagen density in mice (Chi et al., 2017; LaPointe et al., 2004). In neonatal rat model, COX-2 expression is associated with endothelin-1-induced cardiac hypertrophy in vitro (Li et al., 2014). Although low levels of COX-2 enhance tissue healing, promotion of scar-free heart repair using selective COX-2 inhibition remains unclear in neonatal mice.Also, accumulating studies have reported that neonatal mice provided an ideal model in which to demonstrate tissue repair or regeneration because neonatal mice have remarkable regenerating or repairing capacity compared with adult mice (Konfino et al., 2015; Mahmoud et al., 2014; Porrello et al., 2011; Xia et al., 2018). A recent study reported that cryoinjury (CI) induced successful cardiac hypertrophy in GATA4 knockout neonatal mice, but not apical resection injury model (Yu et al., 2016). Also, no blood loss, scaling injury size (e.g., 0.5 mm, 1.0 mm, and 2.0 mm), and reproducible results could be useful for the comparison between regenerative and non-regenerative neonatal models in CI model (Polizzotti et al., 2015, 2016). Thus, we used CI injury neonatal model to induce cardiac hypertrophy and fibrosis in our study. In this study, we found that celecoxib treatment attenuated pro-inflammatory cytokine production, hypertrophic and pro-fibrotic gene expression, and adhesion molecule gene expression in neonatal non-regenerative heart following CI. We also demonstrated that selective COX-2 inhibition may induce M1-like macrophage infiltration, which improves cardiac hypertrophy and fibrosis at the early stage of heart injury in non-regenerative mice.
Results
Different hypertrophic changes during neonatal mouse regeneration
We induced CI in regenerating (P3) and non-regenerating (P8) ICR mice to investigate whether or not different hypertrophic changes occur during heart regeneration (Figure 1A). Heart weight/body weight (HW/BW) (mg/g) and cardiomyocyte size (μm2) were observed at 4 weeks after injury in the P3 and P8 groups. Surprisingly, the HW/BW and cardiomyocyte size of the injured P8 hearts from the border zone significantly increased compared with those of the sham group and P3 injured hearts, and the injured P3 hearts even showed obvious scar formation (Figures 1B–1E). In line with previous studies (Cui et al., 2020; Wang et al., 2019b), we also performed Masson's trichrome staining to identify cardiac fibrosis. Results showed that collagen content significantly increased at 4 weeks after CI in P8 group compared with the P3 group (Figures 1E and 1F). Furthermore, we performed severe CI (copper wire: 2 mm2) to induce cardiac hypertrophy of P3 and P8 group, demonstrating that HW/BW (mg/g) and collagen content of P8 CI group significantly increased compared with that of sham and P3 CI group (Figures S1A–S1C). Also, the percentage of relative wall thickness was higher in the P8 group than in the P3 group at 4 weeks after injury (Figures S1D and S1E). These data showed that non-regenerating mice showed cardiac hypertrophic changes and failed to regenerate in the infarct zone after injury.
Figure 1
Cardiac hypertrophy and fibrosis were induced in non-regenerative mice (P8) following CI
(A) Experimental design of cryoinfarction (cryoinjury [CI]) injury model and analysis in (B–F).
(B) Heart weight/body weight (HW/BW, mg/g) in sham, regenerating mice (P3, at postnatal day 3), and non-regenerating mice (P8) at 4 weeks after injury.
(C) Heart tissue of sham, P3 injury, and P8 injury was cross-sectioned and stained with hematoxylin and eosin (H&E) for analysis; scale bars: 300 μm (40× objective) and 50 μm (400× objective);
(D) Quantification of sham, P3, and P8 cardiomyocytes at 4 weeks after injury (n = 3 per group, independent experiments [n = 2]).
(E) Heart tissue of P3 or P8 after injury (copper wire area: 1 mm2, ICR mother mice: 4–6 weeks) was stained with Masson's trichrome; scale bar, 2,000 μm.
