Literature DB >> 33725864

Correlation between the sulfamethoxazole-trimethoprim resistance of Shigella flexneri and the sul genes.

Quanping Ma1, Chengbao Zhu2, Mingxiao Yao3, Guangying Yuan2,4, Yuguo Sun1.   

Abstract

ABSTRACT: The aim of this study was to discuss the correlation between the sulfamethoxazole-trimethoprim resistance of Shigella flexneri (S. flexneri) and the antibiotic resistance genes sul1, sul2, and sul3 and SXT element.From May 2013 to October 2018, 102 isolates of S. flexneri were collected from the clinical samples in Jinan. The Kirby-Bauer (K-B) test was employed to determine the antibiotic susceptibility of the S. flexneri isolates. The antibiotic resistance rate was analyzed with the WHONET5.4 software. The isolates were subject to the PCR amplification of the sul genes (sul1, sul2, and sul3) and the SXT element. On the basis of the sequencing results, the correlation between the sulfamethoxazole-trimethoprim resistance of the S. flexneri isolates and the sul genes was analyzed.The antibiotic resistance rates of the 102 S. flexneri isolates to ampicillin, streptomycin, chloramphenicol, tetracycline, and sulfamethoxazole-trimethoprim were 90.2%, 90.2%, 88.2%, 88.2%, and 62.7%, respectively. The antibiotic resistance rates of these isolates to cefotaxime, ceftazidime, and ciprofloxacin varied between 20% and 35%. However, these isolates were 100% susceptible to cefoxitin. Positive fragments were amplified from 59.8% (61/102) of the 102 S. flexneri isolates, the sizes of the sul1 and sul2 genes being 338 bp and 286 bp, respectively. The sequence alignment revealed the presence of the sul1 and sul2 genes encoding for dihydrofolate synthase. The carrying rate of the sul1 gene was 13.7% (14/102), and that of the sul2 gene was 48.0% (49/102). No target gene fragments were amplified from the 3 isolates resistant to sulfamethoxazole-trimethoprim. The sul3 gene and SXT element were not amplified from any of the isolates. The testing and statistical analysis showed that the resistance of the S. flexneri isolates to sulfamethoxazole-trimethoprim correlated to the sul1 and sul2 genes.The acquired antibiotic resistance genes sul1 and sul2 were closely associated with the resistance of the 102 S. flexneri isolates to sulfamethoxazole-trimethoprim.
Copyright © 2021 the Author(s). Published by Wolters Kluwer Health, Inc.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 33725864      PMCID: PMC7969299          DOI: 10.1097/MD.0000000000024970

Source DB:  PubMed          Journal:  Medicine (Baltimore)        ISSN: 0025-7974            Impact factor:   1.817


Introduction

Shigella infections can lead to acute, chronic, and toxic dysentery. Some isolates may even cause hemolytic-uremic syndrome and Reiter syndrome. In 2015, diarrhea caused more than 1.3 million deaths globally and was the fourth leading cause of death among children younger than 5 years.[ The Shigella bacteria are recognized by the World Health Organization (WHO) as the bacteria with growing antibiotic resistance and bringing a huge threat to human health.[S. flexneri is the most common Shigella species in developing countries, while Shigella sonnei (S. sonnei) is more prevalent in developed countries.[ The 2017 Clinical and Laboratory Standards Institute (CLSI) guidelines[ recommend the use of ampicillin, fluoroquinolones, and sulfamethoxazole-trimethoprim for the treatment of bacterial dysentery. Since the emergence of sulfonamides in the 1930s, they have been widely used in clinical and veterinary medicine to treat bacterial infections. By combining the catalytic enzyme in the folic acid synthesis pathway -- dihydropteroate synthetase (DHPS), sulfonamides cause dihydrofolic acid synthesis disorder and inhibit bacterial growth.[ Sulfonamide resistance is primarily mediated by the sul1, sul2, and sul3 genes encoding DHPS with a low affinity for sulfonamides.[ The SXT element, first discovered in the Vibrio cholerae of the O139 serogroup, was a gene encoding sulfamethoxazole-trimethoprim resistance.[ In this study, the antibiotic resistance of 102 S. flexneri isolates collected in Jinan was detected. The correlation between the resistance to sulfamethoxazole-trimethoprim and the sul1, sul2, and sul3 genes and the SXT element was discussed.

