Literature DB >> 33649963

An innovative and user-friendly smartphone-assisted molecular diagnostic approach for rapid detection of canine vector-borne diseases.

Archana Upadhyay1,2, Raza Muhammad Waleed3, Jinhua Wang1,4, Jianguo Zhao1,2, Qingfeng Guan1,2, Chenghong Liao5,6, Qian Han7,8.   

Abstract

Present-day diagnostic tools and technologies for canine diseases and other vector-borne parasitic diseases hardly meet the requirements of an efficient and rapid diagnostic tool, which can be suitable for use at the point-of-care in resource-limited settings. Loop-mediated isothermal amplification (LAMP) technique has been always a method of choice in the development and validation of quick, precise, and sensitive diagnostic assays for pathogen detection and to reorganize point-of-care (POC) molecular diagnostics. In this study, we have demonstrated an efficient detection system for parasitic vector-borne pathogens like Ehrlichia canis and Hepatozoon canis by linking the LAMP assay to a smartphone via a simple, inexpensive, and a portable "LAMP box," All the components of the LAMP box were connected to each other wirelessly. This LAMP box was made up of an isothermal heating pad mounted below an aluminum base which served as a platform for the reaction tubes and LAMP assay. The entire setup could be connected to a smartphone via an inbuilt Wi-Fi that allowed the user to establish the connection to control the LAMP box. A 5 V USB power source was used as a power supply. The sensitivity of the LAMP assay was estimated to be up to 10-6 dilution limit using the amplified, purified, and quantified specific DNA templates. It can also serve as an efficient diagnostic platform for many other veterinary infectious or parasitic diseases of zoonotic origin majorly towards field-based diagnostics.

Entities:  

Keywords:  Canine; Ehrlichia canis; Hepatozoon canis; LAMP box; Parasitic vector-borne diseases; Point-of-care

Year:  2021        PMID: 33649963      PMCID: PMC7920752          DOI: 10.1007/s00436-021-07077-z

Source DB:  PubMed          Journal:  Parasitol Res        ISSN: 0932-0113            Impact factor:   2.289