(F) Quantification of fibrosis coverage (%, 100 × scar perimeter/total perimeter) in P3 and P8 left ventricle at 4 weeks following CI. Data are representative of two independent experiments (n = 4–6 per group, mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001)
Cardiac hypertrophy and fibrosis were induced in non-regenerative mice (P8) following CI(A) Experimental design of cryoinfarction (cryoinjury [CI]) injury model and analysis in (B–F).(B) Heart weight/body weight (HW/BW, mg/g) in sham, regenerating mice (P3, at postnatal day 3), and non-regenerating mice (P8) at 4 weeks after injury.(C) Heart tissue of sham, P3 injury, and P8 injury was cross-sectioned and stained with hematoxylin and eosin (H&E) for analysis; scale bars: 300 μm (40× objective) and 50 μm (400× objective);(D) Quantification of sham, P3, and P8 cardiomyocytes at 4 weeks after injury (n = 3 per group, independent experiments [n = 2]).(E) Heart tissue of P3 or P8 after injury (copper wire area: 1 mm2, ICR mother mice: 4–6 weeks) was stained with Masson's trichrome; scale bar, 2,000 μm.(F) Quantification of fibrosis coverage (%, 100 × scar perimeter/total perimeter) in P3 and P8 left ventricle at 4 weeks following CI. Data are representative of two independent experiments (n = 4–6 per group, mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001)
Inflammatory stimuli change during neonatal mouse regeneration
To determine whether or not inflammatory stimuli are involved in cardiac hypertrophy and fibrosis, we performed real-time PCR to identify the changes in inflammatory stimuli in the infarct zone between the P3 and P8 groups at 7 days or 4 weeks after injury (primers listed in Table 1). The mRNA and protein levels of COX-2 were significantly upregulated in the non-regenerative mice (P8) at 7 days and 4 weeks after injury (Figures 2A and 2B). The levels of IL-6, IL-10, IFN-γ, IL-17, and IL-21 also increased in the P3 and P8 groups at 4 weeks after CI compared with the sham group (Figure 2C). Meanwhile, the level of MCP-1 was significantly upregulated in both groups (Figure 2D). Moreover, the expression of adhesion molecular genes (VCAM-I and ICAM-I) was significantly increased (Figure 2D). Interestingly, the mRNA expression levels of IL-6, IL-1β, and ICAM-I significantly increased in the infarct zone of the P8 group than in that of the P3 group (Figures 2C and 2D).
Table 1
Listing of primers and primer sequences for real-time PCR
No.
Gene name
Primer sequence (5′–3′)
1
COX-2
TGCTGTACAAGCAGTGGCAA
GCAGCCATTTCCTTCTCTCC
2
IFN-γ
TCAAGTGGCATAGATGTGGAAGAA
TGGCTCTGCAGGATTTTCATG
3
TNF-α
ATTATGGCTCAGGGTCCAAC
GACAGAGGCAACCTGACCAC
4
IL-6
GACTTCCATCCAGTTGCCTT
ATGTGTAATTAAGCCTCCGACT
5
IL-1β
GCTGCTTCCAAACCTTTGACC
AGCCACAATGAGTGATACTGCC
6
IL-10
ATCTTAGCTAACGGAAACAACTCCT
TAGAATGGGAACTGAGGTATCAGAG
7
IL-17
GCTGACCCCTAAGAAACCCC
GAAGCAGTTTGGGACCCCTT
8
IL-21
GGCTCTCGTTCCCACAGATG
CGTCTATAGTGTCCGGCGTC
9
VCAM-1
GCCACCCTCACCTTAATTGCT
GCACACGTCAGAACAACCGAA
10
ICAM-1
CTCACTTGCAGCACTACGG
TTCATTCTCAAAACTGACAGGC
11
MCP-1
TTAAAAACCTGGATCGGAACCAA
GCATTAGCTTCAGATTTACGGGT
12
Myh-7
TGCCCCATATATACAGCCCCT
TGGAGCCCCTTATCCCAGAG
13
Acta1
CGCCAGCCTCTGAAACTAGA
ACGATGGATGGGAACACAGC
14
Nppb (BNP)
TTTGGGCTGTAACGCACTGA
CACTTCAAAGGTGGTCCCAGA
15
Nppa (ANP)
CTGCTTCGGGGGTAGGATTG
CACACCACAAGGGCTTAGGA
16
TGF-β1
GGCCAGATCCTGTCCAAGC
GTGGGTTTCCACCATTAGCAC
17
TGF-β2
CTTCGACGTGACAGACGCT
GCAGGGGCAGTGTAAACTTATT
18
TGF-β3
CCTGGCCCTGCTGAACTTG
TTGATGTGGCCGAAGTCCAAC
19
TGF-βr1
GAGATTCCAGCTGTTGTTCTGTTAT
CTGTACTGCACTCCCAAACTATTCT
20
GAPDH
GGCATTGCTCTCAATGACAA
TGTGAGGGAGATGCTCAGTG
Figure 2
Pro-inflammatory cytokines, chemokines, and pro-fibrotic gene expression increased in P3 and P8 groups following CI
(A) Protein levels of COX-2, TGF-β2, and Snail in sham, P3, and P8 heart were measured using western blot at 7 days post CI, respectively;
(B–E) (B) mRNA level of COX-2 in Sham, P3, and P8 heart was measured using real-time PCR at 7 days and 4 weeks after injury; mRNA levels of (C) cytokines, (D) chemokines (MCP-1), adhesion molecular genes (ICAM-I and VCAM-I), and (E) pro-fibrotic genes (TGF-βs and TGFBR1) were measured using real-time PCR in Sham, P3, and P8 heart at 4 weeks after injury. Data are representative of two independent experiments (n = 4–6 per group, mean ± SD, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).
