Literature DB >> 33732375

Curcumol inhibits the viability and invasion of colorectal cancer cells via miR-30a-5p and Hippo signaling pathway.

Dan Yu1, Haiping Liu2, Jianli Qin1, Mengjie Huangfu1, Xiao Guan3, Xumei Li1, Luwei Zhou1, Tong Dou1, Yisa Liu1, Lin Wang1, Minglei Fu4, Juan Wang1,5,6,7, Xu Chen1.   

Abstract

MicroRNA-30a-5p (miR-30a-5p), which functions as a tumor suppressor, has been reported to be downregulated in colorectal cancer (CRC) tissues and to be associated with cancer invasion. However, the detailed regulatory mechanism of curcumol in the malignant progression of CRC remains unknown. MTT, Transwell, scratch, western blotting and reverse transcription-quantitative PCR assays were performed to examine how curcumol inhibited CRC cell viability, invasion and migration, and to detect the role of miR-30a-5p and curcumol in the invasion and Hippo signaling pathways of CRC cells. The present study revealed that miR-30a-5p expression was downregulated in human CRC tissues and cells. The results demonstrated that miR-30a-5p downregulation was accompanied by the inactivation of the Hippo signaling pathway, which was demonstrated to promote CRC cell viability, invasion and migration. Curcumol treatment was identified to increase miR-30a-5p expression and to activate the Hippo signaling pathway, which in turn inhibited the invasion and migration of CRC cells. Overexpression of miR-30a-5p enhanced the effects of curcumol on cell invasion and migration, and the Hippo signaling pathway in CRC cells. Furthermore, downregulation of miR-30a-5p reversed the effects of curcumol on cell invasion and migration, and the Hippo signaling pathway in CRC cells. These findings identified novel signaling pathways associated with miR-30a-5p and revealed the effects of curcumol on miR-30a-5p expression. Therefore, curcumol may serve as a potential therapeutic strategy to delay CRC progression. Copyright: © Yu et al.

Entities:  

Keywords:  Hippo; colorectal cancer; curcumol; invasion; microRNA-30a-5p; viability

Year:  2021        PMID: 33732375      PMCID: PMC7905558          DOI: 10.3892/ol.2021.12560

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Colorectal cancer (CRC) is a common gastrointestinal tumor in China (1). CRC was the third most widely diagnosed cancer and had the second highest mortality among cancer types worldwide in 2018 (2). Low survival rates, poor surgical prognosis and the emergence of drug resistance have resulted in unsatisfactory clinical outcomes. The invasion of CRC is one of the main reasons for its high mortality and poor prognosis (3). Furthermore, ~90% of CRC-associated deaths are associated with distant invasion (4). There is no specific treatment to restrain the invasion, which indicates the importance of identifying novel molecular mechanisms driving these processes. Therefore, identifying novel therapeutic strategies and novel target molecules for the invasion of CRC remains important. MicroRNAs (miRNAs/miRs) are a class of non-coding single-stranded small-molecule RNAs that degrade target gene expression via binding to the 3′-untranslated region. It has been reported that numerous miRNAs, including the miR-30 family, serve important roles in the regulation of cancer cell migration and invasion (5–7). It has been reported that miR-30a-5p expression is decreased in primary gallbladder cancer (GBC) lesions, and inhibition of its expression in GBC cells promoted migration and invasion (8). Wang et al (9) reported that miR-30a-5p upregulation can inhibit ovarian cancer epithelial-mesenchymal transition (EMT) and invasion. In addition, miR-30a-5p expression is downregulated in CRC lesions and suppresses CRC invasion via the inhibition of integrin β-3 (ITGB3) (10), suggesting that miR-30a-5p may be a promising target for the treatment of CRC. Yes-associated protein (YAP), which is a crucial downstream effector of the Hippo signaling pathway, has also been demonstrated to be involved in the EMT process (11,12). Furthermore, it has been demonstrated that dysregulation of the Hippo-YAP signaling pathway is associated with EMT and cancer progression mainly driven by YAP (12,13). Therefore, YAP-mediated EMT is considered to be a critical therapeutic target to inhibit YAP-promoted tumor invasion, and YAP may be a promising target for the treatment of CRC. Curcumol is extracted from the traditional Chinese medicine Rhizoma curcumae, which has been reported to possess multiple pharmacological bioactivities, including antioxidant, anti-inflammatory, antifibrosis, antimicrobial and antitumor activities (14–16). It has been demonstrated that curcumol exerts antitumor effects against multiple types of cancer, including gastric cancer (17), cholangiocarcinoma (18), nasopharyngeal carcinoma (19) and colorectal carcinoma (20). Our previous studies revealed that curcumol inhibits CRC cell proliferation and induces apoptosis via the p38 MAPK and PI3K/Akt signaling pathways (21,22). However, to the best of our knowledge, the specific mechanism of curcumol-inhibited CRC cell invasion has not been clearly elucidated. The present study examined the effects of curcumol on miR-30a-5p and the YAP signaling pathway, and revealed its possible mechanisms of CRC cell invasion inhibition.