Materials and methods

Sources of isolates

From May 2013 to October 2018, 102 S. flexneri isolates were isolated from the feces of patients in Jinan. The isolates were analyzed on the ID32E system, and the results were interpreted by ATB expression. Serotyping was performed on the S. flexneri isolates using the Diagnostic Serum for Shigella. The preserved isolates were taken out from the ultra-low temperature freezer at −86°C, thawed at room temperature, and reidentified. The quality-control strain Escherichia coli (E. coli) ATCC 25922 was preserved at the clinical microbiology laboratory of the Fourth People's Hospital of Jinan. This study had been approved by the medical ethics committee of the Fourth People's Hospital of Jinan.

Main reagents and equipment

Ampicillin, chloramphenicol, tetracycline, streptomycin, sulfamethoxazole-trimethoprim, ciprofloxacin, cefotaxime, ceftazidime and cefoxitin drug sensitive slips, and Mueller–Hinton (M-H) agar (OXOID, UK); Diagnostic Serum for Shigella (Lanzhou Institute of Biological Products Co., Ltd.), agarose (Invitrogen); bacterial identification system (Bio mérieux, France, ATB Expression), PCR Instrument (Biometra, Germany), electrophoresis apparatus (10C, Beijing Liuyi Instrument Factory), biosafety cabinet (Shanghai Lishen Scientific Equipment Co., Ltd., 1200IIA2). The synthesis of the PCR primers and the DNA sequencing the amplified PCR products were undertaken by TaKaRa Biotechnology (Dalian) Co., Ltd., Primer sequences are summarized in Table 1.
Table 1

Sequences of the PCR primers.

Primer namePrimer sequence (5′→3′)Fragment length, bpAnnealing temperatureReference
sul1FP:CTTCGATGAGAGCCGGCGGC RP:GCAAGGCGGAAACCCGCGCC33855[5]
sul2FP:GCGCTCAAGGCAGATGGCATT RP:GCGTTTGATACCGGCACCCGT28655[5]
sul3FP: GAGCAAGATTTTTGGAATCG RP: CATCTGCAGCTAACCTAGGGCTTTGGA79955[5]
SXTFP:ATGGCGTTATCAGTTAGCTGGC RP:GCGAAGATCATGCATAGACC103556[6]
Sequences of the PCR primers.

Antibiotic susceptibility test

The Kirby–Bauer (K-B) test was performed to detect the antibiotic susceptibility. The testing procedures were carried out and the results were interpreted in strict accordance with the 2019 CLSI guidelines.[ The quality-control strain E. coli ATCC 25922 was used. The diameter of the zone of inhibition was input into the WHONET 5.4 software.

PCR amplification of the sul1, sul2, and sul3 genes and SXT element

The primers for the sul1, sul2, and sul3 genes and SXT element were synthesized according to literature references.[ The primer sequences are presented in Table 1. A sterile inoculation loop was used to pick a single colony and inoculate to the M-H plate. After incubation at 35°C for 16 to 18 hours, an appropriate amount of bacterial lawn was picked with a sterile cotton swab and dissolved in 50 μL of the double-distilled water. This was followed by a water bath at 95°C for 5 minutes and centrifugation at 12,000 rpm for 30 seconds.[ The DNA-containing supernatant was collected and stored in a −20°C fridge. PCR conditions for the sul1, sul2, and sul3 genes and SXT element were as follows: Predenaturation at 94°C for 3 minutes; 94°C 30 seconds, annealing for 30 seconds (the annealing temperature is shown in Table 1), 72°C 40 seconds, 35 cycles; extension at 72°C for 5 minutes. After the PCR reaction was completed, 10 μL PCR product was taken and subject to 1% agarose gel electrophoresis at 120 V for 20 minutes. Ethidium bromide (EB) staining was carried out, and the DNA bands were visualized under the ultraviolet analyzer. The results were recorded, and the pictures were taken. The PCR products were submitted to TaKaRa Biotechnology (Dalian) Co., Ltd. for the sequencing. The genotypes were finally determined by using the NCBI/BLAST tool.

Results

Results of antibiotic susceptibility test

The antibiotic resistance rates of the 102 S. flexneri isolates to ampicillin, streptomycin, chloramphenicol, and tetracycline were all 90.2% (92/102). The resistance rate to sulfamethoxazole-trimethoprim was 62.7% (64/102). The antibiotic resistance rates of these isolates to cefotaxime, ceftazidime, and ciprofloxacin varied between 20% and 35%. However, these isolates were 100% susceptible to cefoxitin. The antibiotic resistance pattern consisting of ampicillin-streptomycin-chloramphenicol-tetracycline was found in 90.2% of all isolates. The antibiotic resistance pattern consisting of ampicillin-streptomycin-chloramphenicol-tetracycline-sulfamethoxazole-trimethoprim was found in 62.7% of all isolates. See Table 2.
Table 2

Results of the susceptibility of 102 S. flexneri isolates to 9 antibiotics (%).

