Effects of propofol on cardiac function and miR-494 expression in rats with hepatic ischemia/reperfusion injury.

OBJECTIVE: This study aimed to investigate the effects of propofol on cardiac function and miR-494 expression in rats with hepatic ischemia/reperfusion (I/R) injury.
METHODS: Forty healthy adult male Sprague-Dawley rats were allocated to the sham operation group and three hepatic I/R injury groups. The I/R injury groups included I/R injury only (I/R group), treatment with propofol (propofol group), and treatment with propofol + overexpressed miR-494 (propofol+miR-494 group). Apoptosis of myocardial cells and changes in cardiac function indices, including left ventricular end-diastolic diameter, left ventricular end-systolic diameter, and left ventricular posterior wall thickness, as well as changes in miR-494, were monitored.
RESULTS: The apoptotic rate of myocardial cells in the I/R group was higher, cardiac function was deteriorated, and miR-494 levels were elevated compared with the sham group. The apoptotic rate was lower, cardiac function was improved, and miR-494 levels were suppressed in the propofol group compared with the I/R group. The apoptotic rate was higher, cardiac function was deteriorated, and miR-494 levels were elevated in the propofol+miR-494 group compared with the propofol group.
CONCLUSION: Propofol plays a vital role in preventing myocardial cell apoptosis and improvement of cardiac function by suppressing miR-494 in a hepatic I/R injury rat model.

Introduction

Ischemia results from restriction or interruption of blood supply to tissue required for cellular metabolism.[1] Hepatic ischemia/reperfusion (I/R) injury is the main complication of hemorrhagic shock, hepatectomy, and transplantation.[2] Hepatic I/R injury is the leading cause of liver damage during hepatectomy and liver transplantation, and is the main cause of graft dysfunction and liver failure after transplantation.[3] Moreover, hepatic I/R injury is a risk factor for acute and chronic rejection of liver transplantation characterized by exogenous antigen-independent local inflammation and hepatocellular death.[4] MicroRNAs (miRNAs), which are a class of small non-coding RNAs with a length of approximately 22 nucleotides,[5] regulate gene expression through a variety of mechanisms.[6] These miRNAs appear to participate in almost all biological processes because most protein-coding genes are assumed to be regulated by one or several miRNAs.[7] The miRNA miR-494 plays an essential role in many diseases. This miRNA has been identified as an important factor and a promising therapeutic target for lung cancer[8] and muscle-invasive bladder cancer.[9] Moreover, miR-494 is highly expressed in hepatocellular carcinoma (HCC), it may be related to tumor size and stemness markers, and it is a possible therapeutic target and a candidate biomarker for stratification of patients with advanced HCC.[10]

Propofol is an intravenous hypnotic agent used to induce and maintain sedation and general anesthesia, and it enhances the inhibitory neurotransmitter gamma-aminobutyric acid at the gamma-aminobutyric acid A receptor. Propofol is widely used owing to its favorable positive drug effect profile.[11] Additionally, propofol exerts protective effects against hepatic I/R injury owing to its antioxidant properties.[12] However, the effect of propofol on other organs remains largely unknown. Therefore, this study aimed to examine the effects of propofol on cardiac function and miR-494 levels in rats with hepatic I/R injury.

Materials and methods

Materials and reagents

Specific pathogen-free male rats were from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Propofol was purchased from Jiangsu Enhua Pharmaceutical Co., Ltd. (Jiangsu, China; (SFDA Approval No. H20123138).

Rat modeling

Healthy adult male Sprague-Dawley rats were randomly assigned into the sham operation group (sham group) and three hepatic I/R injury groups. The hepatic I/R injury groups included hepatic I/R injury only (I/R group), hepatic I/R injury with propofol treatment (propofol group), and hepatic I/R injury treatment with propofol + overexpressed miR-494 treatment (propofol+miR-494 group). Every procedure was approved by the Animal Care and Use Committee of the Affiliated Hospital of Guizhou Medical University (approval number: 1800952).

All rats were fasted on the day before surgery. On the day of surgery, an anesthetic was injected intraperitoneally. Puncture and intubation were performed to establish an intravenous pathway. An incision was made in the middle of the upper abdomen, exposing the first porta hepatis. The left hepatic artery and portal vein were clamped using a vascular clamp in the three hepatic I/R injury groups, but not the sham group, to induce 70% ischemia of the hepatic parenchyma. Perfusion was restored 30 minutes later. At the time of reperfusion, rats in each group were euthanized, and cardiac tissue specimens were extracted. Rats in the sham group received left laparotomy only. Rats in the propofol group received 5.0 mg/kg propofol 15 minutes before clamping the porta hepatis, followed by continuous infusion at a rate of 20 mg/(kg/hour). In addition to propofol, overexpressed miR-494 was applied to the propofol+miR-494 group. In this group, micrOFFTM antagomir-494 (80 mg/kg body weight) (Biosune Biotechnology, Shanghai, China) was injected into the tail vein for 3 consecutive days.

