Literature DB >> 33708368

Galectin-3 levels are elevated following nintedanib treatment.

Gali Epstein Shochet1, Alon Pomerantz2, David Shitrit3, Becky Bardenstein-Wald4, Kjetil Ask5, Mark Surber6, Noa Rabinowicz7, Yair Levy4, Sydney Benchetrit4, Evgeny Edelstein8, Tali Zitman-Gal4.   

Abstract

BACKGROUND AND AIMS: Idiopathic pulmonary fibrosis (IPF) is a common and severe form of pulmonary fibrosis. Nintedanib, a triple angiokinase inhibitor, is approved for treating IPF. Galectin 3 (Gal-3) activates a variety of profibrotic processes. Currently, the Gal-3 inhibitor TD139 is being tested in phase II clinical trials. Since this treatment is given 'on top' of nintedanib, it is important to estimate its effect on Gal-3 levels. Therefore, we evaluated the impact of nintedanib on Gal-3 expression using both in vitro and in vivo models, in addition to serum samples from patients with IPF.
METHODS: Gal-3 levels were evaluated in IPF and control tissue samples, primary human lung fibroblasts (HLFs) following nintedanib treatment (10-100 nM, quantitative polymerase chain reaction), and in a silica-induced fibrosis mouse model with/without nintedanib (0.021-0.21 mg/kg) by immunohistochemistry. In addition, Gal-3 levels were analyzed in serum samples from 41 patients with interstitial lung disease patients with/without nintedanib treatment by ELISA.
RESULTS: Nintedanib addition to HLFs resulted in significant elevations in Gal-3, phospho-signal transducer and activator of transcription 3 (pSTAT3), as well as IL-8 mRNA levels (p < 0.05). Gal-3 expression was higher in samples from IPF patients compared with non-IPF controls at the protein and mRNA levels (p < 0.05). In the in vivo mouse model, Gal-3 levels were increased following fibrosis induction and even further increased with the addition of nintedanib, mostly in macrophages (p < 0.05). Patients receiving nintedanib presented with higher Gal-3 serum levels compared with those who did not receive nintedanib (p < 0.05).
CONCLUSION: Nintedanib elevates Gal-3 levels in both experimental models, along with patient samples. These findings highlight the possibility of using combined inhibition therapy for patients with IPF.
© The Author(s), 2020.

Entities:  

Keywords:  galectin-3; idiopathic pulmonary fibrosis; in vivo models; nintedanib; signal transducer and activator of transcription 3 (STAT3)

Year:  2020        PMID: 33708368      PMCID: PMC7907712          DOI: 10.1177/2040622320968412

Source DB:  PubMed          Journal:  Ther Adv Chronic Dis        ISSN: 2040-6223            Impact factor:   5.091


Introduction

Idiopathic pulmonary fibrosis (IPF) is considered the most common and severe form of pulmonary fibrosis, with a 5-year survival rate of only 20% reflecting the lack of effective therapies.[1] The pathology of IPF is characterized by scar tissue formation (fibrosis) and excessive extracellular matrix deposition, resulting in the loss of lung function. Galectin-3 (Gal-3) is currently regarded as a potential inflammatory marker identified as a molecule that functions to drive the inflammatory response and oxidative stress.[2,3] It was shown to modulate cell–receptor interactions, immune response, cancer cell behavior, inflammation, as well as scarring processes.[4-8] Accumulating evidence indicates that Gal-3 activates a variety of profibrotic factors, promotes fibroblast proliferation and transformation, and mediates collagen production.[9] There are several known ligands for Gal-3 that are involved in its profibrotic functions, in particular various glycosylated matrix proteins (i.e. laminin, fibronectin, and integrins).[10] Numerous studies have defined the key role of Gal-3 in fibrogenesis in diverse organ systems, including the liver, lung, heart, and kidney.[11-13] There are multiple pathways implicated in fibrosis progression.[14,15] Currently, nintedanib and pirfenidone are the only FDA-approved IPF treatments.[14,15] Nintedanib is a triple angiokinase inhibitor that has been shown to block platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), and vascular endothelial growth factor (VEGF).[16] However, the precise mechanism of nintedanib in preventing fibrosis is not completely understood. Although proven effective in several clinical trials for the reduction of forced vital capacity (FVC) decline,[17-19] patients experience frequent adverse events (e.g. diarrhea and increased aminotransferase levels). Thus, new treatment options are currently being explored including the Gal-3 inhibitor, TD139 (Galecto, Copenhagen, Denmark). Since this treatment is given ‘on top’ of nintedanib, it is important to evaluate its effect on Gal-3 levels. This study assessed the impact of nintedanib treatment on Gal-3 levels using both in vitro and in vivo models. In addition, serum Gal-3 levels were evaluated in patients with IPF receiving nintedanib.