Listing of primers and primer sequences for real-time PCRPro-inflammatory cytokines, chemokines, and pro-fibrotic gene expression increased in P3 and P8 groups following CI(A) Protein levels of COX-2, TGF-β2, and Snail in sham, P3, and P8 heart were measured using western blot at 7 days post CI, respectively;(B–E) (B) mRNA level of COX-2 in Sham, P3, and P8 heart was measured using real-time PCR at 7 days and 4 weeks after injury; mRNA levels of (C) cytokines, (D) chemokines (MCP-1), adhesion molecular genes (ICAM-I and VCAM-I), and (E) pro-fibrotic genes (TGF-βs and TGFBR1) were measured using real-time PCR in Sham, P3, and P8 heart at 4 weeks after injury. Data are representative of two independent experiments (n = 4–6 per group, mean ± SD, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).In addition, we identified the mRNA levels of TGF-βs (1/2/3) at 4 weeks after CI as TGF-βs (1/2/3) are important mediators of cardiac hypertrophy and fibrosis (Kuwahara et al., 2002; Rosenkranz et al., 2002; Sakata et al., 2008). The mRNA levels of TGF-βs (1/2/3) and TGFBR1 were upregulated in both groups at 4 weeks after CI, but no significant changes besides TGF-β2 were found in the infarct zone of P8 compared with P3 injured heart (Figure 2E). Furthermore, the protein levels of TGF-β2 and TGF-β signaling-induced Snail were increased in the P8 CI group at day 7 (Figure 2A).These data demonstrated that inflammatory stimuli were induced in regenerating and non-regenerating hearts after injury, but IL-6, IL-1β, ICAM-I, and pro-fibrotic cytokine (TGF-β2) may be the predominant stimuli in cardiac hypertrophy and fibrosis after injury in non-regenerating mice. However, the resource of these pro-inflammatory stimuli remains unclear because various cell types produce different pathological stimuli after injury (Mahdavian Delavary et al., 2011; Manabe et al., 2002). Intriguingly, COX-2 inhibitors have been reported in suppressing or reducing cardiac hypertrophy and fibrosis in adult rat or mice after injury (Jacobshagen et al., 2008; Zhang et al., 2016). Celecoxib is a selective COX-2 inhibitor that has been approved for clinical use, and clinical trials showed that moderate doses of celecoxib exert no severe cardiovascular side effects (Slomski, 2016).
Celecoxib treatment inhibits cardiac hypertrophy and fibrosis after CI in non-regenerating mice
To investigate the role of celecoxib in cardiac hypertrophy and fibrosis in P8 after injury, we performed CI to P8 ICR mice treated or untreated with celecoxib (50 mg/kg) at days 0, 1, and 2 (Figure 3A). The ratio of HW/BW (mg/g) significantly increased in the untreated and treated P8 groups after injury compared with the sham group at 4 weeks (Figures 3B and 3C). Surprisingly, the HW/BW ratio significantly reduced in the celecoxib-treated P8 heart compared with the DMSO-treated P8 heart after injury at 4 weeks (Figures 3B and 3C). We also quantified the size of cardiomyocytes (μm2) by using H&E and wheat germ agglutinin staining. Similarly, the size of cardiomyocytes from the border zone in P8 heart significantly reduced after celecoxib treatment compared with that of DMSO treatment at 4 weeks after injury, although the cardiomyocyte size of celecoxib-treated P8 CI heart was significantly increased compared with that of the sham group (Figure 3D). Meanwhile, we performed Masson's trichrome staining to identify the scar formation of P8 heart treated with DMSO and celecoxib at 4 weeks after injury. Celecoxib administration significantly reduced excessive scar formation in P8 heart (Figure 3E), which was completely different from adult heart after myocardial ischemia-reperfusion injury (Zhu et al., 2019). These data demonstrated that selective COX-2 inhibition would inhibit the cardiac hypertrophy and scar formation of non-regenerative mice (P8) when celecoxib is administrated at the early stage of injury.
Figure 3
Celecoxib administration inhibited cardiac hypertrophy and fibrosis to repair injured neonatal heart in non-regenerative mice
(A) Experimental design of DMSO treated- and celecoxib-treated heart following CI and analysis for 4 weeks in (B–E).