AntibioticsR+ IS
Ampicillin90.29.8
Cefotaxime30.469.6
Ceftazidime22.577.5
Cefoxitin0.0100.0
Ciprofloxacin34.365.7
Streptomycin90.29.8
Chloramphenicol90.29.8
Tetracycline90.29.8
Sulfamethoxazole-trimethoprim62.737.3

I = Intermediate, R = Resistance, S = Susceptible.

Results of the susceptibility of 102 S. flexneri isolates to 9 antibiotics (%). I = Intermediate, R = Resistance, S = Susceptible.

Results of PCR amplification of the antibiotic resistance genes

Of the 102 S. flexneri isolates, 59.8% (61/102) were positive for the amplification. The presence of the sul1 and sul2 genes encoding for dihydrofolate synthase was then verified by sequencing. Of all these positive isolates, 11.8% (12/102) only carried the sul1 gene, 46.1% (47/102) only carried the sul2 gene, and 2.0% (2/102) carried both. The overall carrying rate of the sul1 gene was 13.7% (14/102), and that of the sul2 gene was 48.0% (49/102). No sul3 gene or SXT element was amplified from any isolates. The electrophoretograms and the sequencing diagrams of the amplified PCR products of the sul1 and sul2 genes are presented in Figures 1 to 3, respectively.
Figure 1

Electrophoretograms of amplified PCR products from the sul1 and sul2 genes. The lane M is DL2000. Lanes 1, 2, 3, 4, 5, and 6 are the amplification results of any 6 isolates. Lane N is the E. coli ATCC 25922 as the negative control. The size of the sul1 and sul2 genes was 338 and 286 bp, respectively.

Figure 3

Part of the sequencing diagram of the sul2 gene.

Electrophoretograms of amplified PCR products from the sul1 and sul2 genes. The lane M is DL2000. Lanes 1, 2, 3, 4, 5, and 6 are the amplification results of any 6 isolates. Lane N is the E. coli ATCC 25922 as the negative control. The size of the sul1 and sul2 genes was 338 and 286 bp, respectively. Part of the sequencing diagram of the sul1 gene. Part of the sequencing diagram of the sul2 gene.

Correlation analysis between the sulfamethoxazole-trimethoprim resistance of the S. flexneri isolates and the antibiotic resistance genes

Of the 102 S. flexneri strains, 64 strains were resistant to sulfamethoxazole/trimethoprim, accounting for 62.7% (64/102). According to the sequencing of 102 strains of S. flexneri, 61 strains carried sul1 or sul2 genes (2 strains carried 2 genes at the same time), all of which were resistant to antibiotics. Only 3 strains (7.32%) of the remaining 41 strains that did not carry these two genes were resistant. After statistical analysis, the drug resistance rate of S. flexneri carrying sul1 or sul2 gene was significantly higher than that of strains without sul1 or sul2 gene (χ2 = 86.184, P < .001), the rate of drug resistance of strains carrying sul1 or sul2 gene was about 13.67 times (4.59∼40.62) of strains without sul1 or sul2 gene, as summarized in Table 3.
Table 3

Correlation analysis of drug resistance gene and drug susceptibility test results (N = 102).

Sulfamethoxazole-trimethoprim
Drug resistance geneDrug resistanceNo drug resistanceχ2P
sul1 gene or sul2 geneCarry61086.184<.001
Don’t carry338
Correlation analysis of drug resistance gene and drug susceptibility test results (N = 102). The statistical analysis of 100 strains with only sul1 gene and strains with only sul2 gene showed that the drug resistance rate of strains with sul1 gene was statistically significant compared with that without sul1 gene (P = .003). The drug resistance rate of the strains with sul2 gene was statistically significant compared with that without sul2 gene (χ2 = 51.351, P < .001), as summarized in Table 4.
Table 4

Correlation analysis of drug resistance gene and drug susceptibility test results (N = 100).

Sulfamethoxazole-trimethoprim
Drug resistance geneDrug resistanceNo drug resistanceχ2P
sul1 geneCarry1206.625<.01
Don’t carry5038
sul2 geneCarry47051.351<.001
Don’t carry1538
Correlation analysis of drug resistance gene and drug susceptibility test results (N = 100).