Materials and methods

Primary human lung fibroblast culture

Primary human lung fibroblasts (HLFs) were isolated by the explant culture method from lung tissue samples of 9 patients with IPF (histologically confirmed) and 20 normal control donors (N-HLF) (histologically normal lung distant from a resected tumor). The isolation was performed as described previously.[20] Following extraction, the HLFs were cultured in Dulbecco’s modified Eagle’s medium supplemented with 15% FCS, L-glutamine (2 mM), and antibiotics (Biological Industries, Beit-Haemek, Israel). Cells were maintained in 5% CO2 at 37°C. Nintedanib (10–100 nM, provided by Avalyn Pharma, USA) was dissolved in DMSO. A similar DMSO concentration served as control.

Study population and serum sampling

The study included sera samples from 41 patients with interstitial lung disease (ILD), above 18 years of age. The medical records of all participants were reviewed to gather data including age, gender, comorbidities, and pulmonary function test results. Blood samples were taken only from participants who had previously consented and authorized the use of their samples for research purposes. Serum was harvested after low-speed centrifugation (3000 g for 10 min) and stored at –80°C before analysis.

Biomarker analysis

Gal-3 was measured using a validated competitive Enzyme-Linked Immunosorbent Assay (ELISA) produced by BG Medicine (Waltham, MA, USA) according to the manufacturer’s instructions.

In vivo silica mouse model

Mouse studies were performed in collaboration with McMaster University using established protocols, as previously described.[21] Briefly, IPF was induced on day 1 in 20–22 g female C57BL/6 mice by a single intratracheal intubation of silica (2.5 mg/kg) or phosphate-buffered saline (PBS) control while animals were under isoflurane anesthesia. Nintedanib was delivered using intranasal (IN) administration of 50 µl formulation directly to the lung.[21,22] After acclimation, animals were randomized based upon body weight. On days 10–29, animals were lightly anesthetized with isoflurane and dosed once a day with 0.021, 0.21, or 2.1 mg/kg nintedanib (35 µl per dose) or inhaled vehicle. Doses and number of animals were chosen based on previous reports,[23,24] A total of 10 mice were used for the control, and 13 were enrolled into each IN dose group. Treatment/controls were given in parallel, and thus the order of treatments and measurements was similar between the groups. The left lobe of each lung was inflated to 30 cmH2O for 3–5 min in a 10% formalin solution for paraffin block preparation.

Immunohistochemistry

Sections prepared from mice lungs were deparaffinized in xylene and alcohol, rinsed in PBS and immersed in citrate buffer (pH 6). The samples were stained using the Mouse on Mouse ImmPRESS polymer kit (Vector Laboratories, Burlingame, CA, USA) according to manufacturers’ instructions. Slides were incubated overnight at 4°C with the anti-Gal-3 primary antibody (1:200) (Abcam, Cambridge, MA, USA), and developed using ImmPACT DAB (Vector Laboratories) according to manufacturers’ instructions. Use of the isotype-matched control antibody (negative control) eliminated nonspecific staining. The expression level of Gal-3 was measured using QuPath in a blinded measurement.[25]