Introduction

Pathogenic organisms are the agents of infectious diseases, and their transmission can be threatening in all respects and can result in economic losses. Promising diagnostic methods are therefore needed for the proper diagnosis and management of such diseases. In such cases, point-of-care (POC) tests can be a boon especially in resource-limited or field settings. Nucleic acid (NA) detection using point-of-care (POC) is a rapidly evolving field which has great application in clinical and commercial setups (Auroux et al. 2002; Yager et al. 2008; Lui et al. 2009; Arora et al. 2010; Kovarik et al. 2013; Gauglitz 2014; Sackmann et al. 2014). NA-based POC diagnostic platforms require NA isolation and purification before proceeding for amplification (Easley et al. 2006), and these are very important and influential parameters. Polymerase chain reaction (PCR) is the most routinely used method for NA amplification which undergoes multiple thermo-cycling steps for complete amplification of NA. On the contrary, isothermal amplification of NA drastically cuts down the thermo-cycling stages, which is more economical without compromising with the quality of DNA (Asiello and Baeumner 2011; Chang et al. 2013; Yan et al. 2014). Many interesting and efficient technological advances in POC testing can play a vital role in patient care and public health care by providing user-friendly, handy, smarter, rapid, economical, and pervasive diagnostic setups on the go (Jani and Peter 2013; Vashist et al. 2014; Vashist et al. 2015). Subsequently, many such newly developing nucleic acid amplification test (NAAT) devices are shifting from the classical laboratory-based platforms to mobile, comprehensive, lucid, and economical POC testing platforms (Yang and Rothman 2004; Chin et al. 2012; Jiang et al. 2014; Priye and Ugaz 2016). Loop-mediated isothermal amplification (LAMP) has popped up to be a very popular isothermal NAAT for NA detection due to its less complex thermal steps and higher sensitivity (Notomi et al. 2000; Notomi et al. 2015; Song et al. 2016; Tian et al. 2016). Moreover, isothermal NAATs do not necessarily require thermal cyclers, thereby eliminating the need of complex hardware and software’s for such kind of tests. For end-point result analysis, LAMP assay generally relies on turbidity monitoring and using indicators like hydroxynaphthol blue (HNB) (Lau et al. 2015), SYBR green dye as a post-reaction analysis (Iwamoto et al. 2003), or agarose gel electrophoresis (Notomi et al. 2000). Apart from LAMP assay, there have been many other assays like the rolling circle amplification (RCA) (Monsur Ali et al. 2014), strand displacement amplification (SDA) (Shi et al. 2014), signal-mediated amplification of RNA technology (SMART) (Hall et al. 2002), nucleic acid sequence-based amplification (NASBA) (Compton 1991), single primer-triggered isothermal amplification (Ma et al. 2015), helicase-dependent amplification (HDA) (Vincent et al. 2004), and cross priming amplification (CPA) (Xu et al. 2012; Craw and Balachandran 2012; Chang et al. 2013) which are used to achieve isothermal amplification of NA. Still, LAMP has been faster, more stable, and sensitive for NA detection (Notomi et al. 2000; Notomi et al. 2015). Interestingly, LAMP-based methods have shown to produce >50-fold more amplicon than PCR-based techniques (Seyrig et al. 2011). Apart from this, LAMP assay provides a flexibility to amplify medium- to long-range template strands of nucleic acids (>130 bp and <300 bp), which makes it highly favorable for amplification of NA of several infectious pathogens (Notomi et al. 2000). LAMP assay amplification can give good results even in the presence of certain inhibitors (Abdul-Ghani et al. 2012) and some food ingredients (Kaneko et al. 2007; Wang et al. 2008; Kiddle et al. 2012). The specificity of the LAMP assay is due to four to six different specific primers and a Bst polymerase enzyme used for amplification (Notomi et al. 2000; Parida et al. 2008; Craw and Balachandran 2012; Tanner and Evans Jr. 2014). Many significant advances have been developed for detecting the LAMP amplicons including electrochemical detection mechanism (Zhang et al. 2014), pH sensing modality, and many more (Ahmed et al. 2008; Toumazou et al. 2013; Zhang et al. 2014). Hepatozoon canis causes canine hepatozoonosis which is one of the most commonly occurring infections found in the canine populations globally (Otranto and Dantas-Torres 2010; Singh et al. 2017a). The causative parasite involved in it has a relatively complex and unique life cycle, where the infection takes place on ingesting the ixodid tick which already contains the mature oocysts of the parasite (Nava et al. 2015). The brown dog tick, Rhipicephalus sanguineus (sensu lato), has been reported to be the sole vector responsible for H. canis infection (Gavazza et al. 2003; Nava et al. 2015). Conventional parasitological techniques such as microscopy have been used for the diagnosis of canine hepatozoonosis (Baneth and Shkap 2003). According to some previous studies, several sensitive tests such as indirect fluorescent antibody test (IFAT) and enzyme-linked immunosorbent assay (ELISA) have been proven to be sensitive especially in diagnosing chronic infections (Shkap et al. 1994; Mylonakis et al. 2005). Molecular diagnostic assays such as PCR and real-time PCR have been employed for the identification and diagnosis of H. canis infections (Otranto et al. 2011; Abd Rani et al. 2011; Aktas et al. 2015; Singh et al. 2017a). PCR being a gold standard for diagnosis, these molecular tests win over other tests due to their high sensitivities and specificities for the detection of such infections from the host as well as the vector (Latrofa et al. 2014; Singh et al. 2017b). However, PCR assays are not easily accessible in the field, due to their higher costs and complex mechanism (Mandal et al. 2015). LAMP assays have been substantially used for the precise and timely diagnosis of various infectious agents or pathogens (Notomi et al. 2000; Parida et al. 2008; Notomi et al. 2015; Mandal et al. 2015). Furthermore, it is easier to evaluate the end-point results either by dye-based methods or by visualizing the presence of turbidity in positive reactions (Mori et al. 2001; Karanis and Ongerth 2009). In the field of veterinary diagnosis, LAMP assays have been developed and effectively used for the detection of Babesia gibsoni (Ikadai et al. 2004; Mandal et al. 2015), Trypanosoma evansi (Thekisoe et al. 2005), Theileria equi (Alhassan et al. 2007), Babesia caballi (Alhassan et al. 2007), Cryptosporidium parvum (Karanis et al. 2007), Babesia orientalis (He et al. 2009), Toxoplasma gondii (Krasteva et al. 2009), Theileria parva (Thekisoe et al. 2010), Theileria sergenti (Wang et al. 2010), and Tritrichomonas foetus (Oyhenart et al. 2013). Canine monocytic ehrlichiosis (CME), significantly marked by the presence of clinical and hematological signs, is caused by a tick-borne bacterium called Ehrlichia canis (Harrus and Waner 2011). CME has been known to have similar clinical signs and hematological alterations like other tick-borne diseases which can be quite challenging for veterinarians for its diagnosis and treatment (Harrus and Waner 2011). It occurs as a multi-systemic disease, ranging from an acute to subclinical and, in some cases, leading to a chronic phase (Harrus and Waner 2011). The pathogen is widespread globally and is predominantly found in tropical and subtropical regions. Moreover, co-infection of dogs with E. canis and other tick-transmitted pathogens has also been reported in such regions, where the vectors are prevalent (Mekuzas et al. 2009; Santos et al. 2009; Al Izzi et al. 2013; Eiras et al. 2013; De Tommasi et al. 2013). Several molecular diagnostic tests such as PCR, nested PCR, and real-time PCR assays have been previously used to detect E. canis in dogs (McBride et al. 1996; Stich et al. 2002; Doyle et al. 2005; Kledmanee et al. 2009; Nakaghi et al. 2010; Peleg et al. 2010; Cardozo et al. 2011). The 16S rRNA nested PCR assay developed for the diagnosis and detection of E. canis has been frequently used; however, a nested PCR assay targeting the p30 gene has been recently reported to be more sensitive (Stich et al. 2002). Despite of being highly specific and sensitive nested PCR tests, they are often judged due to their time-consuming process and cross-contamination issues, which may lead to false-positive results (Cardozo et al. 2011). On the other hand, LAMP assays are sensitive and specific and have an advantage of producing and visualizing the results in relatively lesser period of time (Notomi et al. 2000). The gold standard nucleic acid amplification tests (NAAT), multiplexed quantitative reverse-transcription polymerase chain reaction (qRT-PCR), and many such tests require sophisticated, expensive, power-consuming, and bulky thermal cyclers (for different thermal conditions) with fluorescence detection systems (for performing real-time fluorescence detection). These techniques come with conditions like high turnaround time and complexity; hence, these factors make them less favorable for point-of-care testing and their application in fields. Recently, many evolving NAAT devices are transiting from the traditional benchtop-based detection systems towards more complete, mobile, and inexpensive field-based systems (Yang et al., 2004; Chin et al. 2012; Jiang et al. 2014; Priye and Ugaz 2016). In the present study, we report the development of a smartphone-based rapid, accurate, and networked diagnostic LAMP box system for canine infectious diseases. This LAMP box comprises an isothermal heating pad which serves as a platform for placing the reaction tubes, heat sensor to check the temperatures, a UV, and white LED lights for visualizing the results, and then this entire setup can be connected to the smartphone via an inbuilt Wi-Fi which allows the user to establish a connection, and subsequently it leads to the simple graphical user interface (GUI) which can control the steps of reaction of the LAMP box. A 5 V USB power source was used to supply power for the LAMP assay in the box. This developed platform can be used for many such infectious diseases particularly towards field-based diagnostics.

