MicroRNA-124-3p affects myogenic differentiation of adipose-derived stem cells by targeting Caveolin-1 during pelvic floor dysfunction in Sprague Dawley rats.

BACKGROUND: The aim of this study was to investigate using myogenic differentiation of adipose stem cells for the treatment of female pelvic floor dysfunction (PFD) and aimed to further study the influences of microRNA-124-3p (miR-124-3p) in the process of myogenic differentiation of adipose-derived stem cells (ADSCs) through targeting Caveolin-1 (Cav1) during PFD in Sprague Dawley (SD) rats.
METHODS: The ADSCs were separated from 6-8-week-old female SD rats (n=25) and were cultivated. Then, we observed the cell status and conducted fat and osteogenic experiments. We then constructed an ADSC-green fluorescent protein (GFP) stable transfer strain. Flow cytometry was used to identify the positive rates of CD44, CD90, and CD45 in ADSCs and ADSC-GFP. Real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting were used to mRNA and protein expression levels. Myogenic differentiation of ADSCs was measured with immunofluorescence methods. A dual-luciferase reporter assay was executed to affirm whether Cav1 was a target of miR-124-3p.
RESULTS: The isolated ADSCs cells were in good condition under the microscope. The results of flow cytometry showed that the positive rate of CD44 and CD90 was high, and the positive rate of CD45 was low in ADSCs and ADSC-GFP. Under normal culture conditions, ADSCs-GFP cells can be massively adipated and osteogenic. After 5-Aza induced ADSC-GFP myogenic differentiation, the level of miR-124-3p was significantly increased. We found that MiR-124-3p mimics promoted the myogenic differentiation of ADSCs. Moreover, we discovered that Cav1 was a target gene of miR-124-3p and was negatively regulated by miR-124-3p. The results of leak point pressure (LPP), hematoxylin and eosin (HE), and Masson showed that the collagen fiber content of the PFD group was lower than that of the control group; the collagen fiber content of ADSC-GFP, 5-Aza, or miR-124-3p mimics were increased after intervention. Furthermore, the outcomes qRT-PCR, western blotting, and immunofluorescence suggested that miR-124-3p facilitated the survival ADSC-GFP fat transplantation by regulating many key factors in vivo.
CONCLUSIONS: These results proofed that miR-124-3p could accelerate myogenic differentiation of ADSCs by down-regulating Cav1 to improve PFD in SD rats, which will pave the way for therapeutic delivery of miRNA targeting PFD disease. 2021 Annals of Translational Medicine. All rights reserved.

Introduction

The female pelvic floor is a momentous organ in women. It has multiple functions in all humans, containing excretion of urine and feces, sex, and maintenance of pelvic organs (1). It is a complete anatomical structure, which is composed of nerves, muscles, and connective tissues (2). Studies have shown that vaginal delivery may cause various degrees of pelvic floor dysfunction (PFD) (3). Patients with PFD usually show a diverse range of clinical symptoms, including female genital prolapse and pain, lower urinary tract excretion and bowel dysfunction, and overactive bladder (4,5). According to different definitions of the disease, more than 30% of women suffer from PFD, and the majority are adult women (6). The development of PFD is usually multifactorial, including obesity, race, age, pregnancy, childbirth, multiple births, chronic cough, history of pelvic surgery, genetics, spinal cord disease, and family history, among others (7,8). There are both conservative and surgical treatments for PFD, and manifestations include overactive bladder syndrome, stress urinary incontinence and female reproductive organ prolapse (7). In the over 80-year age group, 11% of PFD patients undergo surgery, which usually requires concurrent partial (anterior or posterior) or full vaginal repair and hysterectomy (9). Nevertheless, up to 20–30% of patients require repetitive surgery due to recurrence (10). Recently, the use of artificial biological mesh during surgical procedures has been shown to improve long-term recovery, but mesh can also cause pain, erosion, and scar formation in about 30% of cases (11). There is an urgent need to find new therapies to enhance the repair and regeneration of damaged tissues in PFD.

Female PFD usually manifests as abnormalities, injuries or defects in the female pelvic structure and symptoms include urinary incontinence, pelvic organ prolapse, etc. Drost et al. (12) indicated that the myogenic differentiation of human bone marrow-derived mesenchymal stem cells (MSCs) could be regarded as a latent treatment for urethral sphincter muscle repair. In a rat model of stress urinary incontinence, low-intensity pulsed ultrasound affected the myogenic differentiation of MSCs (13). Recently, studies have reported that stem cells have great potential in the treatment of PFD (14). Stem cells can promote tissue repair through cells that potentially differentiate into connective tissue relying on their multi-lineage differentiation ability (9). In recent years, adipose-derived stem cells (ADSCs) have attracted attention for repairing damaged tissues in clinical applications (15). In the human body, ADSCs are mesenchymal stem cells (MSCs) originating from adipose tissue (16). In vitro, ADSCs have the ability to proliferate; widely distinguish adipogenesis, osteogenesis, cartilage and myogenic lineages, and secrete multifarious growth factors to stimulate tissue regeneration (17). In view of the above reports, it is necessary to conduct in-depth research on how ADSCs repair PFD.