Materials and methods

Reagents and cell lines

RPMI-1640, DMEM, Opti-MEM I Reduced Serum medium and FBS were purchased from Gibco; Thermo Fisher Scientific, Inc. MTT and DMSO were purchased from Amresco, LLC. All-in-One miRNA Detection kit was purchased from GeneCopoeia, Inc. TRNzol Universal RNA Reagent was purchased from Tiangen Biotech Co., Ltd. GoScript™ Reverse Transcriptase was purchased from Promega Corporation. UltraSYBR Mixture was purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd. Lipofectamine™ 3000 transfection reagent was purchased from Invitrogen; Thermo Fisher Scientific, Inc. pPLK/GFP+ Puro-hsa-miR-30a-5p sponge (miR-30a-5p-sp) and its negative control (NC) were purchased from Yipu Biotechnology. Hsa-miR-30a-5p-mimic and its NC were purchased from Shanghai Integrated Biotech Solutions Co., Ltd. SW480 human CRC cell lines were obtained from Xiangya Medical College of Central South University (Changsha, China) and stored at our laboratory (Key Laboratory of Pharmacognosy, Guilin Medical University, Guilin, China). The HCT116 and SW620 human CRC cell lines were purchased from American Type Culture Collection. The HCoEpiC human normal colorectal cell line was purchased from Jennio Biotech Co., Ltd..

Study samples

CRC tissues and matched tumor-adjacent tissues were obtained from patients with CRC at the First Affiliated Hospital of Guilin Medical College (Guilin, China). These samples were collected between February 2016 and August 2016. The age under 49 years old (17.65%), the age between 50–69 years old (66.17%), the age over 70 years old (16.18%). There were 36.76% male patients and 63.24% female patients. The inclusion criteria was that patients diagnosed with colon cancer. The inclusion criteria was that patients without drug intervention. The corresponding adjacent tissues were obtained ≥2 cm apart from the cancerous node. It was determined that the patients did not receive any preoperative treatment. All tissues were quickly frozen in liquid nitrogen and stored at −80°C until use. All samples were studied with the written consent of the patient and approval from Guilin Medical College Ethics Committee (Guilin, China).

Xenograft assays

BALB/c athymic nude mice (male; weight, ~20 g; n=10 mice) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd, and were housed under standard laboratory conditions. HCT116 cells (1×107) suspended in 200 µl sterile PBS were injected subcutaneously into the right flank of 5-week-old BALB/c nude mice. After 2 weeks, when the tumor size reached ~100 mm3, the mice were randomly divided into two groups (5 mice in each group). Curcumol was dissolved in 90% propylene glycol, and the mode of administration was intragastric. The maximal tumor volume allowed in in vivo experiments was ~900 mm3. The room temperature was 26–28°C, the relative humidity was maintained at 40–60% and a 14-h light/10-h dark cycle was used. The food and drinking water required by nude mice was autoclaved (45 min; 120°C). Commercial mice diet-pellets and water were available to mice ad libitum. After 3 weeks of treatment, mice were sacrificed by cervical dislocation at room temperature. The time interval between injection and final tumor growth measurement and/or the end of the experiment was 5 weeks. The dose of sodium pentobarbital anesthesia was calculated according to body weight. All operations were performed under sodium pentobarbital anesthesia and intraperitoneal administration was selected. All efforts were made to minimize suffering. The tumor issues were collected in a 1.5 ml Eppendorf tube and stored at −80°C until further use. The present study was approved by the Committee on the Ethics of Animal Experiments of Guilin Medical College (Guilin, China).

Curcumol preparation

Curcumol was purchased from Guizhou Dida Technology Co., Ltd.. The storage solution of curcumol was prepared as 20 mg curcumol dissolved in 1 ml anhydrous ethanol as the original solution, and this was then diluted to the desired concentration. Curcumol solution was stored at −4°C.

Cell culture

Human CRC cell lines (HCT116, SW480 and SW620) were cultured in RPMI-1640 medium with 10% FBS, 100 U/ml penicillin and streptomycin. The HCoEpiC human normal colorectal cell line was cultured in MEM with 10% FBS, 100 U/ml penicillin and streptomycin. The cells were washed with 1X PBS and digested with 0.25% trypsin. The cells were cultured in an incubator at 37°C with 5% CO2. The cells were routinely passaged 3–4 times a week, and after cells were completely adherent to the dishes, cells were treated with curcumol for 48 h in an incubator at 37°C with 5% CO2 for subsequent experiments. The remaining cell lines were stored at −80°C.

Plasmid construction, stable transfection and cell transfection

miR-30a-5p-sp and its NC were purchased from Yipu Biotechnology. miR-30a-5p-sp (1.215 µg) plasmid was used to knock down the expression of miR-30a-5p, and miR-30a-5p-sp is an inhibitor of miR-30a-5p. miR-30a-5p-sp (1.215 µg) plasmid was transfected into HCT116 cells, and the duration of transfection was 48 h. Subsequently, 1×107 HCT1116 cells transfected with miR-30a-5p sponge or NC were collected. The multiplicity of infection used to infect cells was 5. miR-30a-5p mimic was used to overexpress miR-30a-5p. miR-30a-5p-sp plasmid (50 ng/µl) was amplified using the endotoxin-free medium extraction kit, and agarose gel electrophoresis (1%) was used to detect miR-30a-5p amplification. The amplified plasmids were packaged into 293T cells (American Type Culture Collection) using Lipofectamine® 3000 (7.5 µl) and P3000 (5 µl) reagents at 37°C with 5% CO2. A second generation lentivirus packaging system was used. The ratio of PMD2.G:PSPAx2:miR-30a-5p-sp or NC (1.215 µg) was 1:2:2. The liquid was changed 6 h later. The supernatant was collected after 24 h. The supernatant was obtained by centrifugation, and the centrifugation conditions were 2,500 × g for 3 min at room temperature. The 293T cells were cultured in DMEM with 10% FBS and 100 U/ml penicillin and streptomycin. The cells were washed with 1X PBS and digested with 0.25% trypsin. The cells were cultured in an incubator at 37°C with 5% CO2. The cells were routinely passaged 3–4 times a week. HCT116 cells were transfected with miR-30a-5p-sp for 5 h and subsequently placed in fresh medium for 12 h at 37°C with 5% CO2. The fluorescence of miR-30a-5p-sp and its NC was observed following transfection for 24 h to confirm successful transfection. The sequence of short hairpin RNA targeting miR-30a-5p-sp was as follows: 5′-CTTCCAGTCGCCTTGTTTACA-3′. Empty vector (miR-30a-5p-sp-NC) was transfected into HCT116 cells, in which no gene sequence was inserted. miR-30a-5p mimic (20 µM) was transfected into HCT116 cells using Lipofectamine® 3000 reagent. The duration of transfection was 48 h. The miR-30a-5p mimic sequence was as follows: Sense, 5′-UGUAAACAUCCUCGACUGGAAG-3′ and anti-sense, 5′-CUUCCAGUCGAGGAUGUUUACA-3′. The mimics NC sequence was as follows: Sense, 5′-UCACAACCUCCUAGAAAGAGUAGA-3′ and anti-sense, 5′-UACUCUUUCUAGGAGGUUGUGAUU-3′. The cells were cultured for another 48 h and harvested for subsequent experiments.