Materials and methods

Sample preparation and PCR assay

Previously collected and identified positive blood samples for E. canis and H. canis from dogs of Hainan province, which were confirmed by DNA sequencing, were processed for fresh DNA isolation (unpublished data). Total DNA was isolated using 200 ul of EDTA-anticoagulated blood samples by using TIANamp blood DNA kit (TIANGEN, China) and Sangon Biotech Ezup blood DNA kit according to the manufacturer’s protocol. DNA concentrations and purities were determined by measuring the absorbance using a NanoDrop Spectrophotometer (Thermo Scientific, USA). The extracted DNA samples were eluted in nuclease-free water and processed and/or stored at −20 °C for downstream applications. The DNA samples which were isolated were subjected to amplification by PCR using previously developed PCR assays (Inokuma et al. 2002; Pinhanelli et al. 2015). The primers used and their thermal cycling conditions are summarized in Table 1.
Table 1

Primer sets with respective product sizes and thermal cycling conditions for DNA amplification of the pathogens in dogs

Pathogen/tick speciesGenePrimersPCR conditionsReference
Hepatozoon canis18S rRNA

HEP-F: ATACATGAGCAAAATCTCAAC

HEP-R: CTTATTATTCCATGCTGCAG

95 °C, 5 min; 35 cycles [95 °C 60 s, 58 °C 60 s, 72 °C 60 s]; 72 °C, 5 minInokuma et al. (2002)
Ehrlichia canisP30