Real-time quantitative polymerase chain reaction

Following cultures, RNA was extracted from HLFs using the RNeasy kit (QAIGEN, Hilden, Germany). Extracted RNA was converted to cDNA using GeneAmp (Applied Biosystems, Waltham, MA, USA USA). Quantitative polymerase chain reaction was performed using Power SYBR Green (Applied Biosystems) to validate the expression pattern of Gal-3 (LGALS3): forward :5′-CAGAATTGCTTTAGATTTCCAA-3′; reverse: 5′-TTATCCAGCTTTGTATTGCAA-3′, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the reference gene: forward: 5′-CTCTGCTCCTCCTGTTCGAC-3′, reverse: 5′ TTAAAAGCAGCCCTGGTGAC 3′. IL-8 forward: 5′-CTCTTGGCAGCCTTCCTGATTT-3′ and reverse: 5′-TGGGGTGGAAAGGTTTGGAGTA -3′.

Western blot

N-HLF, IPF-HLF, or 10 mg of lung tissue samples were lysed and western blot was performed as previously described.[26] The following rabbit/mouse antihuman antibodies were used: Gal-3 (ab2785) and GAPDH (ab9484) (Abcam, USA), phospho-signal transducer and activator of transcription 3 (pSTAT3) S727 (#9134) and STAT3 (#9139) (Cell Signaling Technologies, USA), alpha-tubulin (T5168) from Sigma-Aldrich (Burlington, MA, USA). Bound antibodies were visualized using goat peroxidase-conjugated secondary antibodies (Millipore, Burlington, MA, USA), anti-mouse IgG #AP308P and anti-rabbit IgG #AP307P) followed by enhanced chemiluminescence detection (Millipore, USA). LAS-3000 (Fujifilm, Tokyo, Japan) was used to quantify protein expressions. Results were normalized to tubulin and GAPDH.

Statistical analysis

Statistical analysis was carried out using GraphPad Prism version 7.00 for Windows (GraphPad Software, La Jolla, CA, USA) and by SPSS (IBM). ANOVA was performed to compare differences between multiple cohorts. Paired Student’s t-tests were employed to analyze differences between two groups. An effect was considered significant when the p value was <0.05. All experiments were repeated at least three times.

Ethical approval

The HLF and serum sample studies were approved by the Ethics Committee of the Meir Medical Center (MMC-016-16, MMC-001-20, respectively). Informed consent was obtained from all patients. The nintedanib mouse studies were approved by the Animal Research Ethics Board of McMaster University (IRB Protocol #160414) and carried out in accordance with the Guidelines of the Canadian Council on Animal Care. Animals were monitored for weight loss and other signs of physical distress throughout these experiments.

Results

Nintedanib exposure elevates Gal-3 levels in HLF cells

In order to test the effect of nintedanib on Gal-3 expression, N-HLFs were exposed to nintedanib (10–100 nM) for 24 h, and Gal-3 levels were tested. In fact, exposure to nintedanib resulted in a significant elevation in Gal-3 protein and mRNA levels (Figure 1(a) and (b)). Since Gal-3 is known to be activated by the STAT3 pathway, we also tested STAT3 phosphorylation, which was also found to be elevated by nintedanib following 1 h of exposure in N-HLFs (p < 0.05) (Figure 1(c-d)). IL-8 that was previously shown to be induced by Gal-3 and linked to STAT3 (Figure 1(e))[27] was also significantly elevated by the nintedanib treatment (p < 0.05) (Figure 1(f)).
Figure 1.

Nintedanib exposure elevates Gal-3 levels in N-HLFs.

N-HLFs were exposed to nintedanib (10–100 nM). Gal-3 levels were measured by (a) western blot and (b) qPCR after 24 h. (c) The effect of nintedanib on N-HLF pSTAT3-S727 (60 min) was analyzed by western blotting. (d) Representative western blots for (a) and (c). Protein interaction networks were constructed using STRING (http://string-db.org/) (e). IL-8 mRNA levels were measured by qPCR after 24 h (f).