MTT analysis

HCT116 cells were cultured in 96-well plates at a density of 3×103 cells/well and treated with various concentrations of curcumol (0, 10, 20, 40, 80, 100, 120 and 160 µg/ml) at 37°C. After 24, 48 and 72 h, 20 µl MTT solution was added, and the cells were cultured for another 4 h in an incubator at 37°C with 5% CO2. A total of 150 µl DMSO was added once the cell suspension was removed. The absorbance values were measured at a wavelength of 490 nm using a microplate reader. The optical density values were used to calculate the IC50. The experiment was performed in triplicate.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from tissues and cells using TRNzol Universal RNA Reagent (Tiangen Biotech Co., Ltd.) according to the manufacturer's protocol. The 260/280 values ranged between 1.8 and 2.2. A total of 2 µg total RNA was reverse transcribed into cDNA using a GoScript™ Reverse Transcription Mix at 42°C for 20 min and 90°C for 5 min. The fluorophore was SYBR Green (CoWin Biosciences). The thermocycling conditions were as follows: 95°C for 30 sec, 40 cycles of 95°C for 5 sec and 60°C for 30 sec, followed by 95°C for 15 sec, 60°C for 1 min, 95°C for 15 sec and 50°C for 30 sec. This protocol was used for E-cadherin, β-catenin, MMP2, LATS1, MST-1, YAP1 and GAPDH. The primers were purchased from Invitrogen; Thermo Fisher Scientific, Inc.). The primer sequences are presented in Table I. A total of 2 µg total RNA was reverse transcribed using the All-in-One miRNA Detection kit at 37°C for 1 h and 85°C for 5 min, and the thermocycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 1 min. This protocol was used for miR-30a-5p. RT-qPCR was performed using the Applied Biosystems 7500 Fast RT-PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). U6 was used as the internal control to normalize miR-30a-5p expression. The sequences of the U6 primers were as follows: Forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′. The hsa-miR-30a-5p primer was purchased from GeneCopoeia, Inc. The relative expression levels of miR-30a-5p were calculated using the 2−ΔΔCq method (23). The experiments were performed in biological triplicates.
Table I.

Sequences of forward and reverse primers used in reverse transcription-quantitative PCR.

GeneSequences (5′-3′)
E-cadherinF: CACCCGGGACAACGTTTATTA
R: AGCTGGCTCAAGTCAAAGTC
β-cateninF: CTGCCAAGTGGGTGGTATAG
R: CAGATGACGAAGAGCACAGAT
MMP2F: GGCACCCATTTACACCTACA
R: CCAAGGTCAATGTCAGGAGAG
LATS1F: ATCTCCCGAATCTCTCCTGT
R: AATGCCTCTCTGTCCTTGATTAG
MST-1F: GAGACCAAAGGTACGGGTAATG
R: GTCCTCGGTGCTTGATGTT
YAP1F: AGCATCTTCGACAGTCTTCTTT
R: GTTGTTGTCTGATCGATGTGATTT
GAPDHF: TGCACCACCAACTGCTTAGC
R: GGCATGGACTGTGGTCATGAG

YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; F, forward, R, reverse.