P30-1SPF: ATGGGTGGCCCAAGAATAGAACTTG

P30-1SPR: CATCCTGCTATGGTTCCTAGTG

95 °C, 5 min; 40 cycles [95 °C 45 s, 60 °C 30 s, 72 °C 30 s]; 72 °C, 5 minPinhanelli et al. (2015)
Primer sets with respective product sizes and thermal cycling conditions for DNA amplification of the pathogens in dogs HEP-F: ATACATGAGCAAAATCTCAAC HEP-R: CTTATTATTCCATGCTGCAG P30-1SPF: ATGGGTGGCCCAAGAATAGAACTTG P30-1SPR: CATCCTGCTATGGTTCCTAGTG End-point PCR assays on the basis of the 18S rRNA gene of H. canis and p30 gene of E. canis were performed, which consisted of 1 μl of DNA solution, 12.5 μl of 2x Buffer for TransGen Biotech PCR Super Mix, 5 μl of 2 mM dNTPs, 3 μl of 25 mM MgSO4, 0.5 μl of forward primer, 0.5 μl of reverse primer (50 pmol/μl each) (Table 2), 1 μl of 2 x EcoTaq PCR Super Mix (1 U/μl), and double distilled water to make up a final volume of 25μl. The reaction mixtures were cycled in an Eppendorf gradient thermal cycler (Eppendorf). PCR products were examined on 2% agarose gel stained with 0.4 μg/ml ethidium bromide using a Quick-Load 5kb DNA Ladder marker (TAKARA BIO, Inc. China), visualized under the Gel Doc XR+ Imaging system (BIO-RAD Laboratories, Inc.).
Table 2

Nucleotide sequences of LAMP primers used for the detection of H. canis (18S rRNA gene) and E. canis (p30 gene)

PrimersTypeGenesPathogen speciesSequences (5′→3′)References
F3-p30Forward outer primerP30Ehrlichia canisGGCCCAAGAATAGAACTTGAPinhanelli et al. 2015
B3-p30Reverse outer primerP30Ehrlichia canisCCTTCAATTATTATGTCATAGCATGPinhanelli et al. 2015
Fip-p30Forward inner primerP30Ehrlichia canisTGTGTGCGCCGTTCTTATAATTgaattcAGTTCTGTACGAGACATTCGPinhanelli et al. 2015
Bip-p30Reverse inner primerP30Ehrlichia canisCATCATAGTTCAGCAACAAACATGTgaattcAATGATAAGTCAATTAACCCTTCPinhanelli et al. 2015
F3Forward outer primer18S rRNAHepatozoon canisGCAAAGTGAAAACAGGCGSingh et al. 2019
B3Reverse outer primer18S rRNAHepatozoon canisAGAATTGGGTAATTTGCGCSingh et al. 2019
FIPForward inner primer18S rRNAHepatozoon canisGCCACGGTAAGCCAATACCATAAATCATTCAAGTTTCTGACCTSingh et al. 2019
BIPReverse inner primer18S rRNAHepatozoon canisGTGACGGTTAACGGGGGATTGTGGTAGCCGTTTCTCAGSingh et al. 2019
Nucleotide sequences of LAMP primers used for the detection of H. canis (18S rRNA gene) and E. canis (p30 gene)

LAMP assay

The LAMP assay was carried out by using previously used primers for H. canis and E. canis as mentioned in Table 2. The LAMP reaction was performed in 25μl reaction volumes as described (Notomi et al. 2000), with fewer modifications. Each LAMP reaction of 25 μl contained 9 μl nuclease-free water, 2.5 μl 10x Isothermal Amplification Buffer Pack (contains 20mM Tris-HCl, 10mM (NH4)2SO4, 50mM KCl, 2mM MgSO4, 0.1% Tween1 20) (New England Biolabs), 3.5 μl 10 mM each dNTPs (New England Biolabs), 1 μl 100 mM MgSO4 (New England Biolabs), 3.5 μl 5M Betaine (Affymetrix), 40 pmol each of FIP and BIP primers, 50 pmol each of the F3 and B3 primers, 1 μl Fluorescent Detection Reagent (FD), 1.0 μl Bst 2.0 WarmStart DNA Polymerase (8 units/μl) (New England Biolabs), and 1 μl of sample DNA template. Contamination issues were resolved to its maximum by addition of mineral oil on the top part of each reaction tube. The amplification reaction was performed at 64 °C for 45 min and terminated at a high temperature of 92 °C for 2 min. Nuclease-free water was used as a negative control template. After incubation, the tubes containing the amplified DNA target were checked visually by two persons to check the color changes observed, purple color represented a positive test, whereas no color change referred to as negative control. To confirm the reaction, 15μl of each LAMP product was examined on 2% agarose gel stained with 0.4 μg/ml ethidium bromide using a Quick-Load 5kb DNA Ladder marker (TAKARA BIO, Inc. China), visualized under the Gel Doc XR+ Imaging system (BIO-RAD Laboratories, Inc.).

