Literature DB >> 33626495

Knockout of the CEP290 gene in human induced pluripotent stem cells.

Joseph Fogerty1, Brian D Perkins2.   

Abstract

CEP290 is a principal component of the primary cilium and is important for the proper function of ciliated cells. CEP290 mutations have been linked to numerous ciliopathies, with a wide range of phenotypic severities, but with poor genotype:phenotype correlation. Here we have used CRISPR/Cas9 technology to target the CEP290 gene and generate a line of induced pluripotent stem cells that lack detectable CEP290 expression, but retain a normal karyotype and differentiation potential. This line of cells will be useful for the study of disorders resulting from CEP290 mutations.
Copyright © 2021 The Authors. Published by Elsevier B.V. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 33626495      PMCID: PMC8127132          DOI: 10.1016/j.scr.2021.102243

Source DB:  PubMed          Journal:  Stem Cell Res        ISSN: 1873-5061            Impact factor:   2.020


Resource utility

There is poor genotype: phenotype correlation with CEP290 mutations. This line of cells lacks all detectable CEP290 expression and will be a useful comparator for functional studies of patient-derived mutations with variable pathogenicity.

Resource details

CEP290 is located at 12q21.32 and encodes a component of the primary cilium transition zone (Craige et al., 2010). The primary cilium is an important organelle into which a wide range of receptors and signalling molecules are segregated, and thus it is one of the primary means by which cells interact with their local environment (Gerdes et al., 2009). Mutations in CEP290 have been linked to a spectrum of heritable disorders ranging from the blinding disease Leber’s Congenital Amaurosis to multiorgan diseases such as Bardet-Biedel syndrome (Coppieters et al., 2010). The ability to derive lines of induced pluripotent stem cells from patient biopsy samples now enables investigators to more easily study the effects of CEP290 mutations in specific cell types. Because many CEP290 mutations are thought to be hypomorphic (Roosing et al., 2017), we sought to produce a line of CEP290 knockout stem cells that can be used as a negative control for the comparison of patient derived lines (Table 1).
Table 1

Characterization and validation

ClassificationTestResultData
MorphologyPhotographyNormalFig. 1B
PhenotypeQuantitative analysis (ddRT-PCR)Expression of SOX2 and NANOGFig. 1D
Qualitative analysis (Immunocytochemistry)Positive staining for pluripotency markers SOX2, OCT4Fig. 1E
GenotypeKaryotype (G-banding) and resolution46XX, Resolution 500Fig. 1C
IdentityMicrosatellite PCRN/AN/A
STR analysis16/16 loci matchedAvailable from the authors.
Mutation analysis (IF APPLICABLE)SequencingCompound heterozygous Allele 1: c.576-592delAllele 2: c.584-590delFig. 1A
Western BlotCep290 protein is not detectable in mutant cellsFig. 1F
Microbiology and virologyMycoplasmaNegativeSupplementary data
Differentiation potentialDirected differentiationExpression of germ layer-specific genes was enriched under their respective culture conditions.Fig. 1G
Donor screening (OPTIONAL)HIV 1 + 2 Hepatitis B, Hepatitis CN/AN/A
Genotype additional info (OPTIONAL)Blood group genotypingN/AN/A
HLA tissue typingN/AN/A
A guide RNA (Fig. 1A, red text) targeting exon 9 of CEP290 was designed using ZiFiT (http://zifit.partners.org/ZiFiT/) and inserted into pSpCas9(BB)-2A-Puro(PX459)V2.0 (Addgene). Exon 9 encodes a portion of CEP290 near the N-terminus (Fig. 1A, asterisk, adapted from Coppieters et al., 2010), at which point a truncating mutation would disrupt all known functional domains of the protein. This construct was transfected into the EP-1 line of iPSC cells, which were originally derived from the human lung fibroblast line IMR-90 (Bhise et al., 2013). After selection with puromycin and expansion, we cloned and sequenced the targeted region of both CEP290 alleles from each candidate colony and established a line of mutant cells, designated CEIi001-A, that contained two frameshifting mutations (c.576–592del and c.584–590del, Fig. 1A). Eight potential off-target sites were sequenced from that line, and no CRISPR-Cas9 activity was detected at any of them (Supplemental Fig. S1). The cells in this line grew in compact colonies similar to the parental line, with a large nucleus:cytoplasm ratio and prominent nucleoli (Fig. 1B), and STR analysis confirmed that they are genetically identical to IMR-90 (supplemental data). The cells also had a normal human female karyotype (Fig. 1C). We demonstrated pluripotency with droplet digital RT-PCR (ddRT-PCR) assays showing expression of SOX2 and NANOG, (Fig. 1D), and by immunolabeling for SOX2 and OCT4, which both had nuclear expression (Fig. 1E). The cells also tested negative for mycoplasma contamination (supplemental data).
Fig. 1.
We predicted that the frameshifting mutations in CEIi001-A would prevent expression of full-length CEP290 protein. To test this, we western blotted cell lysates from EP-1 and CEIi001-A with a C-terminal CEP290 antibody. This antibody prominently labeled a band at the predicted size in EP-1 cells, which was absent in CEIi001-A (Fig. 1F, green band). Total protein staining of the blot showed that sample loading was comparable (Fig. 1F, red). Finally, the differentiation potential of CEIi001-A was confirmed by trilineage analysis, showing that expression of germ layer-specific genes was enriched under their respective culture conditions (Fig. 1G).