Western blotting

Protein was extracted from tissues/cells using RIPA lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.) containing 2 µg/ml aprotinin, 5 µg/ml leupeptin, 1 µg/ml pepstatin, 1 mol/l dithiothreitol and 1 mol/l PMSF. The lysates were centrifuged at 13,400 × g for 20 min at 4°C. Protein concentrations were determined using a BCA assay. Proteins (30 µg/lane) of different molecular weights were separated using 10% SDS-PAGE. Protein was then transferred to PVDF membranes. The membranes were incubated with 5% skim milk for 2 h at room temperature. Membranes were incubated with primary antibodies against large tumor suppressor kinase 1 (LATS1; dilution, 1:1,000; cat. no. ab243656; Abcam), YAP1 and phosphorylated (p)-YAP1 (dilution, 1:1,000; cat. nos. ab52771 and ab76252; Abcam), E-cadherin (dilution, 1:2,000; cat. no. #3195; Cell Signaling Technology, Inc.), β-catenin (dilution, 1:2,000; cat. no. #8480; Cell Signaling Technology, Inc.), mammalian STE20-like protein kinase (MST-1; dilution, 1:2,000; cat. no. #DF7691; Affinity Biosciences), MMP2 (dilution, 1:1,000; cat. no. 10373-2-AP; ProteinTech Group, Inc.) and GAPDH (dilution, 1:2,000; cat. no. TA-08; OriGene Technologies, Inc.) overnight at 4°C, followed by incubation with horseradish peroxidase-labeled anti-mouse (dilution, 1:4,000; cat. no. EM35110-01; Beijing Emarbio Science & Technology Co., Ltd.) or anti-rabbit secondary antibodies (dilution, 1:4,000; cat. no. 31460; Thermo Fisher Scientific, Inc.) for 1 h at 37°C. Protein signals were detected with an enhanced chemiluminescence reagent (Bio-Rad Laboratories, Inc.) on the ChemiDoc XRS+ instrument (Bio-Rad Laboratories, Inc.). The results were measured using Gel-pro Analyzer 32 software (version 4.0; Media Cybernetics, Inc.).

Transwell assay

Matrigel matrix (BD Biosciences) was melted in a 4°C refrigerator in advance, and diluted in RPMI-1640 medium at a ratio of 1:6. A total of 50 µl matrix was added to the upper Transwell chamber of 24-well transwell chamber inserts (BD Biosciences) at 37°C for 4 h. HCT116 cell density was adjusted to 3×105 per 200 µl RPMI-1640 medium and plated in the upper chamber at 37°C with 5% CO2 for 48 h. A total of 600 µl RPMI-1640 medium supplemented with 10% FBS was plated in lower chamber at 37°C with 5% CO2. After 48 h, the Matrigel matrix was removed and fixed in 4% paraformaldehyde for 30 min at room temperature, and stained with 0.1% crystal violet at 37°C for 20 min. PBS was used to wash the Transwell chamber. Subsequently, cell invasion was observed under a light microscope (magnification, ×100). Invasion of cells at 48 h was calculated using ImageJ1.50i software (National Institutes of Health) using the following formula: Relative invasion rate (%)=(cell penetration/3×105) ×100. Three independent experiments were performed, and the data are presented as the mean ± SD.

Scratch assay

Curcumol-treated HCT116 cells were inoculated in a six-well plate. The cells were serum-starved for this assay to avoid the effects of cell viability. When the cells had grown to fuse into a monolayer, the cells were scratched with a 200-µl pipette tip perpendicular to the bottom of the well and washed with PBS twice to remove the remaining cells. HCT116 cells were cultured in RPMI-1640 medium at 37°C with curcumol for 48 h. Images were captured at 0, 24 and 48 h, where 0 h was recorded as the starting time point. The width of the scratch was observed and recorded under a light microscope (magnification, ×40). The image was processed using ImageJ1.50i software (National Institutes of Health) and the proportion of relative wound closure was calculated. The following formula was used: Change rate of scratch area (%)=(0 h scratch area-24 h scratch area)/0 h scratch area ×100.

Statistical analysis

All statistical analyses were performed using SPSS Statistics 22 software (IBM Corp.). Data are presented as the mean ± SD. The unpaired t-test was used to analyze two independent groups. The paired t-test was used to analyze the data in Fig. 1A and D. One-way ANOVA followed by Bonferroni and LSD was used to assess statistical significance for multiple comparisons. All experiments were repeated in triplicate. P<0.05 was considered to indicate a statistically significant difference.
Figure 1.

miR-30a-5p expression and Hippo signaling pathway activity in CRC tissue samples. miR-30a-5p expression in (A) six pairs of CRC and paracancerous tissues, and (B) CRC cell lines was analyzed by RT-qPCR. (C) Expression levels of epithelial-mesenchymal transition, MMP2 and Hippo signaling pathway-associated proteins in three pairs of CRC and paracancerous tissues were analyzed by western blotting. (D) Semi-quantitative analysis of the results of western blotting. RT-qPCR and western blotting data are presented as the mean ± standard deviation of three independent experiments. *P<0.05 and **P<0.01 vs. control (normal or HCoEpic). miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; CRC, colorectal cancer; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; YAP1, Yes-associated protein; p, phosphorylated; N, normal tissue; T, tumor tissue.

Results

miR-30a-5p expression and activation of the Hippo signaling pathway in CRC tissue samples

Six pairs of CRC tissues and paracancerous tissues were collected from the First Affiliated Hospital of Guilin Medical College. miR-30a-5p expression in CRC tissues and adjacent tissues that were collected clinically was detected by RT-qPCR. The present study used a paired t-test to analyze two groups. miR-30a-5p expression was lower in CRC tissues compared with in paracancerous tissues (Fig. 1A). Subsequently, miR-30a-5p expression was examined in HCoEpic, HCT116, SW480 and SW620 cells. miR-30a-5p expression in HCoEpic cells was the highest among these cell lines. miR-30a-5p expression was second highest in HCT116 cells (Fig. 1B). Additionally, the study used a paired t-test to compare the CRC tissues group and the adjacent tissues group. The expression levels of β-catenin and MMP2 were increased, whereas the expression levels of E-cadherin were decreased in the tumor tissues. The expression levels of MST-1, LATS1 and p-YAP1, which are key factors of the Hippo signaling pathway, were decreased in CRC tissues, while YAP1 expression was increased according to western blot analysis (Fig. 1C and D).