*p < 0.05, **p < 0.01. (n ⩾4).

CXCL8, C-X-C motif chemokine ligand 8; Gal-3, galectin-3; HLF, human lung fibroblast; IL, interleukin; N-HLF, human lung fibroblast from control donors; qPCR, quantitative polymerase chain reaction; pSTAT, phospho-signal transducer and activator of transcription 3; STAT, signal transducer and activator of transcription 3.

Nintedanib exposure elevates Gal-3 levels in N-HLFs. N-HLFs were exposed to nintedanib (10–100 nM). Gal-3 levels were measured by (a) western blot and (b) qPCR after 24 h. (c) The effect of nintedanib on N-HLF pSTAT3-S727 (60 min) was analyzed by western blotting. (d) Representative western blots for (a) and (c). Protein interaction networks were constructed using STRING (http://string-db.org/) (e). IL-8 mRNA levels were measured by qPCR after 24 h (f). *p < 0.05, **p < 0.01. (n ⩾4). CXCL8, C-X-C motif chemokine ligand 8; Gal-3, galectin-3; HLF, human lung fibroblast; IL, interleukin; N-HLF, human lung fibroblast from control donors; qPCR, quantitative polymerase chain reaction; pSTAT, phospho-signal transducer and activator of transcription 3; STAT, signal transducer and activator of transcription 3.

Gal-3 is overexpressed in IPF lung tissue

Following these results, Gal-3 baseline expression was evaluated in primary HLFs derived from patients with IPF (IPF-HLF) and control N-HLF. Although Gal-3 expression was higher in the IPF-HLF compared with N-HLF cells, it did not reach significance (Figure 2(a) and (c)). Nevertheless, when analyzing whole tissue samples from IPF and non-IPF controls, we found that total Gal-3 levels were significantly elevated in IPF tissue samples (Figure 2(b) and (d)) (p < 0.05). These results suggest that although fibroblast involvement is observed, the increase in Gal-3 levels results primarily from other cell types. Immunohistochemical staining of IPF tissue samples demonstrated stromal involvement with strong staining mainly in the alveolar macrophages (AM) (Figure 2(e) and (f)).
Figure 2.

Gal-3 is overexpressed in IPF lung tissue.

Proteins were extracted from HLFs from (a) patients with IPF (IPF-HLF) or control donors (N-HLF) and (b) from lung tissue lysates. Gal-3 protein levels were measured by western blotting. (c) and (d) Representative western blots for (a) and (b) **p < 0.01 (n ⩾10). IPF tissue samples were fixed in formaldehyde and paraffin embedded. Following deparaffinization, slides were stained with (e) Masson’s trichrome stain, and (f) anti-Gal-3 antibody. Black arrows indicate stromal involvement.

AM, alveolar macrophages; Gal-3, galectin-3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HLF, human lung fibroblast; IPF, idiopathic pulmonary fibrosis; N-HLF, human lung fibroblast from control donors.

Gal-3 is overexpressed in IPF lung tissue. Proteins were extracted from HLFs from (a) patients with IPF (IPF-HLF) or control donors (N-HLF) and (b) from lung tissue lysates. Gal-3 protein levels were measured by western blotting. (c) and (d) Representative western blots for (a) and (b) **p < 0.01 (n ⩾10). IPF tissue samples were fixed in formaldehyde and paraffin embedded. Following deparaffinization, slides were stained with (e) Masson’s trichrome stain, and (f) anti-Gal-3 antibody. Black arrows indicate stromal involvement. AM, alveolar macrophages; Gal-3, galectin-3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HLF, human lung fibroblast; IPF, idiopathic pulmonary fibrosis; N-HLF, human lung fibroblast from control donors.