Detection of B-cell lymphoma-2-associated X and B-cell lymphoma-2 protein levels using western blotting

For measuring B-cell lymphoma-2 (Blc-2) and Bcl2-associated X (Bax) protein levels, total cell proteins were lysed using a radioimmunoprecipitation assay buffer and equally separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The proteins were subsequently transferred to a polyvinylidene difluoride membrane and sealed for 1 hour. Mouse anti-rat Bcl-2 monoclonal antibody and mouse anti-rat Bax monoclonal antibody were used (Amyjet Scientific Co., Ltd., Wuhan Hubei, China). A universal secondary antibody (goat anti-rabbit, Shanghai Yuanmu Biotechnology Co., Ltd., Shanghai, China) was added and reacted at room temperature for 2 hours. The membrane was washed three times, fixed, and developed with enhanced chemiluminescence.

Detection of the apoptosis index

Specimens of heart tissue were fixed, paraffin embedded, sliced, and subsequently dewaxed and blocked with hydrogen peroxide. TdT-mediated dUTP nick-end labeling staining (Wuhan Hualianke Biotechnology Co., Ltd., Wuhan, China) and anti-anti-fluorescein isothiocyanate (Shanghai Wines Da Industry Co., Ltd., Shanghai, China) were separately added after digestion of the membrane and nuclear proteins. Coloration was performed using diaminobenzidine (Beijing Future Biotechnology Co., Ltd., Beijing, China) and restaining using hematoxylin (Shanghai Qiantu Biotechnology Co., Ltd., Shanghai, China). Next, the samples were dehydrated and mounted. The apoptotic cells and the total number of cells in different fields under a high-magnification microscope (Shanghai Sanger Biotechnology Co., Ltd., Shanghai, China) were recorded, and the apoptosis index (AI) was calculated.

Changes in cardiac function in rats

Echocardiography (Xuzhou Hengda Electronics Co., Ltd., Xuzhou, China) equipped with 11-MHZ probe was performed to monitor the left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), left ventricular posterior wall thickness (LVPWT), and left ventricular fractional shortening (LVFS).

Detection of miR-494 expression by quantitative reverse transcription-polymerase chain reaction

Total RNA in the specimens of heart tissue was extracted with Trizol (Beijing Baiao Laibo Technology Co., Ltd., Beijing, China), and the concentration and purity were determined using an ultraviolet spectrophotometer (Shanghai Clinx Science Instrument Co., Ltd., Shanghai, China). RNA with an optical density of 260/optical density of 280 ratio of 1.8 to 2.0 was synthesized to cRNA using reverse transcriptase (Shanghai Kang Lang Biotechnology Co., Ltd., Shanghai, China) and oligonucleotides. The transcription system (20 μL) was as follows: 4 μL buffer, 2 μL reverse transcriptase, 2 μL total RNA, and 12 μL RNAse-free water. Reaction conditions were as follows: a 42°C water bath for 1 hour and 95°C water bath for 5 minutes. Amplification was performed using a polymerase chain reaction (PCR) instrument (Guangzhou Huafeng Biotechnology Co., Ltd., Guangzhou, China). Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as an internal control, and miR-494 levels were determined with specific primers (BeijingTaihe Biotechnology Co., Ltd., Beijing, China) (Table 1) using quantitative reverse transcription (qRT)-PCR. The PCR reaction system (20 μL) was as follows: 0.4 μL upstream primer, 0.4 μL downstream primer, and 0.5 μL Taq DNA polymerase, made up to 20 μL with deionized, distilled H2O. PCR conditions were 94°C for 10 s, and then 40 cycles of 94°C for 5 s, annealing at 52°C for 30 s, and 72°C for 15 s. Three replicates were established for each test and each test was repeated three times. The test outcomes were quantitatively analyzed, and the relative expression of miR-494 was calculated by the 2−△CT method.[13]

Table 1.

Primer sequences

	Upstream primer (5ʹ-3ʹ)	Downstream primer (5ʹ-3ʹ)
miR-494	UGAAACAUACACGGGAAACCUC	GGUUUCCCGUGUAUAUUUCAUU
GAPDH	ATGTTCGTCATGGGTGTGAA	GGTGCTAAGCAGTTGGTGGT

GAPDH, glyceraldehyde phosphate dehydrogenase.