Curcumol inhibits HCT116 cell viability and invasion

The MTT assay demonstrated that curcumol inhibited the viability of HCT116 cells in a dose- and time-dependent manner (Fig. 2A), as previously reported (21). miR-30a-5p expression was upregulated as curcumol concentration increased (Fig. 2B). Following treatment of HCT116 cells with curcumol (0, 50 and 100 µg/ml) for 0, 24 and 48 h, Scratch assays revealed that with the increase of curcumol concentration, the migration ability of HCT116 cells was inhibited, and the cells exhibited a significant difference at 48 h compared with 24 h (Fig. 2C and D). Transwell assays revealed that with the increase in curcumol concentration, the invasion ability of HCT116 cells was inhibited (Fig. 2E and F). Western blotting demonstrated that YAP1, β-catenin and MMP2 expression was inhibited by curcumol, while the expression levels of E-cadherin, MST-1, LATS1 and p-YAP1 in HCT116 cells were increased following curcumol treatment (Fig. 2G and H). Therefore, these data suggested that curcumol inhibited HCT116 cell viability, invasion and migration, upregulated miR-30a-5p expression and activated the Hippo signaling pathway.
Figure 2.

Curcumol inhibits viability, invasion and migration by targeting miR-30a-5p. (A) Curcumol inhibited HCT116 cell viability. (B) Reverse transcription-quantitative PCR was performed and revealed that miR-30a-5p expression was increased by curcumol treatment. (C) Scratch experiments revealed that curcumol inhibited the migration of HCT116 cells (magnification, ×40). (D) Quantitative histogram of the results of the scratch experiments. (E) Transwell experiments revealed that curcumol inhibited the invasion of HCT116 cells (magnification, ×100). (F) Quantitative histogram of the results of the Transwell experiments. (G) Expression levels of YAP1, β-catenin, MMP2, E-cadherin, MST-1, LATS1 and p-YAP1 were regulated by curcumol in HCT116 cells. (H) Semi-quantitative analysis of the results of western blotting. *P<0.05 and **P<0.01 vs. control (no curcumol group). miR, microRNA; YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; p, phosphorylated.

Effects of miR-30a-5p on CRC cell invasion and the Hippo signaling pathway in CRC cells

To further determine the effects of miR-30a-5p on CRC cell invasion and the association with the Hippo signaling pathway, HCT116 cells were transfected with miR-30a-5p-sp and miR-30a-5p mimics. The MTT assay demonstrated that miR-30a-5p-sp promoted HCT116 cell viability, while miR-30a-5p mimics inhibited their viability (Fig. 3A). RT-qPCR demonstrated that miR-30a-5p-sp and mimics were successfully transfected into HCT116 cells (Fig. 3B). Scratch assays revealed that miR-30a-5p-sp promoted HCT116 cell migration, while miR-30a-5p mimics inhibited their migration, and there was a significant difference at 48 h compared with 24 h (Fig. 3C and D). Transwell assay demonstrated that miR-30a-5p-sp promoted HCT116 cells invasion, while miR-30a-5p mimics inhibited their invasion (Fig. 3E and F). When miR-30a-5p-sp was transfected into HCT116 cells, the expression levels of YAP1, β-catenin and MMP2 were increased, and the expression levels of E-cadherin, MST-1, LATS1 and p-YAP1 were decreased. However, when the expression levels of miR-30a-5p were upregulated, YAP1, β-catenin and MMP2 expression was decreased, and the expression levels of E-cadherin, MST-1, LATS1 and p-YAP1 were increased in HCT116 cells transfected with miR-30a-5p mimics (Fig. 3G and H).
Figure 3.

Effects of miR-30a-5p on the Hippo and epithelial-mesenchymal transition signaling pathways in HCT116 cells. (A) HCT116 cell viability was analyzed following transfection with miR-30a-5p mimics and miR-30a-5p-sp. (B) Reverse transcription-quantitative PCR revealed that miR-30a-5p expression was markedly increased by miR-30a-5p mimics and reduced by miR-30a-5p-sp in HCT116 cells. The control group were untransfected cells, which are HCT116 cells. (C) Scratch experiments revealed that miR-30a-5p inhibited HCT116 cell migration (magnification, ×40). (D) Quantitative histogram of the results of scratch experiments. (E) Transwell experiments revealed that miR-30a-5p inhibited HCT116 cell invasion (magnification, ×100). (F) Quantitative histogram of the results of Transwell experiments. (G) Expression levels of YAP1, β-catenin, MMP2, E-cadherin, MST-1, LATS1 and p-YAP1 were altered by miR-30a-5p mimic transfection in HCT116 cells. (H) Semi-quantitative analysis of the results of western blotting. *P<0.05 and **P<0.01 vs. control (HCT116 cells) or 24 h in (D); ##P<0.01, significantly different from the miR-30a-5p-sp group. miR, microRNA; YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; p, phosphorylated; sp, sponge.

miR-30a-5p overexpression enhances the inhibitory effects of curcumol on invasion and the Hippo signaling pathway in HCT116 cells