(B) Neonatal ICR mice were intraperitoneally (i.p.) injected with DMSO and celecoxib at 50 mg/kg per mouse 0, 1, and 2 days after CI; scale bar, 2,000 μm.
(C and D) (C) Heart weight/body weight (mg/g) and (D) size of cardiomyocytes (μm2) were measured by H&E and wheat germ agglutinin (WGA) staining in sham, DMSO treated-, and celecoxib-treated P8 mice at 4 weeks after injury; scale bars: 50 μm (400× objective), 100 μm (200× objective), and 200 μm (100× objective).
(E) Fibrosis coverage (%, 100 × scar perimeter/total perimeter) of heart tissue was measured using Masson's trichrome staining in DMSO treated- and celecoxib-treated P8 mice at 4 weeks after injury; scale bar, 1,000 μm. Data are representative of two independent experiments (n = 4–6 per group, mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).
Celecoxib administration inhibited cardiac hypertrophy and fibrosis to repair injured neonatal heart in non-regenerative mice(A) Experimental design of DMSO treated- and celecoxib-treated heart following CI and analysis for 4 weeks in (B–E).(B) Neonatal ICR mice were intraperitoneally (i.p.) injected with DMSO and celecoxib at 50 mg/kg per mouse 0, 1, and 2 days after CI; scale bar, 2,000 μm.(C and D) (C) Heart weight/body weight (mg/g) and (D) size of cardiomyocytes (μm2) were measured by H&E and wheat germ agglutinin (WGA) staining in sham, DMSO treated-, and celecoxib-treated P8 mice at 4 weeks after injury; scale bars: 50 μm (400× objective), 100 μm (200× objective), and 200 μm (100× objective).(E) Fibrosis coverage (%, 100 × scar perimeter/total perimeter) of heart tissue was measured using Masson's trichrome staining in DMSO treated- and celecoxib-treated P8 mice at 4 weeks after injury; scale bar, 1,000 μm. Data are representative of two independent experiments (n = 4–6 per group, mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).
Celecoxib inhibits hypertrophic and pro-fibrotic gene expression by regulating pro-inflammatory cytokines, chemokine (MCP-1), and adhesion molecule genes (ICAM-I and VCAM-I) after injury in non-regenerating mice
To study the changes in hypertrophic and pro-fibrotic gene expression after myocardial injury, we analyzed the published RNA-sequencing data in P1 and P8 at 1.5 and 7 days after MI, respectively (Wang et al., 2019b). In line with previous study, pro-inflammatory and pro-fibrotic signaling was induced in P8 heart compared with P1 heart at 1.5 and 7 days after injury (Wang et al., 2019b) (Figures S2A–S2C). To further demonstrate the relationship between inflammatory response and hypertrophy response, we reanalyzed related signaling pathways in regenerative and non-regenerative mice models at 7 days after injury. The Gene Ontology (GO) enrichment analysis showed that leukocyte migration, neutrophil migration, and cytokine- and chemokine-mediated signaling pathways were significantly enriched in the context of inflammatory response. Also, TGF-β signaling, PI3K-AKT signaling, extracellular matrix organization, hypertrophic cardiomyopathy, and collage fibril organization were significantly enriched, which may contribute to cardiac hypertrophy and fibrosis (Figure S2C). Furthermore, our bioinformatic analysis showed that the expression levels of hypertrophic genes (e.g., BNP, Myh7, and Acta1) and pro-fibrotic genes (e.g.,TGF-β1/2/3) significantly differed between regenerative and non-regenerative mice (Wang et al., 2019b) (Figure S2D). To study changes in hypertrophic genes, we identified cardiac hypertrophic makers through real-time PCR (primers listed in Table 1). The mRNA levels of ANP and Acta1 increased in P3 and P8 hearts at 7 days after injury, whereas those of BNP and Myh7 significantly increased in P8 heart at 7 days after injury compared with the sham group (Figure 4A). Compared with DMSO group, celecoxib treatment significantly reduced the levels of ANP, Myh7, and Acta1 in P8 heart at 7 days after injury (Figure 4A).
Figure 4
Celecoxib administration reduced cardiac hypertrophic and fibrotic gene expression as well as inflammatory-related gene expression in non-regenerative mice following injury
(A and B) (A) mRNA levels of hypertrophic genes and (B) pro-fibrotic genes were analyzed in sham, P3, P8, and DMSO-treated and celecoxib-treated P8 mice at 7 days after injury;
(C) Protein levels of pro-fibrotic genes and Snail in DMSO treated- and celecoxib-treated P8 mice were measured by western blot at 7 days after injury, respectively. Data are representative of two independent experiments (n = 5–6 per group, mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).