Observation of pathological changes by hematoxylin and eosin staining

Samples were placed into 4% paraformaldehyde solution, dehydrated with alcohol, dehydrated with xylene, and embedded in paraffin. Sections of 5-mm thickness were cut and stained with hematoxylin and eosin.

Statistical methods

IBM SPSS version 20.0 (IBM Corp., Armonk, NY, USA) was used for analysis of data. Measurement data are expressed as mean ± standard deviation and were analyzed using the t-test. Comparison among multiple groups was performed with repeated measures analysis of variance. Differences were statistically significant at P < 0.05.

Results

Characteristics

Forty healthy adult male Sprague-Dawley rats were studied. The mean weight of the rats was 37.29 ± 4.32 g.

Expression of miR-494 in heart tissue

The mean expression level of miR-494 in the sham group (1.23 ± 0.22) and propofol group (1.64 ± 0.66) was significantly lower than that in the I/R group (2.76 ± 0.75, both P < 0.05). The mean expression level of miR-494 in the propofol+miR-494 group (2.37 ± 0.69) was significantly higher than that in the propofol group (P < 0.05) (Figure 1).

Figure 1.

Expression of miR-494 in heart tissue of rats. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion.

Bax and Bcl-2 protein levels in heart tissue

The mean Bax protein level in the I/R group (0.38 ± 0.03) was significantly higher than that in the sham group (0.21 ± 0.01) and propofol group (0.28 ± 0.02, both P < 0.05). The mean Bax protein level in the propofol+miR-494 group (0.31 ± 0.03) was significantly higher than that in the propofol group (P < 0.05) (Figure 2). The mean Bcl-2 protein level in the sham group (0.26 ± 0.01) and propofol group (0.39 ± 0.03) was significantly higher compared with that in the I/R group (0.21 ± 0.02, both P < 0.05). However, the mean Bcl-2 protein level in the propofol+miR-494 group (0.33 ± 0.02) was significantly lower than that in the propofol group (P < 0.05) (Figure 3).

Figure 2.

Bax protein levels in heart tissue of rats. bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; Bax, B-cell lymphoma-2-associated X.

Figure 3.

Bcl-2 protein levels in heart tissue of rats. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; Bcl-2, B-cell lymphoma-2; GAPDH, glyceraldehyde phosphate dehydrogenase.

AI of myocardial cells

The mean AI of myocardial cells in the sham group (3.48 ± 1.21) and propofol group (24.72 ± 3.13) was significantly lower than that in the I/R group (39.47 ± 3.59, both P < 0.05). However, the mean AI of myocardial cells in the propofol+miR-494 group (33.48 ± 3.43) was significantly higher than that in the propofol group (P < 0.05) (Figure 4).

Figure 4.

AI of myocardial cells. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; AI, apoptosis index.

Comparison of cardiac function indices

The mean LVEDD in the sham group (2.13 ± 0.32 mm) and propofol group (3.46 ± 1.21 mm) was significantly shorter than that in the I/R group (5.47 ± 1.38 mm, both P < 0.05). However, the mean LVEDD in the propofol+miR-494 group (4.75 ± 1.03 mm) was significantly longer than that in the propofol group (P < 0.05) (Figure 5). The mean LVESD in the sham group (1.58 ± 0.53 mm) and propofol group C (1.81 ± 0.69 mm) was significantly shorter than that in the I/R group (2.64 ± 0.78 mm, both P < 0.05). However, the mean LVESD in the propofol+miR-494 group (2.59 ± 0.74 mm) was significantly longer than that in the propofol group (P < 0.05) (Figure 6). The mean LVPWT in the sham group (1.85 ± 1.13 mm) and propofol group (2.13 ± 1.14 mm) was significantly thinner than that in the I/R group (3.73 ± 1.89 mm, both P < 0.05). However, the mean LVPWT in the propofol+miR-494 group (3.34 ± 1.34 mm) was significantly thicker than that in the propofol group (P < 0.05) (Figure 7). The mean LVFS in the sham group (57.39 ± 3.25 mm) and propofol group (47.56 ± 3.14 mm) was significantly higher than that in the I/R group (38.28 ± 4.59 mm, both P < 0.05). Additionally, the mean LVFS in the propofol+miR-494 group (40.28 ± 3.48 mm) was significantly lower than that in the propofol group (P < 0.05) (Figure 8).

Figure 5.

Comparison of LVEDD among the groups. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; LVEDD, left ventricular end-diastolic diameter.

Figure 6.

Comparison of LVESD among the groups. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; LVESD, left ventricular end-systolic diameter.

Figure 7.

Comparison of LVPWT among the groups. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; LVPWT, left ventricular posterior wall thickness.