To investigate the association between curcumol and miR-30a-5p, the present study first overexpressed miR-30a-5p and then analyzed the inhibitory effect of curcumol on invasion and migration in HCT116 cells. MTT assays demonstrated that miR-30a-5p mimics and curcumol (50 µg/ml) inhibited HCT116 cell viability. Following treatment with both miR-30a-5p mimics and curcumol simultaneously, HCT116 cell viability was significantly inhibited compared with treatment with miR-30a-5p mimics alone (Fig. 4A). RT-qPCR revealed that miR-30a-5p expression was upregulated after treatment with miR-30a-5p mimics or curcumol alone. The expression levels of miR-30a-5p were higher following treatment with both miR-30a-5p mimics and curcumol (Fig. 4B). Scratch assays demonstrated that miR-30a-5p mimics and curcumol (50 µg/ml) inhibited HCT116 cell migration, following treatment with both miR-30a-5p mimics and curcumol simultaneously, HCT116 cell migration was more inhibited compared with miR-30a-5p mimics and curcumol (50 µg/ml) alone, and HCT116 cell migration was increased at 48 h compared with 24 h (Fig. 4C and D). Transwell assays demonstrated that miR-30a-5p mimics and curcumol (50 µg/ml) inhibited HCT116 cell invasion. Following treatment with both miR-30a-5p mimics and curcumol simultaneously, HCT116 cell invasion was significantly inhibited compared with that of cells treated with miR-30a-5p mimics alone (Fig. 4E and F). Western blotting demonstrated that when miR-30a-5p mimics were transfected into HCT116 cells, the expression levels of YAP1, β-catenin and MMP2 were decreased, and the levels of E-cadherin, MST-1, LATS1 and p-YAP1 were increased. miR-30a-5p mimics increased the inhibitory effect of curcumol (50 µg/ml) on the expression levels of YAP1, β-catenin and MMP2, and increased the promoting effects of curcumol on the expression levels of E-cadherin, MST-1, LATS1 and p-YAP1 in HCT116 cells, and the difference between curcumol and no curcumol in cells treated with miR-30a-5p mimics was significant (Fig. 4G and H). The results indicated that the effect of curcumol on CRC cell invasion and the Hippo signaling pathway was associated with miR-30a-5p upregulation.
Figure 4.

miR-30a-5p enhances the inhibitory effects of curcumol on the Hippo and epithelial-mesenchymal transition signaling pathways in HCT116 cells. (A) HCT116 cell viability was decreased in curcumol- and miR-30a-5p mimic-treated groups. (B) miR-30a-5p expression was increased in curcumol- and miR-30a-5p-mimic-treated groups. (C) Scratch experiments revealed that curcumol inhibited the migration of HCT116 cells by upregulating miR-30a-5p (magnification, ×40). (D) Quantitative histogram of the results of scratch experiments. (E) Transwell experiments revealed that curcumol inhibited the invasion of HCT116 cells by upregulating miR-30a-5p (magnification, ×100). (F) Quantitative histogram of the results of Transwell experiments. (G) Expression levels of YAP1, β-catenin, MMP2, E-cadherin, MST-1, LATS1 and p-YAP1 in HCT116 cells following treatment with curcumol and miR-30a-5p mimics were detected by western blotting. (H) Semi-quantitative analysis of the results of western blotting. **P<0.01 vs. control (miR-30a-5p mimics-NC) or 24 h in (D); ##P<0.01. miR, microRNA; YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; p, phosphorylated.

Downregulation of miR-30a-5p reverses the effects of curcumol on invasion and the Hippo signaling pathway

In addition to overexpressing miR-30a-5p in HCT116 cells, the present study also inhibited its expression in HCT116 cells and observed whether the effects of curcumol on the invasion and migration of HCT116 cells were altered. MTT assays demonstrated that curcumol (50 µg/ml) inhibited HCT116 cell viability, and miR-30a-5p-sp promoted HCT116 cell viability. Following treatment with both miR-30a-5p-sp and curcumol simultaneously, HCT116 cell viability was significantly inhibited compared with that in the group treated with miR-30a-5p-sp alone (Fig. 5A). RT-qPCR revealed that the expression levels of miR-30a-5p were downregulated following treatment with miR-30a-5p-sp. The expression levels of miR-30a-5p were upregulated following treatment with curcumol (50 µg/ml). When miR-30a-5p-sp and curcumol (50 µg/ml) were used simultaneously, the expression levels of miR-30a-5p were higher than in the group treated with miR-30a-5p-sp alone (Fig. 5B). Scratch assays demonstrated that miR-30a-5p-sp promoted HCT116 cell migration, while curcumol (50 µg/ml) inhibited HCT116 cell migration. Following treatment with both miR-30a-5p-sp and curcumol simultaneously, HCT116 cell migration was inhibited compared with that of the miR-30a-5p-sp group, and HCT116 cell migration was increased at 48 h compared with 24 h (Fig. 5C and D). Transwell assays demonstrated that miR-30a-5p-sp promoted HCT116 cell invasion, while curcumol (50 µg/ml) inhibited HCT116 cell invasion. Following treatment with both miR-30a-5p-sp and curcumol simultaneously, HCT116 cell invasion was inhibited compared with that of the miR-30a-5p-sp group (Fig. 5E and F). Western blotting demonstrated that when miR-30a-5p-sp was transfected into HCT116 cells, the expression levels of YAP1, β-catenin and MMP2 were increased, and the levels of E-cadherin, MST-1, LATS1 and p-YAP1 were decreased. However, curcumol treatment decreased the expression levels of YAP1, β-catenin and MMP2, and increased the levels of E-cadherin, MST-1, LATS1 and p-YAP1. Following treatment with both miR-30a-5p-sp and curcumol simultaneously, YAP1, β-catenin and MMP2 expression was decreased, while the levels of E-cadherin, MST-1, LATS1 and p-YAP1 in HCT116 cells were increased compared with those in the group treated with miR-30a-5p-sp alone (Fig. 5G and H).
Figure 5.