Sensitivity, specificity, and diagnostic performance of LAMP assay

The isolated DNA samples were processed and were subjected to the 18S rRNA and P30 PCR assays (Table 1) for the amplification of H. canis and E. canis, followed by the confirmation of respective amplifications by observing specific bands by agarose gel electrophoresis. The amplified PCR products were purified using the DNA gel purification kit (Sangon prep Kit) as per the manufacturer’s protocol, and DNA was eluted using 30μl of elution buffer. The concentrations and purities of the eluted samples were determined by measuring the absorbance using the NanoDrop spectrophotometer (Thermo Scientific, USA). Tenfold serial dilutions of the eluted and quantified DNA were done by using the eluted and quantified DNA (1μl) which were used to detect the sensitivity and detection limit of the assay. The amplicons from PCR were further confirmed by 2.0% agarose gel electrophoresis containing ethidium bromide. To determine the specificity of the LAMP assay, a positive DNA sample of B. canis vogeli was also used as a DNA template for the LAMP assay to validate its specificity and cross reactivity. In order to assess the usefulness of the optimized smartphone-enabled LAMP assay in a BOX as a smart and a rapid diagnostic tool, representative samples from the previously collected, identified (positive and negative), and extracted genomic DNA from the dogs (unpublished data) were tested using this platform. The diagnostic performance of the smartphone-assisted LAMP box was evaluated using a total number of 226 DNA samples of dogs (unpublished data).

Smartphone-assisted portable LAMP box

A 5V isothermal heating pad (COM-11288; 5VDC), UV LED light (Lite-On Inc.; Part# LTPL-C034UVH385), and white LED light (Panasonic Electronic components; Part LNJ03004BDD1) were maneuvered via an Arduino esp8266 microcontroller (ESP8266 ESP-01 Wi-Fi Arduino) which could wirelessly connect to a smartphone. Here, we used the iPhone 7 model (R-62000612). A hard cardboard box was used to assemble all the components. The inner and the outer dimensions of the box were approximately 32.5*23*17.5 cm and 34*25*18.2 cm, respectively (Fig. 1).The entire box was covered by a black film to facilitate smooth and uninterrupted visualization of results under UV light (Fig. 2). The highly detailed description about the LAMP box has been mentioned in the Supplementary Information section (Supplementary Text 1: Smartphone-assisted portable LAMP box).
Fig. 1

Raw image of the portable LAMP box displaying the components of the box in an open form. a Arduino esp8266, b power source, c heat sensor, d isothermal heating pad, e UV LED light, and f white LED light

Fig. 2

White LED light (a) and ultraviolet (UV) LED light, (b) for viewing the sample results after the LAMP assay

Raw image of the portable LAMP box displaying the components of the box in an open form. a Arduino esp8266, b power source, c heat sensor, d isothermal heating pad, e UV LED light, and f white LED light White LED light (a) and ultraviolet (UV) LED light, (b) for viewing the sample results after the LAMP assay

Statistical analysis

The sensitivity of the LAMP assay was calculated at 95% confidence intervals (CI) for using the SPSS V.17.0 program.