Materials and methods

Cell culture

EP-1 cells were a gift from Donald Zack, and were cultured in mTESR-1 media (Stem Cell Technologies) on Matrigel coated plates at 37°C in 10% CO2, 5% O2. Cells were routinely passaged with Accutase (Sigma) when colonies began to merge, and replated in media containing 5 μM blebbistatin (Sigma).

Gene targeting

A sgRNA sequence targeting exon 9 of CEP290 (Fig. 1A, red text) was cloned into the BbsI site of pSpCas9(BB)-2A-Puro(PX459)V2.0 (a gift from Feng Zhang, Addgene plasmid #72988). EP-1 cells were transfected in 24-well plates with Lipofectamine STEM (ThermoFisher), and treated with 0.9 μg/ml puromycin 48 h later. After 24 h selection, cells were grown in non-selective media for several days and then passaged at low density into a matrigel-coated 6 well plate. Colonies were picked manually and transferred to coated 24-well plates. After expansion, both alleles from the targeted region were cloned and sequenced. Potential off-target sites were identified with Cas-Offinder (http://www.rgenome.net/cas-offinder/) and sequenced.

Immunofluorescence

Cells were plated on matrigel-coated chamber slides and grown until large colonies formed. They were then fixed with 4% paraformaldehyde for 5 min and blocked in PBS containing 5% goat serum, 0.1% Tween-20 and 0.1% DMSO. Primary antibody incubation was done in blocking buffer overnight at 4°C, followed by washing and secondary antibody incubation. Cells were counterstained with DAPI and imaged on a Zeiss Imager.Z2 with Apotome. See Table 2 for antibody information.
Table 2

Reagents details

Antibodies used for immunocytochemistry/flow-cytometry
AntibodyDilutionCompany Cat # and RRID
Pluripotency MarkerOCT41:100DSHB #PCRP-POU5F1-1D9-S RRID: AB_2618969
Pluripotency MarkerSOX21:100Cell Signaling Technology #3579TRRID: AB_2195767
Knockout confirmationCEP2901:1000Abcam #ab84870 RRID: AB_1859782
Secondary antibody (ICC)Goat anti-mouse Alexa-5681:500ThermoFisher #A11004 RRID: AB_2534072
Secondary antibody (ICC)Goat anti-rabbit Alexa-5681:500ThermoFisher #A11036 RRID: AB_10563566
Secondary antibody (WB)IRDye 800CW Goat anti-rabbit1:10000Li-Cor #925-32211 RRID: AB_2651127
Primers
TargetForward/Reverse primer (5′-3′)
Pluripotency Marker (ddPCR)SOX2AGAAGAGGAGAGAGAAAGAAAGGGAGA/GAGAGAGGCAAACTGGAATCAGGATCAAA
Pluripotency Marker (ddPCR)NANOGGAACTCTCCAACATCCTGAACCT/TCTGCGTCACACCATTGCTAT
Ectoderm Marker (ddPCR)PAX6GTCCATCTTTGCTTGGGAAA/TAGCCAGGTTGCGAAGAACT
Ectoderm Marker (ddPCR)NESTINCAGGGGCAGACATCATTGGT/CACTCCCCCATTCACATGCT
Mesoderm Marker (ddPCR)NCAMATGGAAACTCTATTAAAGTGAACCTG/TAGACCTCATACTCAGCATTCCAGT
Mesoderm Marker (ddPCR)TBXTGCTGTGACAGGTACCCAACC/CATGCAGGTGAGTTGTCAGAA
Endoderm Marker (ddPCR)FOXA2GGAGCGGTGAAGATGGAA/TACGTGTTCATGCCGTTCAT
Endoderm Marker (ddPCR)SOX17GTGGACCGCACGGAATTTG/GGAGATTCACACCGGAGTCA
Housekeeping Gene (ddPCR)GAPDHTCCAAAATCAAGTGGGGCGAT/TTCTAGACGGCAGGTCAGGTC
Targeted mutation analysis/sequencingCEP290ACTTTGTCAGGATATTATTGACTACCA/TTTAGACAACTGTGATCGGTAGT
Potential off-target sequencingPOT1TCCTCGAGAATTGTGCACCT/AACATCCAACCACACTGCGA
Potential off-target sequencingPOT2GTCAGTCCTGGGCAGAGAAC/CTGTCTCTTGCTGCTTTGCG
Potential off-target sequencingPOT3GGCAGTGCCTTGGAGAGAAT/CCCGTTGCTCATTTCCTCCT
Potential off-target sequencingPOT4AGCAGTCTGTTACAGCAGCA/TTCCCTTTTTCTGAGCCCCC
Potential off-target sequencingPOT5TAGGAGCTTCGACTTGCCAC/TAGGAGCTTCGACTTGCCAC
Potential off-target sequencingPOT6GGTACCTGAATGGCCAGTCA/TGCCACAACAAAGACATATCCC
Potential off-target sequencingPOT7GGCCCCTTTTGCCTACTTCT/CCATTGGGCTAGGGAATGGT
Potential off-target sequencingPOT8TGGATGCAGAAATGGAGGCT/ATGTACCTGCTGGTTGGCAT