Celecoxib administration reduced cardiac hypertrophic and fibrotic gene expression as well as inflammatory-related gene expression in non-regenerative mice following injury(A and B) (A) mRNA levels of hypertrophic genes and (B) pro-fibrotic genes were analyzed in sham, P3, P8, and DMSO-treated and celecoxib-treated P8 mice at 7 days after injury;(C) Protein levels of pro-fibrotic genes and Snail in DMSO treated- and celecoxib-treated P8 mice were measured by western blot at 7 days after injury, respectively. Data are representative of two independent experiments (n = 5–6 per group, mean ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).Next, we identified different pro-fibrotic gene expression in regenerative and non-regenerative neonatal mice at day 7 after injury. The mRNA expression levels of TGF-β2 and TGFBR1 were higher in P8 injured heart than in P3 injured heart at day 7, and celecoxib administration significantly reduced the mRNA levels of TGF-β2 and TGFBR1 (Figure 4B). Meanwhile, the protein levels of TGF-β2 and TGF-β signaling-induced Snail were reduced after celecoxib administration at 7 days after injury (Figure 4C). These data demonstrated that celecoxib administration inhibited pro-fibrotic gene expression in non-regenerative mice at 7 days after injury, thereby suppressing cardiac hypertrophy and fibrosis at an early stage after injury.Immune response plays a critical role in cardiac repair and regeneration (Lai et al., 2019; Wang et al., 2019a). The recent studies suggested that Ly6C+ monocyte subset was significantly increased within 24 h after neonatal heart injury, and macrophages were required for neonatal heart regeneration (Aurora et al., 2014; Wang et al., 2019b, 2020). Also, increasing studies illustrated that mRNA expression of MCP-1 was significantly increased at different time points after skin injury, and peaked MCP-1 expression was at 3 and 5 h after injury (Bai et al., 2008; Rezvan et al., 2020). In context of atherosclerotic lesions, mRNA expression of MCP-1 was significantly upregulated at 15 weeks after consecutive celecoxib treatment compared with the untreated group (Bea, 2003). Also, previous studies showed that PGE2, a product of COX-2, would inhibit MCP-1 expression in vivo and in vitro (Largo et al., 2004; Schneider et al., 1999).Thus, we performed real-time PCR and ELISA to demonstrate whether MCP-1 was induced at the early stage of injury in celecoxib treatment (Figure 5A). Our data showed that mRNA levels of MCP-1 significantly increased at D1, D3, and D7 in celecoxib-treated P8 CImice compared with that of Sham and DMSO-treated P8 mice (Figure 5B). The protein expression levels of MCP-1 was significantly upregulated at 3 and 7 days in celecoxib-treated compared with DMSO-treated P8 CImice, but no difference was present at 1 day after injury (Figure 5C). Our data suggested that celecoxib treatment would upregulate MCP-1 expression, which may recruit M1-like macrophages to repair injured heart at the early stage of injury. To evaluate the role of the anti-inflammatory agent celecoxib on the production of inflammatory stimuli after cardiac injury, we performed western blot to identify chemokine (MCP-1) and adhesion molecular genes (VCAM-I and ICAM-I) in the infarct/border zone at 7 days after injury. We found that the protein level of VCAM-I significantly reduced, whereas that of MCP-1 slightly increased in celecoxib-treated P8 heart at 7 days after CI (Figure 5D).
Figure 5
Celecoxib administration inhibited inflammatory-related gene expression in non-regenerative mice following injury
(A–D) (A) Experimental design of DMSO treated- and celecoxib-treated heart following CI and analysis for 1, 3, and 7 days in (B–D). mRNA levels (B) or protein levels (C) of MCP-1 were measured by real-time PCR or ELISA in both groups; protein levels of (D) chemokines and adhesion molecular genes were measured by western blot at 7 days after injury in DMSO treated- and celecoxib-treated P8 mice. Data are representative of two independent experiments (n = 5–6 per group, mean ± SD; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).
Celecoxib administration inhibited inflammatory-related gene expression in non-regenerative mice following injury(A–D) (A) Experimental design of DMSO treated- and celecoxib-treated heart following CI and analysis for 1, 3, and 7 days in (B–D). mRNA levels (B) or protein levels (C) of MCP-1 were measured by real-time PCR or ELISA in both groups; protein levels of (D) chemokines and adhesion molecular genes were measured by western blot at 7 days after injury in DMSO treated- and celecoxib-treated P8 mice. Data are representative of two independent experiments (n = 5–6 per group, mean ± SD; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).These data demonstrated that COX-2 inhibition reduced the expression of inflammatory cytokines and VCAM-I but upregulated MCP-1, which may contribute to the activation and migration of immune cell after cardiac injury.