Results

The optimal results and appropriate reaction conditions, which were represented by a characteristic ladder-like pattern generally observed for LAMP products, were accomplished successfully at 64°C for a time period of 45 min. A series of serial dilutions of the template DNA from the amplified LAMP products of E. canis p30 gene and H. canis 18S rRNA gene, when subjected to agarose gel electrophoresis, demonstrated similar ladder-like patterns for the same. The amplified PCR product from the 18S PCR assay was purified and consequently quantified and was further 10-fold diluted to achieve the sensitivity of the LAMP assay (Fig. S1a). The sensitivity of the LAMP assay was estimated to be up to 10−6 dilution limit using the amplified and purified DNA having average concentration of 648.6 ng/ul and 550.2 ng/ul for H. canis and E. canis, respectively. 10−6 dilution limit of the dilution series (Fig. S1b) was observed to be the limit of detection for the LAMP assay on the basis of the ladder-like pattern observed in the agarose gel electrophoresis images. The same tubes were observed under UV and showed the same results with detection limit of 10−6 dilution (Fig. S1b). Moreover, no cross amplification was seen after the addition of the positive DNA templates of B. canis vogeli, as evident from the agarose gel electrophoresis (Fig. S2a) and simultaneously observed under UV light (Fig. S2b). Following the incubation step of the LAMP assay, the amplified DNA contained in a reaction tube resulting from the LAMP assay was visualized by two observers by naked eyes, who were alternatively blinded to the setup of the assay, during and after the entire experiment (Fig. S3). Pinkish purple (dark blue to light blue on long-term/short-term storage of the LAMP products) corresponded to a positive reaction (presence of amplification) and no color change or transparent as a negative reaction. The diagnostic capacity of the smartphone-assisted portable LAMP box as a rapid and efficient diagnostic tool was addressed by testing the previously collected and identified genomic DNA (unpublished data) using the LAMP box, which revealed that 5.3% (12/226) and 15.0% (34/226) of samples were positive for H. canis and E. canis, respectively, which clearly matched with the previously collected data for the same samples. The results were in agreement with the observed results. The LAMP assay was statistically checked for its sensitivity, and the corresponding values were represented at 95% confidence intervals (CI), and the observed sensitivity was around 96.4% falling within a range of 89.5–100.0% using the SPSS V.17.0 program. All the data of the LAMP assay was found to be statistically significant at p < 0.01. In this study, we developed a lucid, comprehensible, economic, competitive, and a mobile LAMP detection system that utilizes the rigorous and robust LAMP assay for canine parasitic vector-borne infectious diseases and the flexibility and adaptability of smartphones to facilitate in-field POC diagnostics (Fig. 3).
Fig. 3

Schematic representation of the portable LAMP box settings. A Isothermal heating pad, B LED white light, C UV LED light, D heat sensor, E Arduino esp8266, and F camera of any smartphone

Schematic representation of the portable LAMP box settings. A Isothermal heating pad, B LED white light, C UV LED light, D heat sensor, E Arduino esp8266, and F camera of any smartphone The comprehensive NAAT device comprised the following primary modules: (A) isothermal heating pad, (B) LED white light, (C) LED UV light, (D) heat sensor, (E) Arduino esp8266, and (F) a smartphone (Fig. 3). The isothermal heating pad could accommodate 5–6 0.5 ml Eppendorf reaction tubes, and hence, 5–6 samples can be processed at a time. Thermal parameters provided in the thermal cyclers or PCR machines which are sold by high-end reputed companies and brands are often tricky and intricate due to their bulky nature and huge thermal blocks. Distinctively, the isothermal nucleic acid amplification devices use less complicated thermal platforms. For instance, in this platform, we employed a small isothermal heating pad that was operated by using an externally available power source of 5 V. The heater that we used utilized comparatively lesser energy which was fulfilling its need to provide and maintain a consistent surface temperature profile for 45 min. Currently, most of the thermal cyclers are using silver blocks to facilitate heat resistant and uninterrupted fluctuations in the temperatures. Here, we used a very simple and handy miniature aluminum block with grooves which could easily withstand high temperatures and fluctuations. Also, isothermal heaters often require modified PCR tubes. We tried to keep the experimental profile simple and easily available by using the conventionally used PCR tubes used in laboratory to process the LAMP tests. The isothermal heating pad, LED lights (UV and white), and heat sensor were initialized wirelessly through the webpage opened in the smartphone (router: 192.168.4.1). This was done through the Arduino esp8266 (Fig. 4a), which when connected, permitted the user end to recognize and set up a Wi-Fi connection named HanVet through the control screen panel (Fig. 4b). It directed it to a screen which had three tabs on the main screen (i) Run test tab, (ii) UV On tab, and (iii) UV Off tab (Fig. 4c).
Fig. 4

a Mobile screen showing the router address for launching the webpage for the LAMP set up, b Wi-Fi connection HanVet establishment through the control screen panel, and c GUI page for the LAMP setup

a Mobile screen showing the router address for launching the webpage for the LAMP set up, b Wi-Fi connection HanVet establishment through the control screen panel, and c GUI page for the LAMP setup Once the router or the webpage was launched, the control panel screen permitted the end-point user to set up a connection with the LAMP box, managed the heater temperature, and monitored the thermal profile on real-time basis as an ongoing process which could be easily viewed on the screen of the smartphone. The LAMP box was covered using a printed black paper to facilitate unblocked viewing of the end-point results and to provide consistent LED illumination. The unique features of this smartphone-enabled LAMP box are its portability and its usage in field applications.