Downregulation of miR-30a-5p reverses the effects of curcumol on CRC cell epithelial-mesenchymal transition and the Hippo signaling pathway. (A) HCT116 cell viability was analyzed using an MTT assay following treatment with curcumol and/or miR-30a-5p-sp. (B) Reverse transcription-quantitative PCR was performed to detect miR-30a-5p expression in HCT116 cells treated with curcumol and/or miR-30a-5p-sp. (C) Scratch experiments revealed that the inhibitory effects of curcumol on migration were decreased in HCT116 cells following downregulation of miR-30a-5p (magnification, ×40). (D) Quantitative histogram of the results of scratch experiments. (E) Transwell experiments revealed that the inhibitory effects of curcumol on invasion were decreased in HCT116 cells following downregulation of miR-30a-5p (magnification, ×100). (F) Quantitative histogram of the results of Transwell experiments. (G) Expression levels of YAP1, β-catenin, MMP2, E-cadherin, MST-1, LATS1 and p-YAP1 in HCT116 cells were detected by western blotting following treatment with curcumol and/or miR-30a-5p-sp. (H) Semi-quantitative analysis of the results of western blotting. *P<0.05 and **P<0.01 vs. control (miR-30a-5p-sp NC) or 24 h in (D); ##P<0.01. miR, microRNA; YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; p, phosphorylated; sp, sponge.

Curcumol can regulate the expression levels of miR-30a-5p and the Hippo signaling pathway in vivo

A xenograft tumor model of CRC was established. RT-qPCR revealed that curcumol (40 µg/ml) treatment increased miR-30a-5p expression, increased the expression levels of E-cadherin, MST-1, LATS1 and p-YAP1, and inhibited YAP1, β-catenin and MMP2 expression (Fig. 6).
Figure 6.

Curcumol can regulate the expression levels of miR-30a-5p and the Hippo signaling pathway in vivo. (A) Curcumol treatment increased the expression levels of miR-30a-5p. (B) Curcumol increased the expression levels of E-cadherin, MST-1 and LATS1, and inhibited YAP1, β-catenin and MMP2 expression. *P<0.05 and **P<0.01 vs. NC. miR, microRNA; YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; NC, negative control.

Discussion

CRC is a common gastrointestinal tumor with high invasion rates, which causes significant mortality (24,25). Therefore, it is urgent to identify novel treatments and to explore effective therapeutic targets for CRC invasion. Increasing numbers of non-coding RNAs have been identified as CRC prognostic biomarkers and novel therapeutic targets (26–28). Increasing evidence has indicated that miRNA expression is abnormal in various types of cancer, and that miRNAs act as tumor suppressors or promoters (29,30). It has been demonstrated that miR-30a-5p expression is decreased in a number of cancer types and may be a novel potential prognostic biomarker or molecular therapeutic target for GBC and CRC (8,31). Although miR-30a-5p has been demonstrated to be a tumor suppressor, and suppresses CRC cell migration and invasion by targeting ITGB3 and may be a promising therapeutic target for CRC (10), few drugs, particularly natural drugs, have been reported to inhibit CRC cell invasion by increasing its expression. The present study investigated the potential effects of curcumol on miR-30a-5p expression, and CRC cell migration and invasion. It was demonstrated that curcumol increased miR-30a-5p expression in CRC cells, and overexpression of miR-30a-5p enhanced the effects of curcumol on CRC cell migration and invasion, while downregulation of miR-30a-5p reversed its effects on CRC cells. In addition, the present study revealed the association between miR-30a-5p and the Hippo signaling pathway. The Hippo signaling pathway is dysregulated in numerous types of cancer, including CRC (32–34). Its inactivation is associated with CRC progression (35–37). YAP is a major effector in the Hippo signaling pathway and p-YAP exists in the cytoplasm. When the Hippo signaling pathway is activated, YAP remains in the cytoplasm in the phosphorylated form, and YAP mediates the expression of multiple downstream genes to control tissue development and progress (38). It has been demonstrated that the EMT signaling pathway can be regulated by YAP (39). When the EMT process is activated, the expression of epithelial marker E-cadherin, which serves a key role in attachment, is inhibited (40), whereas β-catenin, a mesenchymal protein marker, is activated (41,42). The EMT signaling pathway is further complicated by interactions with matrix metalloproteinases. Among these complex interactions, MMP2 and other MMPs have been demonstrated to promote EMT, which is involved in cancer invasion (43,44). The present study revealed that increased miR-30a-5p expression following curcumol treatment inhibited CRC cell invasion, migration and MMP2 expression, and activated the Hippo signaling pathway. In addition, overexpression of miR-30a-5p activated the Hippo signaling pathway and enhanced the effect of curcumol on its downstream factors, such as MST-1, LATS1 and YAP1. Furthermore, downregulation of miR-30a-5p expression inhibited the activation of the Hippo signaling pathway and reversed the stimulatory effects of curcumol on this signaling pathway (Fig. 7).
Figure 7.

Experimental framework. Curcumol treatment increased miR-30a-5p expression, promoted the expression of E-cadherin, activated the Hippo signaling pathway, and inhibited β-catenin and MMP2 expression. miR, microRNA; YAP1, Yes-associated protein; MST-1, mammalian STE20-like protein kinase; LATS1, large tumor suppressor kinase 1; p, phosphorylated.