Celecoxib modulates macrophages during cardiac hypertrophy and fibrosis
Various immune cells produce cytokines, chemokines, and other pathological stimuli; the previous studies showed that immune cell infiltration promoted cardiac hypertrophy and fibrosis (Frieler and Mortensen, 2015; Liu et al., 2019; Swirski and Nahrendorf, 2018). Accumulating evidence has shown that macrophages were required for heart regeneration and repair (Aurora et al., 2014; Simoes et al., 2020). In the present study, MCP-1 expression was significantly upregulated in the celecoxib-treated group at the early stage of injury, which may regulate macrophage migration (Figures 5B and 5C).To investigate the role of macrophage in celecoxib administration during neonatal heart repair, we also identified M1-like (F4/80+ Ly6C+) and M2-like (F4/80+ CD206+ Ly6C-) macrophages among the total F4/80+ macrophages at 7 days after P8 heart injury (Figure 6A). We found no predominant difference in the percentage of all F4/80+ macrophages from the infarct/border zone of the celecoxib- and DMSO-treated groups, but the percentage of all F4/80+ macrophages from the spleen significantly reduced in the celecoxib-treated group compared with the DMSO-treated group (Figure 6B). Surprisingly, the percentage and number of M1-like macrophages from the infarct/border zone of the heart and spleen significantly increased in the celecoxib-administered group compared with the DMSO-treated group (Figures 6C, 6D, 6F, and 6G). Furthermore, the percentage and number of M2-like macrophages from all F4/80+ macrophages of the spleen considerably decreased in the celecoxib-treated group compared with the DMSO-treated group, whereas those of M2-like macrophages from the infarct/border zone of the heart showed no significant difference in both groups (Figures 6C, 6E, 6F, and 6H).
Figure 6
Celecoxib administration increased M1-like macrophage infiltration after injury
(A) Experimental design of DMSO treated- and celecoxib-treated P8 heart following CI and analysis for 7 days in (B–H).
(B–E) (B and C) Percentage of total F4/80+ macrophages of infarct/border zones was analyzed by flow cytometry at 7 days after injury; percentage and quantification of (D) M1-like macrophages (F480 + Ly6C high M1) and (E) M2-like macrophages (F480+ CD206+ Ly6C low M2).
(F–H) (F and G) Percentage and quantification of M1-like macrophages and (H) M2-like macrophages from the spleen were analyzed by flow cytometry in both groups the same as those in the heart. Data are representative of three independent experiments (n = 3–5 per group, mean ± SD, ∗p < 0.05, ∗∗∗p < 0.001).
Celecoxib administration increased M1-like macrophage infiltration after injury(A) Experimental design of DMSO treated- and celecoxib-treated P8 heart following CI and analysis for 7 days in (B–H).(B–E) (B and C) Percentage of total F4/80+ macrophages of infarct/border zones was analyzed by flow cytometry at 7 days after injury; percentage and quantification of (D) M1-like macrophages (F480 + Ly6C high M1) and (E) M2-like macrophages (F480+ CD206+ Ly6C low M2).(F–H) (F and G) Percentage and quantification of M1-like macrophages and (H) M2-like macrophages from the spleen were analyzed by flow cytometry in both groups the same as those in the heart. Data are representative of three independent experiments (n = 3–5 per group, mean ± SD, ∗p < 0.05, ∗∗∗p < 0.001).These observations demonstrated that COX-2 inhibition may regulate myocardial macrophages and polarize splenic macrophages to improve cardiac hypertrophy and fibrosis during the early process of neonatal heart repair.
Celecoxib treatment improves cardiac function through inhibition of inflammation after CI
To evaluate the role of the anti-inflammatory agent celecoxib on the production of inflammatory stimuli after cardiac injury, we performed real-time PCR to identify pro-inflammatory mediators in the infarct/border zone at 4 weeks after injury (primers listed in Table 1). In the production of pro-inflammatory cytokines, the mRNA levels of TNF-α, IFN-γ, IL-6, IL-1β, IL-17, and IL-21, especially those of IL-6 and IL-1β, were reduced after celecoxib administration (Figure 7A). Interestingly, the expression of the anti-inflammatory cytokine IL-10 significantly reduced in P8 heart when treated with celecoxib (Figure 7A). In addition, the mRNA levels of MCP-1, VCAM-I, and ICAM-I significantly decreased at 4 weeks after injury when treated with celecoxib (Figure 7B).
Figure 7
Celecoxib improved cardiac function by inhibiting inflammatory response after injury
(A and B) (A) The mRNA levels of cytokines and (B) chemokines as well as adhesion molecular genes were measured by real-time PCR at 4 weeks after injury in DMSO treated- and celecoxib-treated P8 mice.