Nintedanib exposure elevates Gal-3 levels in silica-induced fibrosis mice model

In our recent work,[21] nintedanib was given to silica-exposed mice in three doses (0.021–2.1 mg/kg) and was shown to inhibit the silica-induced expression of fibrotic markers (e.g. smooth muscle actin, collagen, and IL-1β). However, inhibition was not complete thus suggesting activation of parallel mechanisms, possibly Gal-3. Therefore, left lungs were stained to assess parenchymal Gal-3 levels. Compared with sham animals, silica exposure stimulated a significant increase in lung Gal-3 expression (Figure 3). Positive cells were mostly AMs, epithelial cells, as well as some fibroblasts. Interestingly, nintedanib treatment (0.21–2.1 mg/kg) further elevated Gal-3 levels, mostly in the AMs (p < 0.05) (Figure 3).
Figure 3.

Nintedanib exposure elevates Gal-3 levels in silica-induced fibrosis mice model.

Mice were exposed to silica with/without nintedanib treatment (0.021–2.1 mg/kg) for 30 days. Paraffin blocks were prepared from the left lobes of each lung. (a) Slides were stained with Masson and for Gal-3 and quantified by QuPath. One-way ANOVA was used within treatments ****p < 0.0001. Representative images for Masson’s trichrome staining of (b) control, (c) silica, and (d) silica + nintedanib 0.21 mg/kg (nintedanib). Representative images for Gal-3 staining of (e) control, (f) silica, and (g) silica + nintedanib 0.21 mg/kg (nintedanib). Number of sections used: n = 10 control, n = 19 silica vehicle, n = 11 silica + 0.021 nintedanib, n = 12 silica + 0.021 nintedanib, n = 11 silica + 0.21 nintedanib.

ANOVA, analysis of variance; Gal-3, galectin-3.

Nintedanib exposure elevates Gal-3 levels in silica-induced fibrosis mice model. Mice were exposed to silica with/without nintedanib treatment (0.021–2.1 mg/kg) for 30 days. Paraffin blocks were prepared from the left lobes of each lung. (a) Slides were stained with Masson and for Gal-3 and quantified by QuPath. One-way ANOVA was used within treatments ****p < 0.0001. Representative images for Masson’s trichrome staining of (b) control, (c) silica, and (d) silica + nintedanib 0.21 mg/kg (nintedanib). Representative images for Gal-3 staining of (e) control, (f) silica, and (g) silica + nintedanib 0.21 mg/kg (nintedanib). Number of sections used: n = 10 control, n = 19 silica vehicle, n = 11 silica + 0.021 nintedanib, n = 12 silica + 0.021 nintedanib, n = 11 silica + 0.21 nintedanib. ANOVA, analysis of variance; Gal-3, galectin-3.

Patients receiving nintedanib show elevated Gal-3 serum levels

Serum was collected from 41 consecutive patients with ILD routinely visiting the pulmonary clinic enrolled in the study. A total of 11 patients were receiving nintedanib. The time patients had received nintedanib varied between several months and up to 3 years. In the non-nintedanib group, there was one subject with rheumatoid arthritis and two subjects with systemic sclerosis. Each group had one subject who previously had had a myocardial infarction. We evaluated Gal-3 levels in those receiving nintedanib versus those not receiving nintedanib. Of these patients, 21 were diagnosed with IPF and 20 with non-IPF-ILD (e.g. nonspecific interstitial pneumonia, sarcoidosis). Most patients receiving nintedanib had IPF. As shown in Table 1, other demographic parameters between the groups were comparable. Nevertheless, nintedanib-receiving patients had significantly higher levels of serum Gal-3 (15.6 ± 0.8 ng/ml versus 21.2 ± 3 ng/ml, p < 0.05) (Figure 4). When analyzing only the subgroup of patients with IPF (n = 21), Gal-3 levels were similarly elevated (16.3 ± 3.4 ng/ml versus 22.2 ± 11 ng/ml, p = 0.37), yet did not reach significance due to the low number of samples.
Table 1.

Patient demographic data.