Discussion

In recent years, cross-resistance and multidrug resistance to Shigella bacteria have become a critical concern.[ In 1996, Shigella bacteria were recognized by WHO as the bacteria causing a huge threat to human society due to the growing antibiotic resistance.[ The prevalence of Shigella infection is closely related to economic status, public health, life habits, and prevalent serotypes in different regions. In China, bacterial dysentery is a severe public health problem.[ Our results indicated that the antibiotic resistance rate of the 102 S. flexneri isolates to ampicillin, streptomycin, chloramphenicol, and tetracycline was 90.2%. The resistance rate to sulfamethoxazole-trimethoprim was 62.7%. These results were consistent with those by Xu et al[ but lower than the resistance rates reported in Peru[ and Iran,[ and higher than the 44.4% reported in Xinjiang.[ Moreover, the antibiotic resistance pattern consisting of ampicillin-streptomycin-chloramphenicol-tetracycline was found in 90.2% of the isolates. The antibiotic resistance pattern consisting of ampicillin-streptomycin-chloramphenicol-tetracycline-sulfamethoxazole-trimethoprim was found in 62.7% of the isolates. In India[ and Bangladesh,[ the antibiotic resistance pattern consisting of ampicillin-nalidixic acid-sulfamethoxazole-trimethoprim prevailed. Delfifino et al[ reported that as nalidixic acid and ciprofloxacin were rarely used in Mozambique, the antibiotic resistance pattern consisting of ampicillin-chloramphenicol-tetracycline-sulfamethoxazole-trimethoprim prevailed. The variation of the antibiotic resistance pattern has a close connection to the use of different antibiotics and the prevalent antibiotic resistance genotypes across the regions. PCR results showed the presence of the sul1 and sul2 genes in the S. flexneri isolates resistant to sulfamethoxazole-trimethoprim. However, no fragments of the sul1 and sul2 genes were amplified from the isolates susceptible to sulfamethoxazole-trimethoprim. Statistical analysis suggested a strong correlation between antibiotic resistance and the presence of the sul1 and sul2 genes. It was thus implied that the sul1 and sul2 genes encoding for dihydrofolate synthase were involved in the resistance of the S. flexneri isolates to sulfamethoxazole-trimethoprim. Shuyu et al[ also detected the sul1, sul2, and sul3 genes in 45%, 65%, and 12% of the E. coli isolates resistant to sulfonamides in Denmark, respectively. These genes could be transferred via the plasmid of 33 to 160 kb, which was related to the spread of the sulfonamide-resistant E. coli. In the UK, although the prescription rate of sulfonamides dropped dramatically in the 1990s (by 97%), the resistance of the sulfonamide-resistant E. coli isolates from the patients did not weaken. It has been reported that gene transfer was mediated by the sul2-carrying plasmid in E. coli.[ Byrne-Bailey et al[ reported the identification of an S. flexneri isolate from the soil slurry fertilized with the pig manure at a pig farm in the UK, this isolate presented with resistance to multiple drugs, including sulfonamides, and also carried the sul2 and intI1 genes. Lluque et al[ detected 36 clinical isolates of S. flexneri resistant to sulfamethoxazole-trimethoprim. Among them, 94% (34/36) of the isolates carried the sul2 gene, and 61% (22/36) carried the dfrA1 gene. Mohd et al[ reported the presence of sul2 in all 146 isolates of S. flexneri 2a resistant to sulfamethoxazole-trimethoprim. The transfer of the sul2 gene was mediated by the 4.3 MDa plasmid. The SXT element, first discovered in the Vibrio cholerae of the O139 serogroup, was a gene encoding sulfamethoxazole-trimethoprim resistance.[ In recent years, the SXT element has been successively discovered in other bacteria, and the antibiotic resistance genes carrying the SXT element also varies.[ To observe whether the SXT element is also present in Shigella, we detected 102 strains of S. flexneri and found no SXT element. Of the 64 isolates resistant to sulfamethoxazole-trimethoprim, 95.3% (61/64) carried the sul1 or sul2 gene or both; the remaining 4.7% (3/64) were negative for the sul1 and sul2 genes. Whether other antibiotic resistance mechanisms were also involved was not yet fully clarified. Fragments of the sul1 and sul2 genes were not amplified from 40 isolates susceptible to sulfamethoxazole-trimethoprim. This result implied that the presence of the sul1 and sul2 genes induced the sulfamethoxazole-trimethoprim resistance in the 102 S. flexneri isolates collected in Jinan. The occurrence mechanism of multidrug resistance is very complex. One possible explanation is that the mobile genetic elements in bacteria are able to move within the same species or across the different species, thereby accelerating the antibiotic resistance to S. flexneri and the generation of the multidrug-resistant isolates. This study has some limitations. Due to our limited sample size, it may have an impact on the experimental results; in future studies, we will further improve our experiment.