(C–F) (C and D) Internal diameters (LVID), posterior wall thickness (LVPW), and intraventricular septal thickness (IVS) at the end diastole (C) or at the end systole (D) of the left ventricle and end-diastolic/systolic volume (EDVs and ESVs) were analyzed by a digital ultrasound system (E) at 4 weeks following cryoinjury. (F) Ejection fraction (EF%) and fractional shortening (FS%) were measured by a digital ultrasound system, the same as that in (E). Data are representative of mean ± SD (n = 5 per group, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).
Celecoxib improved cardiac function by inhibiting inflammatory response after injury(A and B) (A) The mRNA levels of cytokines and (B) chemokines as well as adhesion molecular genes were measured by real-time PCR at 4 weeks after injury in DMSO treated- and celecoxib-treated P8 mice.(C–F) (C and D) Internal diameters (LVID), posterior wall thickness (LVPW), and intraventricular septal thickness (IVS) at the end diastole (C) or at the end systole (D) of the left ventricle and end-diastolic/systolic volume (EDVs and ESVs) were analyzed by a digital ultrasound system (E) at 4 weeks following cryoinjury. (F) Ejection fraction (EF%) and fractional shortening (FS%) were measured by a digital ultrasound system, the same as that in (E). Data are representative of mean ± SD (n = 5 per group, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001).Consequently, we evaluated the role of celecoxib treatment in cardiac function at 4 weeks after injury. Interestingly, the end-diastolic volumes (EDVs), end-systolic volumes (ESVs), and intraventricular septal thickness at the end diastole (IVSd) significantly decreased in the celecoxib-treated group compared with the DMSO-treated group at 4 weeks after injury (Figures 7C and 7D). Moreover, the posterior wall thickness at the systole of left ventricle (LVPWs) increased after injury (Figure 7D). Internal diameters at the end diastole/systole (LVIDd/s), posterior wall thickness at the end diastole (LVPWd), intraventricular septal thickness at the end systole (IVSs), ejection fraction (EF%), and fractional shortening (FS%) showed no significant differences between the celecoxib-treated mice and the DMSO-treated mice at 4 weeks after injury (Figures 7C–7F). Thus, short time of celecoxib administration would improve cardiac function after injury.
Discussion
Pathological cardiac hypertrophy is commonly induced by pathological stimuli and mechanical forces, resulting in cardiomyopathy death, and cardiac fibrosis. Accumulating evidence demonstrated that COX-2 is involved in cardiac hypertrophy and fibrosis (Chi et al., 2017; Li et al., 2014). Specific overexpression of COX-2 contributes to cardiac hypertrophy in mice, whereas COX-2 inhibition improves angiotensin- and aldosterone-induced hypertrophic response in vitro (Streicher et al., 2010; Wang et al., 2010). COX-2 expression triggers inflammatory response, cell apoptosis, and fibrosis after injury, which aggravate brain (Dehlaghi Jadid et al., 2019), renal (Fujihara et al., 2003), lung (Song et al., 2002), and skin (Romana-Souza et al., 2016) injuries. Overexpression of COX-2 is involved in vascular endothelial cell dysfunction and cardiac injury during inflammatory condition (Pang et al., 2016; Yin et al., 2017). The present study investigated whether or not selective COX-2 inhibition suppresses cardiac hypertrophy and fibrosis by mediating macrophages after injury or serves a regenerative function after injury in non-regenerative mice. We first demonstrated that hypertrophic response was only induced in non-regenerative mice compared with severe CI of regenerative mice. Although COX-2 expression was found in both groups after heart injury, the non-regenerative mice lost their regenerative capacity compared with the regenerative mice. In addition, the expression levels of pro-inflammatory cytokines (IL-6 and IL-1β), adhesion molecule genes (ICAM-I), and pro-fibrotic gene expression (TGF-β2) were significantly upregulated in non-regenerative mice. This result demonstrates that upregulated COX-2 expression could be a central mediator in immune response during cardiac hypertrophy and fibrosis after injury.Previous studies showed that selective COX-2 inhibitors exert a detrimental effect on cardiac vascular cells and heart after MI, contributing to reduced production of cardioprotective PGI2 and increased infarct size and mortality in high-dose celecoxib administration (Camitta et al., 2001; Timmers et al., 2007). Recent studies have demonstrated that selective COX-2 inhibitors with moderate-dose administration exert no detrimental effects on cardiovascular disease (Beales, 2020; Schjerning et al., 2020). Meanwhile, the infarct size of adult heart at the early stage of MI shows no significant changes in COX-2 knockout or inhibition with celecoxib compared with that in wild-type mice (Guo et al., 2000; Zhu et al., 2019). In a cardiac hypertrophyrat model, celecoxib inhibits inflammation and cardiac cell