No nintedanib n = 30Nintedanib n = 11p value
Age, years61.7 ± 1369.4 ± 7.90.08
Gender (% male)15 (50%)9 (81.8%)0.07
BMI27.7 ± 5.927.6 ± 40.94
Smoker13 (43.3%)2 (18.2%)0.24
Steroid treatment10 (33.3%)2 (18.2%)0.38
FEV1 (%)75.6 ± 23.180 ± 20.20.60
FVC (%)75 ± 21.775.5 ± 14.50.96
DLCO (%)52.9 ± 18.446.8 ± 13.80.37
Resting O2 (%)95.3 ± 3.193.35 ± 5.20.31
Diabetes9 (30%)5 (45.5%)0.35
COPD2 (6.7%)1 (9.1%)0.79
IHD4 (13.3%)3 (27.3%)0.29
IPF12 (40%)10 (90.9%)0.01[$]
NSIP13 (43%)0
Other ILDs[*]5 (16.7)

Other ILDS included sarcoidosis, vasculitis, fibrocystic lung, and common variable immunodeficiency with pulmonary fibrosis.

Chi-square analysis for IPF, NSIP, and other ILDs.

BMI, body mass index; COPD, chronic obstructive pulmonary disease; DLCO, diffusing capacity; FEV1, forced expiratory volume in 1 s; FVC, forced vital capacity; IHD, ischemic heart disease; ILD, interstitial lung disease; IPF, idiopathic pulmonary fibrosis; NSIP, nonspecific interstitial pneumonia.

Figure 4.

Patients receiving nintedanib show elevated Gal-3 serum levels.

Serum samples were analyzed for Gal-3 using ELISA. Values are means ± SE.

*p ⩽ 0.05, n = 41.

ELISA, enzyme-linked immunosorbent assay; Gal-3, galectin-3; SE, standard error.

Patient demographic data. Other ILDS included sarcoidosis, vasculitis, fibrocystic lung, and common variable immunodeficiency with pulmonary fibrosis. Chi-square analysis for IPF, NSIP, and other ILDs. BMI, body mass index; COPD, chronic obstructive pulmonary disease; DLCO, diffusing capacity; FEV1, forced expiratory volume in 1 s; FVC, forced vital capacity; IHD, ischemic heart disease; ILD, interstitial lung disease; IPF, idiopathic pulmonary fibrosis; NSIP, nonspecific interstitial pneumonia. Patients receiving nintedanib show elevated Gal-3 serum levels. Serum samples were analyzed for Gal-3 using ELISA. Values are means ± SE. *p ⩽ 0.05, n = 41. ELISA, enzyme-linked immunosorbent assay; Gal-3, galectin-3; SE, standard error.