Western blotting

Cells were scraped in RIPA buffer and sonicated. 10 μg total protein was run on a 6% polyacrylamide gel and transferred to Immobilon-FL membrane (Millipore). The membrane was first stained with REVERT total protein stain (Li-Cor), then blocked with Odyssey blocking buffer and incubated with primary antibody overnight at 4°C in blocking buffer. After washing the membrane, it was incubated with secondary antibody in blocking buffer for 1 h at room temperature. Visualization was performed with an Odyssey CLx infrared scanner (Li-Cor).

ddRT-PCR analysis

RNA was extracted with Trizol (ThermoFisher), and cDNA was synthesized with an iScript kit (Bio-Rad). ddPCR analysis was performed using SybrGreen with a QX200 droplet scanner (Bio-Rad). Primer sequences are listed in Table 2.

Karyotyping and STR analysis

Karyotyping and STR analysis were performed by Cell Line Genetics (Madison, WI).

Mycoplasma detection

Mycoplasma testing was completed by the Cell Services Core at the Cleveland Clinic Lerner Research Institute using the MycoAlert PLUS kit (Lonza).

Trilineage differentiation

Differentiation potential was assessed using the STEMdiff trilineage differentiation kit (Stemcell Technologies), in triplicate, following the manufacturer’s differentiation protocol. Expression of germ layer-specific genes was measured by ddRT-PCR. Primer sequences are listed in Table 2.

Resource Table

Unique stem cell line identifierCEIi001-A
Alternative name(s) of stem cell lineCEP290Ex9-4
InstitutionCleveland Clinic – Cole Eye Institute
Contact information of distributorJoseph Fogerty
Type of cell lineiPSC
Originhuman
Additional origin infoApplicable for human ESC or iPSC
Age: Unknown
Sex: F
Ethnicity if known:Unknown
Cell SourceEP-1 iPSC line
ClonalityClonal
Method of reprogrammingN/A
Genetic ModificationYES
Type of ModificationCRISPR/Cas9-induced gene knockout
Associated diseaseCiliopathies
Gene/locusCEP290/12q21.32
Method of modificationCRISPR/Cas9
Name of transgene or resistanceN/A
Inducible/constitutive systemN/A
Date archived/stock date19 Oct. 2020
Cell line repository/bankhttps://hpscreg.eu/user/cellline/edit/CEIi001-A
Ethical approvalCell lines were used according to institutional guidelines.
  5 in total

Review 1.  CEP290, a gene with many faces: mutation overview and presentation of CEP290base.

Authors:  Frauke Coppieters; Steve Lefever; Bart P Leroy; Elfride De Baere
Journal:  Hum Mutat       Date:  2010-10       Impact factor: 4.878

2.  CEP290 tethers flagellar transition zone microtubules to the membrane and regulates flagellar protein content.

Authors:  Branch Craige; Che-Chia Tsao; Dennis R Diener; Yuqing Hou; Karl-Ferdinand Lechtreck; Joel L Rosenbaum; George B Witman
Journal:  J Cell Biol       Date:  2010-09-06       Impact factor: 10.539

Review 3.  The vertebrate primary cilium in development, homeostasis, and disease.

Authors:  Jantje M Gerdes; Erica E Davis; Nicholas Katsanis
Journal:  Cell       Date:  2009-04-03       Impact factor: 41.582

4.  A Rare Form of Retinal Dystrophy Caused by Hypomorphic Nonsense Mutations in CEP290.

Authors:  Susanne Roosing; Frans P M Cremers; Frans C C Riemslag; Marijke N Zonneveld-Vrieling; Herman E Talsma; Francoise J M Klessens-Godfroy; Anneke I den Hollander; L Ingeborgh van den Born
Journal:  Genes (Basel)       Date:  2017-08-22       Impact factor: 4.096

5.  Evaluating the potential of poly(beta-amino ester) nanoparticles for reprogramming human fibroblasts to become induced pluripotent stem cells.

Authors:  Nupura S Bhise; Karl J Wahlin; Donald J Zack; Jordan J Green
Journal:  Int J Nanomedicine       Date:  2013-12-04
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.