Author contributions

Data curation: Quanping Ma, Chengbao Zhu. Formal analysis: Chengbao Zhu. Investigation: Quanping Ma, Mingxiao Yao. Methodology: Chengbao Zhu. Resources: Quanping Ma, Chengbao Zhu. Software: Mingxiao Yao. Supervision: Guangying Yuan, Yuguo Sun. Writing – original draft: Quanping Ma, Yuguo Sun. Writing – review & editing: Mingxiao Yao, Guangying Yuan, Yuguo Sun.
  24 in total

1.  Resistance among Escherichia coli to sulphonamides and other antimicrobials now little used in man.

Authors:  David C Bean; David M Livermore; Iro Papa; Lucinda M C Hall
Journal:  J Antimicrob Chemother       Date:  2005-09-08       Impact factor: 5.790

2.  Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries.

Authors:  Frank M Aarestrup; Monton Lertworapreecha; Mary C Evans; Aroon Bangtrakulnonth; Thongchai Chalermchaikit; Rene Sjøgren Hendriksen; Henrik Caspar Wegener
Journal:  J Antimicrob Chemother       Date:  2003-09-12       Impact factor: 5.790

3.  Bacteria on the rampage.

Authors:  J Davies
Journal:  Nature       Date:  1996-09-19       Impact factor: 49.962

4.  Antibiotic resistance and molecular characterization of shigella isolates recovered from children aged less than 5 years in Manhiça, Southern Mozambique.

Authors:  Delfino Vubil; Clara Balleste-Delpierre; Rita Mabunda; Sozinho Acácio; Marcelino Garrine; Tacilta Nhampossa; Pedro Alonso; Inacio Mandomando; Jordi Vila
Journal:  Int J Antimicrob Agents       Date:  2018-02-12       Impact factor: 5.283

5.  A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland.

Authors:  Vincent Perreten; Patrick Boerlin
Journal:  Antimicrob Agents Chemother       Date:  2003-03       Impact factor: 5.191

6.  Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.

Authors:  K G Byrne-Bailey; W H Gaze; P Kay; A B A Boxall; P M Hawkey; E M H Wellington
Journal:  Antimicrob Agents Chemother       Date:  2008-12-08       Impact factor: 5.191

7.  Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human.

Authors:  Shuyu Wu; Anders Dalsgaard; Anette M Hammerum; Lone J Porsbo; Lars B Jensen
Journal:  Acta Vet Scand       Date:  2010-07-30       Impact factor: 1.695

8.  Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Authors:  Na Wang; Xiaohong Yang; Shaojun Jiao; Jun Zhang; Boping Ye; Shixiang Gao
Journal:  PLoS One       Date:  2014-11-18       Impact factor: 3.240

9.  Characterization of Three Novel SXT/R391 Integrating Conjugative Elements ICEMfuInd1a and ICEMfuInd1b, and ICEMprChn1 Identified in the Genomes of Marinomonas fungiae JCM 18476T and Marinomonas profundimaris Strain D104.

Authors:  Jhasketan Badhai; Subrata K Das
Journal:  Front Microbiol       Date:  2016-11-25       Impact factor: 5.640

10.  Prevalence of Shigella species and its drug resistance pattern in Ethiopia: a systematic review and meta-analysis.

Authors:  Siraj Hussen; Getamesay Mulatu; Zemenu Yohannes Kassa
Journal:  Ann Clin Microbiol Antimicrob       Date:  2019-07-09       Impact factor: 3.944

View more
  1 in total

1.  Antimicrobial Resistance and Transconjugants Characteristics of sul3 Positive Escherichia coli Isolated from Animals in Nanning, Guangxi Province.

Authors:  Qinmei Li; Zheng Li; Yuhan Wang; Yunru Chen; Junying Sun; Yunqiao Yang; Hongbin Si
Journal:  Animals (Basel)       Date:  2022-04-10       Impact factor: 3.231

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.