Discussion

IPF is a progressive disease with poor survival and limited treatment options.[28] Treatment options currently available show some reduced disease progression, yet their effect is still rather limited. Newly discovered pathways in IPF, such as Gal-3, are now being tested in clinical trials on top of nintedanib. Thus, we explored the effect of nintedanib on Gal-3 expression. Using in vitro and in vivo models, we showed that Gal-3 expression was significantly elevated by nintedanib. These findings highlight the possibility of combined inhibition for patients with progressive ILD. Nintedanib is a small tyrosine kinase inhibitor (TKI) that acts primarily, but not exclusively, downstream of PDGF, FGF, and VEGF, all of which are major factors in IPF pathogenesis, as well as angiogenesis. These factors are related to antifibrotic and anti-inflammatory pathways in animal models.[28,29] Nintedanib was previously shown to inhibit STAT3 signaling in IPF models.[30,31] However, TKIs may also lead to activation of various bypass signaling pathways, leading to resistance. Activation of STAT3 as the mechanism for resistance to TKIs has been previously suggested. Li et al. who showed that STAT3 activation was associated with gefitinib resistance in colorectal cancer cells.[32] Moreover, Wang et al. showed that epidermal growth factor receptor (EGFR)-TKIs lead to activation of Src/IL-6/STAT3 even in EGFR-TKI-sensitive lung cancer cells.[33] In another work, afatinib was shown to induce STAT3 activation through autocrine IL-6 production.[34] Since IPF and cancer share multiple signaling pathways,[35] and since Gal-3 was already shown to be elevated in cancer,[36] targeting both STAT3/Gal-3 and TKI activation may be an effective strategy for ILD treatment. IPF diagnosis is based on a combination of radiological or histological findings, which often include the usual interstitial pneumonia (UIP) pattern. In this pattern, the fibrosis must be heterogeneous, with normal lung adjacent to established fibrosis. Thus, the effect of IPF treatments on normal HLFs needs to be considered. Here, we show that HLFs exposed to nintedanib, without any additional stimulus, show STAT3 pathway activation. Thus, since STAT3 physically binds to the Gal-3 (LGALS3) promoter and induces its transcription,[37] this could serve as part of a potential mechanism for our findings. Moreover, IL-8 in HLFs exposed to nintedanib was also elevated. These results support the work by Nishi et al.,[38] which showed that increased Gal-3 in lungs may be related to fibrosis and disease resistance to immunosuppressive therapies by induction of angiogenesis and IL-8. The UIP pattern cannot be replicated in animal models of pulmonary fibrosis, which is probably the reason that despite the significant progress in our understanding of the molecular events underlying pulmonary fibrosis in animals, we have little knowledge about what regulates the progression of IPF in the human lung.[39] Gal-3 was previously shown to be increased in a mouse model of bleomycin-induced lung fibrosis.[40] Here, we show that our silica-induced fibrosis model also caused a similar increase, in parallel with elevation in other fibrotic markers. Interestingly, in spite of a significant reduction in fibrotic markers, nintedanib further elevated Gal-3 levels. This elevated expression was primarily in the AMs. MacKinnon et al. showed increased Gal-3 levels in bleomycin-treated mice lungs, in which the staining was also primarily observed in the AMs.[41] Therefore, it is reasonable to assume that the antifibrotic treatment may cause an increase in inflammatory cells that can later promote the fibrotic process. Since our animal study, as well as most others,[41] was limited to about 1 month, it is difficult to predict long-term outcomes. These findings should be studied in a long-term model. IPF patient serum, as well as broncho-alveolar lavage, samples, were previously shown to contain more Gal-3 than those from control subjects.[38] Here, we show that IPF tissue samples show increased levels of Gal-3, supporting previous findings. Elevated Gal-3 serum level was also found to be associated with ILD severity.[42] In the last part of our work, we tested serum samples from patients with ILD receiving nintedanib versus those that did not. Our results support previous findings and show that the average Gal-3 level in patients with ILD is above the control range. Moreover, according to a large meta-analysis for heart failure, the value for low risk was set at 17.8 ng/ml.[43] In our study, the nintedanib-receiving group had an average value of 21.2 ng/ml. It is worth noting that myocardial infarction was reported in five patients in the nintedanib group (1.6%) and one patient in the placebo group (0.5%) in INPULSIS-1, and in five patients in the nintedanib group (1.5%) and one patient in the placebo group (0.5%) in INPULSIS-2.[17] Thus, it would be of interest to study the long-term effects of nintedanib, as well as other antifibrotic treatments (e.g. pirfenidone), on Gal-3 levels in patients with ILD. Study limitations include a relatively low number of subjects in the patient serum analyses. In addition, it could be interesting to test the ‘before’ and ‘after’ nintedanib treatment for each patient. In conclusion, we showed that nintedanib elevated Gal-3 levels in two experimental models, as well as in ILD patient samples. These findings warrant further study for establishing a possible future treatment combination. Click here for additional data file. Supplemental material, sj-docx-1-taj-10.1177_2040622320968412 for Galectin-3 levels are elevated following nintedanib treatment by Gali Epstein Shochet, Alon Pomerantz, David Shitrit, Becky Bardenstein-Wald, Kjetil Ask, Mark Surber, Noa Rabinowicz, Yair Levy, Sydney Benchetrit, Evgeny Edelstein and Tali Zitman-Gal in Therapeutic Advances in Chronic Disease
  43 in total

1.  Tyrosine kinase inhibitor-induced IL-6/STAT3 activation decreases sensitivity of EGFR-mutant non-small cell lung cancer to icotinib.