In summary, these results suggested that miR-30a-5p can be used as a therapeutic target for CRC treatment and may be associated with the activation of the Hippo signaling pathway. Curcumol inhibited viability, migration and invasion by regulating miR-30a-5p expression and activating the Hippo signaling pathway in CRC cells, and curcumol may be a promising agent for the treatment of CRC.
  44 in total

1.  Cinobufacini Inhibits Colon Cancer Invasion and Metastasis via Suppressing Wnt/β-Catenin Signaling Pathway and EMT.

Authors:  Jie Wang; Han Cai; Qiaoli Liu; Yue Xia; LiKai Xing; Qingsong Zuo; Yong Zhang; Cao Chen; Ke Xu; Peihao Yin; Teng Chen
Journal:  Am J Chin Med       Date:  2020-04-24       Impact factor: 4.667

2.  Curcumol induces cell cycle arrest in colon cancer cells via reactive oxygen species and Akt/ GSK3β/cyclin D1 pathway.

Authors:  Juan Wang; Xu-Mei Li; Zhun Bai; Bi-Xia Chi; Yan Wei; Xu Chen
Journal:  J Ethnopharmacol       Date:  2017-07-04       Impact factor: 4.360

3.  Therapeutic Effects of Curcumol in Several Diseases; An Overview.

Authors:  Sheema Hashem; Sabah Nisar; Geetanjali Sageena; Muzafar A Macha; Santosh K Yadav; Roopesh Krishnankutty; Shahab Uddin; Mohammad Haris; Ajaz A Bhat
Journal:  Nutr Cancer       Date:  2020-04-14       Impact factor: 2.900

4.  The Interplay of MicroRNA-34a, LGR4, EMT-Associated Factors, and MMP2 in Regulating Uveal Melanoma Cells.

Authors:  Qiang Hou; Shuxian Han; Lin Yang; Shengwen Chen; Junxiu Chen; Nan Ma; Chao Wang; Jiajia Tang; Xiaogang Chen; Feng Chen; Xiang Da Eric Dong; LiLi Tu
Journal:  Invest Ophthalmol Vis Sci       Date:  2019-10-01       Impact factor: 4.799

5.  The lncRNA FEZF1-AS1 Promotes the Progression of Colorectal Cancer Through Regulating OTX1 and Targeting miR-30a-5p.

Authors:  Jing Li; Lian-Mei Zhao; Cong Zhang; Meng Li; Bo Gao; Xu-Hua Hu; Jian Cao; Gui-Ying Wang
Journal:  Oncol Res       Date:  2019-07-03       Impact factor: 5.574

6.  Curcumol Inhibits Growth and Induces Apoptosis of Colorectal Cancer LoVo Cell Line via IGF-1R and p38 MAPK Pathway.

Authors:  Juan Wang; Fengxiang Huang; Zhun Bai; Bixia Chi; Jiacai Wu; Xu Chen
Journal:  Int J Mol Sci       Date:  2015-08-20       Impact factor: 5.923

7.  MiR-195 suppresses the metastasis and epithelial-mesenchymal transition of hepatocellular carcinoma by inhibiting YAP.

Authors:  Shuo Yu; Li Jing; Xiao-Ran Yin; Min-Cong Wang; Yi-Meng Chen; Ya Guo; Ke-Jun Nan; Li-Li Han
Journal:  Oncotarget       Date:  2017-09-15

8.  MicroRNA-30a-5p inhibits gallbladder cancer cell proliferation, migration and metastasis by targeting E2F7.

Authors:  Yuan-Yuan Ye; Jia-Wei Mei; Shan-Shan Xiang; Huai-Feng Li; Qiang Ma; Xiao-Ling Song; Zheng Wang; Yi-Chi Zhang; Yong-Chen Liu; Yun-Peng Jin; Yun-Ping Hu; Lin Jiang; Fa-Tao Liu; Yi-Jian Zhang; Ya-Juan Hao; Ying-Bin Liu
Journal:  Cell Death Dis       Date:  2018-03-14       Impact factor: 8.469

9.  Curcumol Exerts Anticancer Effect in Cholangiocarcinoma Cells via Down-Regulating CDKL3.

Authors:  Jinduo Zhang; Gang Su; Zengwei Tang; Li Wang; Wenkang Fu; Sheng Zhao; Yongjiang Ba; Bing Bai; Ping Yue; Yanyan Lin; Zhongtian Bai; Jinjing Hu; Wenbo Meng; Liang Qiao; Xun Li; Xiaodong Xie
Journal:  Front Physiol       Date:  2018-03-20       Impact factor: 4.566

10.  Long Non-Coding RNA LEF1-AS1 Promotes Migration, Invasion and Metastasis of Colon Cancer Cells Through miR-30-5p/SOX9 Axis.

Authors:  Ting Sun; Zhexian Liu; Rui Zhang; Siping Ma; Tao Lin; Yanxi Li; Shihua Yang; Wanchuan Zhang; Yongpeng Wang
Journal:  Onco Targets Ther       Date:  2020-04-07       Impact factor: 4.147

View more
  2 in total

1.  Characterization of Cell Cycle-Related Competing Endogenous RNAs Using Robust Rank Aggregation as Prognostic Biomarker in Lung Adenocarcinoma.

Authors:  Yifei Yang; Shiqi Zhang; Li Guo
Journal:  Front Oncol       Date:  2022-02-03       Impact factor: 6.244

Review 2.  Regulatory Roles of Noncoding RNAs in the Progression of Gastrointestinal Cancers and Health Disparities.

Authors:  Aditi Kulkarni; Sharan Gayathrinathan; Soumya Nair; Anamika Basu; Taslim A Al-Hilal; Sourav Roy
Journal:  Cells       Date:  2022-08-07       Impact factor: 7.666

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.