Discussion

Here, we demonstrate the idea of a point-of-care testing system for canine parasitic vector-borne diseases, utilizing any conventional smartphone that couples with the LAMP assay to facilitate mobile detection of diseases of zoonotic concern. The nucleic acid tests (NAT) serve as a valuable, much reliable, and advanced diagnostic tool for the detection and identification of pathogens, in combination with clinical findings and serological tests. This smartphone-enabled LAMP box contains the entire setup for processing the LAMP reaction and further visualizing the results. This entire setup is connected to our smartphone via Wi-Fi. All the software programming has been done using C language. This LAMP box is a portable, cost-effective diagnostic platform for diagnosis of several vector-borne diseases of the canine populations. Although many technologies using the smartphone and LAMP assay have been previously developed, like the smartphone-based detection assay for Zika, chikungunya, and dengue viruses using a multiplex platform and quenching techniques for accurate detection in a multiplex system (Teoh et al. 2013; Priye et al. 2017), but these involve an expensive setup and quenching dyes for differentiating between different targets in a closed system. On the contrary, our smartphone-enabled portable LAMP assay is an economical, user-friendly, and specific assay for the detection of canine infectious diseases. It does not require the need of additional quenching dyes; it just requires the addition of a fluorescent detection dye for the viewing of a positive sample. Our developed assay serves as a qualitative detection platform, which definitely has a scope for modifications and further studies in terms of advancing the technology. In a similar such study, a research group developed a uncomplicated, reasonable, water-activated, chemically heated, minimally instrumented smart cup for nucleic acid amplification and detection targeting the herpes simplex virus type 2 (HSV-2) (Liao et al. 2016). While the routine PCR tests rely on dedicated and special need specialized equipment or machinery, LAMP assays can be carried out in a simple heating block/water bath, knocking out the specific requirements for thermocyclers, and they are validated and standardized for direct visualization of results by naked eye, getting rid of the need for agarose gel electrophoresis (Notomi et al. 2000). This can ultimately lead to the reduced cost and ease for setting up a budget NAT diagnostic test for a veterinary clinic and related services. More importantly, with fewer modifications and validations in the LAMP assay, the overall turnaround time of the test can be drastically reduced without compromising on the quality of the experiment and results (Parida et al. 2008). Microscopy is a classical technique which has been continuously used since long time, for the identification and detection of hemoparasites. Conveniently, detection and visualizing of the circulating gamonts in stained blood smears is the most common approach used to check the presence of H. canis infection. The absence of infection is not always indicated by the absence of parasitemia, because there is a possibility of false-negative results in dogs having tissue infection with Hepatozoon spp. irrespective of the lower or a temporary state of parasitemia. PCR tests and similar amplification methods are considered to be a gold standard for the detection of even smaller amounts of the parasitic DNA and pathogens, since it becomes difficult to detect the lower parasitemia by the traditional microcopy techniques. In the present study, a specific LAMP assay on the basis of the partial 18S rRNA gene and p30 gene of H. canis and E. canis was optimized for the rapid detection of these infections in canine populations. The LAMP assay was found to be specific and did not amplify the DNA of B. canis vogeli, negative sample, and no-template controls displaying a characteristic ladder-like patterns. The developed LAMP assay can be conveniently used field for regular testing, when the high-end and state-of-the-art equipment are not accessible. The rising canine population on a global scenario can be threatening with respect to the animal welfare and public health, as dogs serve as significant reservoirs of many zoonotic parasites and diseases. Doxycycline is one of the antibiotic drugs that is popularly been used to treat dogs suffering from E. canis infections and related pathogens (Bowman 2011). Profound and large-scale usage of this particular antibiotic for treating the infections in dogs can give rise to an alarming situation, by giving rise to the resistant strains (Harrus and Waner 2011). The clinical signs observed in the canine diseases are very much inter-related and overlapping with the symptoms of several other diseases occurring in dogs, and it becomes very crucial and important to use both serological tests and NAT to reach a definite conclusion related to the diagnosis of a particular canine disease (Harrus and Waner 2011). This constructive approach towards the diagnosis of canine parasitic diseases will not only allow the veterinary practitioners to suggest appropriate treatments but will also help them to modify the existing treatment systems (Harrus and Waner 2011). LAMP assay has been popularly and effectively used for the diagnosis of a wide range of pathogens and infectious diseases, including canine pathogens and diseases (Stich et al. 2002; Harrus et al., 2011; Faggion et al. 2013). In this respect, LAMP assay and technique can be very helpful for the overall management and treatment of the canine infectious diseases, specifically in tropical and sub-tropical areas where such diseases occur more prevalently and where the veterinary laboratories often have negligible or limited access to advanced and modern equipment. Isothermal amplification techniques have a great potential over the traditional gold standard methods like PCR. An important point to be considered for the existing LAMP-based POC platforms in resource-limited settings is ultimately the final cost of the test and the reaction components. Indeed, the existing and the upcoming molecular technologies come with a higher turnaround time, sophisticated and power-consuming modern equipment, and undoubtedly the need for skilled labor. Smarter amalgamation by using smart and mobile devices is a key to the modifications in the existing LAMP-based devices.