Authors:  Jinyao Wang; Yizhe Wang; Chunlei Zheng; Kezuo Hou; Tieqiong Zhang; Xiujuan Qu; Yunpeng Liu; Jian Kang; Xuejun Hu; Xiaofang Che
Journal:  Cell Biol Int       Date:  2018-06-20       Impact factor: 3.612

Review 2.  Immunhistochemical expression of galectin-3 in cancer: a review of the literature.

Authors:  Tuğçe Cay
Journal:  Turk Patoloji Derg       Date:  2012

Review 3.  The regulation of inflammation by galectin-3.

Authors:  Neil C Henderson; Tariq Sethi
Journal:  Immunol Rev       Date:  2009-07       Impact factor: 12.988

4.  GRP78 and CHOP modulate macrophage apoptosis and the development of bleomycin-induced pulmonary fibrosis.

Authors:  Ehab A Ayaub; Philipp S Kolb; Zahraa Mohammed-Ali; Victor Tat; James Murphy; Pierre-Simon Bellaye; Chiko Shimbori; Felix J Boivin; Rocky Lai; Edward G Lynn; Šárka Lhoták; Darren Bridgewater; Martin Rj Kolb; Mark D Inman; Jeffrey G Dickhout; Richard C Austin; Kjetil Ask
Journal:  J Pathol       Date:  2016-06-07       Impact factor: 7.996

5.  Galectin-3 Is Associated with Restrictive Lung Disease and Interstitial Lung Abnormalities.

Authors:  Jennifer E Ho; Wei Gao; Daniel Levy; Rajalakshmi Santhanakrishnan; Tetsuro Araki; Ivan O Rosas; Hiroto Hatabu; Jeanne C Latourelle; Mizuki Nishino; Josée Dupuis; George R Washko; George T O'Connor; Gary M Hunninghake
Journal:  Am J Respir Crit Care Med       Date:  2016-07-01       Impact factor: 21.405

6.  Elevated plasma galectin-3 is associated with near-term rehospitalization in heart failure: a pooled analysis of 3 clinical trials.

Authors:  Wouter C Meijers; James L Januzzi; Christopher deFilippi; Aram S Adourian; Sanjiv J Shah; Dirk J van Veldhuisen; Rudolf A de Boer
Journal:  Am Heart J       Date:  2014-03-05       Impact factor: 4.749

7.  Fibroblast paracrine TNF-α signaling elevates integrin A5 expression in idiopathic pulmonary fibrosis (IPF).

Authors:  Gali Epstein Shochet; Elizabetha Brook; Lilach Israeli-Shani; Evgeny Edelstein; David Shitrit
Journal:  Respir Res       Date:  2017-06-19

Review 8.  Potential of nintedanib in treatment of progressive fibrosing interstitial lung diseases.

Authors:  Lutz Wollin; Jörg H W Distler; Elizabeth F Redente; David W H Riches; Susanne Stowasser; Rozsa Schlenker-Herceg; Toby M Maher; Martin Kolb
Journal:  Eur Respir J       Date:  2019-09-19       Impact factor: 16.671

9.  Nuclear PKM2 contributes to gefitinib resistance via upregulation of STAT3 activation in colorectal cancer.

Authors:  Qiong Li; Daoxiang Zhang; Xiaoying Chen; Lei He; Tianming Li; Xiaoping Xu; Min Li
Journal:  Sci Rep       Date:  2015-11-06       Impact factor: 4.379

View more
  1 in total

1.  Nintedanib enhances the efficacy of PD-L1 blockade by upregulating MHC-I and PD-L1 expression in tumor cells.

Authors:  Jingyao Tu; Haoran Xu; Li Ma; Chunya Li; Wan Qin; Xinyi Chen; Ming Yi; Li Sun; Bo Liu; Xianglin Yuan
Journal:  Theranostics       Date:  2022-01-01       Impact factor: 11.600

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.