Figure 8.

Comparison of LVFS among the groups. aP < 0.05 vs. group A; bP < 0.05 vs. group B; cP < 0.05 vs. group C. Group A, sham group; group B, I/R group; group C, propofol group; group D, propofol+miR-494 group

I/R, ischemia/reperfusion; LVFS, left ventricular fractional shortening.

Pathological changes in the liver

The hepatic cords in the sham group were regularly arranged, the sinusoids were not dilated, and there was only a small amount of inflammatory cell infiltration. In the I/R group, the liver tissue was swollen, and sinusoid dilatation, vacuolar degeneration and punctate necrosis of hepatocytes, a large number of red blood cells, and inflammatory cell infiltration were observed. These findings were accompanied by vacuolar degeneration and punctate necrosis. In the propofol group, the structure of the liver cells was clear, and the degree of swelling of hepatocytes and inflammatory cell infiltration was reduced compared with the I/R group. The degree of swelling of hepatocytes and inflammatory cell infiltration in the propofol+miR-494 group was worse than that in the propofol group (Figure 9).

Figure 9.

Pathological changes in the liver. A, Sham group; B, I/R group; C, propofol group; D, propofol+miR-494 group

I/R, ischemia/reperfusion.

Discussion

Ischemia may induce a series of biochemical reactions and cellular dysfunction, and even apoptosis.[14] The interaction between pro-survival and pro-apoptotic Bcl-2 family proteins is the primary factor controlling most apoptosis.[15] Bax and Bcl-2 are apoptotic proteins[16] and important regulators of programmed cell death and apoptosis.[17] After Bax and Bcl-2 are stimulated by apoptosis, they are activated and oligomerize on the outer mitochondrial membrane to mediate its permeabilization.[18] Bax is a gatekeeper for controlling outer mitochondrial membrane permeabilization in the process of apoptosis.[19] Bax is also a cell fate regulator, and is located in the cytosol with static monomer conformation, and plays an essential role in cell homeostasis and pathological cell death.[20] Bcl-2 is an anti-apoptotic protein,[21] which inhibits apoptosis by preventing cells from responding to stimulation.[22]

In this study, we found that protein levels of the pro-apoptotic protein Bax were increased and those of the anti-apoptotic protein Bcl-2 were decreased in rats with hepatic I/R injury. However, after propofol treatment, Bax protein levels were decreased and Bcl-2 protein levels were increased. These findings suggested that hepatic I/R injury accelerated apoptosis of myocardial cells and damaged the myocardium. However, propofol was able to reduce apoptosis, as shown by the reduced AI of myocardial cells in the propofol group. A previous study showed that propofol reduced mitochondrial damage and improved mitochondrial biogenesis by reducing caveolin-3 during hyperglycemia, thus attenuating myocardial I/R injury.[23]

When we compared cardiac function in each group, we found that the ventricles of rats were enlarged and thickened and ventricular systolic function was decreased in the I/R group. However, this condition improved after propofol treatment. Therefore, propofol plays a favorable role in protection of myocardial cells during hepatic I/R injury therapy. Additionally, propofol was found to protect myocardial cells from H2O2-induced injury by inhibiting mitochondria- and endoplasmic reticulum-mediated apoptosis signaling pathways.[24]

Moreover, propofol reduces apoptosis of myocardial cells induced by hepatic I/R injury in rats and upregulates mRNA and protein expression of sarcoplasmic reticulum Ca2+-ATPase.[25] All of these previous studies mentioned above indicate the protective effect of propofol on myocardial cells. In our study, miR-494 was highly expressed in the heart tissue of rats with hepatic I/R injury. miR-494-3p is an oncogene that is upregulated in HCC. High levels of miR-494-3p are associated with aggressive clinicopathological features and they predict a poor prognosis in patients with HCC.[26] Additionally, miR-494 activates the phosphoinositide 3‐kinase/AKT signaling pathway by downregulating phosphatase and tensin homolog deleted on chromosome 10, thus attenuating hepatic I/R injury. In our study, a weakened protective effect of propofol on myocardial cells was observed after propofol injection and miR-494 overexpression treatment. Therefore, we speculate that the protective effect of propofol may be related to miR-494. However, currently, there are no relevant reports to support this possibility.

There are several limitations in this study. One limitation is that inflammatory factors and other indicators were not detected and analysis of prognosis was not conducted. Additionally, the relationship between the protective effect of propofol on myocardial cells and miR-494 levels was not examined. These issues will be addressed in future studies.

In conclusion, propofol plays a vital role in preventing apoptosis of myocardial cells and improving cardiac function by suppressing miR-494 expression in the hepatic I/R injury rat model.