apoptosis after MI and subsequently improves pressure overload-induced cardiac hypertrophy in adult heart (Zhang et al., 2016). In neonatal CI model, we performed celecoxib treatment to non-regenerative mouse heart (P8) at the early stage of injury (D0, D1, and D2). Our data demonstrated that cardiac hypertrophy (HW/BW, and cardiomyocyte size) and fibrosis (fibrosis coverage [%]) significantly reduced at 4 weeks after injury in celecoxib administration. Meanwhile, hypertrophic (ANP, Myh7, and Acta1) and pro-fibrotic (TGF-β2 and TGFBR1) gene expression reduced in the treated group. These data suggest that celecoxib inhibited CI-induced cardiac hypertrophy and fibrosis in non-regenerative mice.Given its capacity to promote cardiac structure, inflammatory response plays a central mediator in cardiac remodeling after injury (Frangogiannis, 2015; Nahrendorf et al., 2010). Recent studies have suggested that celecoxib inhibits the recruited cell number of CD4+T cells, F/480+ macrophages, and neutrophils at wound sites (Geesala et al., 2017; Wilgus et al., 2003). As for macrophage function, M1-like macrophages promote pro-inflammatory response at the early stage of wound healing after injury, contributing to clear dead cells and necrotic debris at wound sites. Consequently, M2-like macrophages play an anti-inflammatory role in the late stage of wound healing by releasing cytokines, chemokines, and pro-fibrotic growth factors, thereby regulating scar formation for tissue repair (Braga et al., 2015; Simoes et al., 2020). More interestingly, mounting studies reported that macrophages improved heart regeneration or repair in neonatal heart after injury, but not in adult injured heart (Aurora et al., 2014; Lavine et al., 2014). This means that macrophages-mediated cardiac repair has different functions in neonates and adults because of developmental and immunological difference (Li et al., 2020). Meanwhile, other groups performed transversal aortic constriction (TAC) to induce adult cardiac hypertrophy, and celecoxib administration improved pressure overload-induced hypertrophic response and inflammation in adult injury model as well (Jacobshagen et al., 2008; Zhang et al., 2016). However, the infarct size of adult heart at 24 h after MI showed no significant changes in COX-2 knockout or celecoxib treatment compared with that in wild-type mice (Guo et al., 2000; Zhu et al., 2019). The difference would demonstrate that neonatal CI model could be an ideal model to evaluate the effect of celecoxib on cardiac hypertrophy and fibrosis.Also, accumulating studies showed that PGE2 would inhibit MCP-1 expression in vivo and in vitro (Largo et al., 2004; Schneider et al., 1999). In the present study, MCP-1 expression was significantly upregulated after celecoxib treatment at the early stage of injury but downregulated at the later stage of injury, which may contribute to macrophage recruitment via CCL2/MCP-1 signaling. In addition, the recruited number or percentage of M1-like macrophages increased in the celecoxib-treated group compared with the DMSO-treated group in the infarct/border zone at 7 days after injury, whereas that of M2-like macrophages showed no significant difference in both groups. However, polarization of M2-to-M1-like macrophages was detected in the spleen after celecoxib administration. In line with a previous study (Jürgensen et al., 2019), emerging data suggested that M1-like (F4/80+Ly6c+) macrophages have a higher capacity of collagen and fibrin uptake for tissue repair after injury compared with M2-like macrophages and that no significant reduction of M2-like macrophages can be observed. Taken together, our data demonstrated that celecoxib can inhibit cardiac hypertrophy and fibrosis in non-regenerative mice by regulating M1-like macrophage infiltration. COX-2 is inducible by other pathological stimuli after injury; thus the regulatory mechanism of COX-2 should be further investigated in immune response-mediated cardiac hypertrophy and fibrosis.
Limitations of the study
CI-induced cardiac hypertrophy has been observed in neonatal mice, and CI was performed to successfully establish cardiac hypertrophy in ICR neonatal mice. CI was only performed on ICR neonatal mice. Different injury models and mouse strains should be considered in future studies.
Resource availability
Lead contact
Yanli, Zhao, Assistant Research Fellow, Department of Medical Laboratory, Shenzhen Longhua District Central Hospital, Affiliated Central Hospital of Shenzhen Longhua District, Guangdong Medical University, Shenzhen, China, Email: yanlizhao2015@126.com.
Material availability
Requests for materials and reagents should be address to the lead contact, Yanli, Zhao, yanlizhao2015@126.com.
Data and code availability
Raw count data of RNA-seq were retrieved from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo) under the accession no. GSE123868 (Wang et al., 2019b).
Methods
All methods can be found in the accompanying Transparent Methods supplemental file.