Conclusion

Isothermal amplification techniques especially LAMP is a trustworthy and reliable alternative to the traditional gold standard, PCR for the diagnosis and detection of pathogens in the canine populations. We have developed an economical and easy to handle smartphone-assisted portable LAMP box altogether connected to each other wirelessly which facilitates the diagnosis of the parasitic diseases in canine population powered by a 5 V power bank or power source eliminating the need of any external electricity source. The sensitivity limit of the LAMP assay was found to be up to 10−6 dilution limit using the amplified specific DNA templates, and around 5–6 samples could be tested at one time. The use of this diagnostic tool is not only limited to the diagnosis of various important canine vector-borne diseases like E. canis and H. canis but can also have a wide applicability in the field of other parasitic vector-borne infectious diseases diagnosis including those of zoonotic origin. (DOCX 772 kb)
  65 in total

1.  Latest developments in micro total analysis systems.

Authors:  Arun Arora; Giuseppina Simone; Georgette B Salieb-Beugelaar; Jung Tae Kim; Andreas Manz
Journal:  Anal Chem       Date:  2010-06-15       Impact factor: 6.986

2.  Development of loop-mediated isothermal amplification (LAMP) method for diagnosis of equine piroplasmosis.

Authors:  Andy Alhassan; Oriel M M Thekisoe; Naoaki Yokoyama; Noboru Inoue; Makhosazana Y Motloang; Peter A Mbati; Hong Yin; Yoshinari Katayama; Toru Anzai; Chihiro Sugimoto; Ikuo Igarashi
Journal:  Vet Parasitol       Date:  2006-09-14       Impact factor: 2.738

Review 3.  Miniaturized isothermal nucleic acid amplification, a review.

Authors:  Peter J Asiello; Antje J Baeumner
Journal:  Lab Chip       Date:  2011-03-09       Impact factor: 6.799

Review 4.  Loop-mediated isothermal amplification (LAMP) for malarial parasites of humans: would it come to clinical reality as a point-of-care test?

Authors:  Rashad Abdul-Ghani; Abdulsalam M Al-Mekhlafi; Panagiotis Karanis
Journal:  Acta Trop       Date:  2012-02-16       Impact factor: 3.112

Review 5.  Nucleic acid amplification using microfluidic systems.

Authors:  Chen-Min Chang; Wen-Hsin Chang; Chih-Hung Wang; Jung-Hao Wang; John D Mai; Gwo-Bin Lee
Journal:  Lab Chip       Date:  2013-04-07       Impact factor: 6.799

Review 6.  Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine.

Authors:  M Monsur Ali; Feng Li; Zhiqing Zhang; Kaixiang Zhang; Dong-Ku Kang; James A Ankrum; X Chris Le; Weian Zhao
Journal:  Chem Soc Rev       Date:  2014-03-18       Impact factor: 54.564

Review 7.  Introduction to the alpha-proteobacteria: Wolbachia and Bartonella, Rickettsia, Brucella, Ehrlichia, and Anaplasma.

Authors:  Dwight D Bowman
Journal:  Top Companion Anim Med       Date:  2011-11

8.  A molecular and parasitological survey of Hepatozoon canis in domestic dogs in Turkey.

Authors:  Munir Aktas; Sezayi Özübek; Kürşat Altay; İbrahim Balkaya; Armagan Erdem Utuk; Akın Kırbas; Sami Şimsek; Nazir Dumanlı
Journal:  Vet Parasitol       Date:  2015-02-25       Impact factor: 2.738

9.  Babesia canis vogeli, Ehrlichia canis, and Anaplasma platys infection in a dog.

Authors:  Salah Al Izzi; Donald S Martin; Roxanne Y Y Chan; Christian M Leutenegger
Journal:  Vet Clin Pathol       Date:  2013-10-18       Impact factor: 1.180

10.  A survey of canine tick-borne diseases in India.

Authors:  Puteri Azaziah Megat Abd Rani; Peter J Irwin; Glen T Coleman; Mukulesh Gatne; Rebecca J Traub
Journal:  Parasit Vectors       Date:  2011-07-19       Impact factor: 3.876

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.