MicroRNAs (miRNAs), consist of about 18–24 nucleotides, and are a series of small non-coding RNA that are concerned with modulation of post-transcriptional gene expression (18). It is recognized that miRNAs regulate the expression of about 30% of human proteins and participate in various biological processes, including cell immune and inflammatory responses, differentiation, proliferation, and apoptosis and migration, among others (19,20). An increasing number of studies have indicated that miRNAs are important regulators of stem cell differentiation, regeneration, and development (21,22). Expression profile analysis during myogenic differentiation or the development of stem cells has demonstrated various miRNAs with differential expression patterns, and these miRNAs may act as new myogenic modulators (23). Recently, a study revealed that miR-124-3p has important roles in the proliferation, differentiation, and regeneration of MSCs (24). However, the impacts of miR-124-3p on several biological processes, including muscle biology and myogenic differentiation of adipose stem cells, remain to be elucidated.

In the present study, we discovered that miR-124-3p modulated the differentiation of ADSCs by targeting Caveolin-1 (Cav1), suggesting its potential roles in improving PFD.

We present the following article in accordance with the ARRIVE reporting checklist (available at http://dx.doi.org/10.21037/atm-20-8212).

Methods

Isolation and culture of adipose stem cells

Female Sprague Dawley (SD) rats (6–8 weeks old) from Cavens (Changzhou, China) were used for our experiment. The experimental protocol of our study was performed in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the First Affiliated Hospital of Wenzhou Medical University. First, rats were anesthetized by injection of 15% chloral hydrate. Then, the rats were fixed on plates and disinfected with alcohol spray. The subcutaneous fat tissue of the rats’ groin were cut and the visible blood vessels and fascia tissue were then removed. The tissues were washed with phosphate buffered saline (PBS), cut into small pieces, and placed in a centrifuge tube containing collagenase for digestion for 30 min. After digestion, it was centrifuged and inoculated into a petri dish containing Dulbecco’s Modified Eagle Medium (DMEM), antibiotics were added, and cultured at 37 °C in a 5% CO2 incubator.

Cell transfection

The miR-124-3p mimics and its corresponding negative control (NC) were obtained from RiboBio (Guangzhou, China) and were transfected into adipose stem cells (ADSCs) cells utilizing Lipofectamine 2000 reagents (Invitrogen, Carlsbad, CA, USA), following the supplier’s instructions. The concentration of transfection was 50 nm, and the solution was altered after 6 hours transient transfer. After 48 hours, the cells were subjected to qPCR for verification.

qRT-PCR

qRT-PCR for miRNA

Enriched miRNA was extracted via a miRNA isolation kit, following the manufacturer protocol (Omega, Norcross, GA, USA). The SYBR green stem-loop RT-PCR method (Takara Bio., Shiga, Japan) was used to quantify miRNAs expression levels. The housekeeping gene U6 served as the internal control for miRNA. Relative gene expression was measured by using the 2−ΔΔCt method.

qRT-PCR for mRNA

The total RNA of MH7A cells was isolated utilizing TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A PrimeScript RT Reagent Kit (Takara Bio, Shiga, Japan) was utilized to synthesize complementary (c)DNA. Then, the mRNA expression of EIF2AK1 was analyzed through qPCR. This was conducted via a SYBR Premix Ex Taq II (Takara) kit on an ABI 7300 fast real time PCR system (Applied Biosystems, Foster City, CA, USA). The expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was regarded as an internal reference. The primers utilized for reverse transcription are shown in .

Table 1

The primers used in qRT-PCR

Gene (R)	Sequence
miR-124-3p	F: ACACTCCAGCTGGGTAAGGCACGCGGTG
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGCATTCA
miR-140-5p	F: ACACTCCAGCTGGGCAGTGGTTTTACCCTA
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCATA
miR-194-5p	F: ACACTCCAGCTGGGTGTAACAGCAACTCCA
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACATG
miR-129-5p	F: ACACTCCAGCTGGGCTTTTTGCGGTCTGG
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCAAGCCC
miR-132-3p	F: ACACTCCAGCTGGGTAACAGTCTACAGCCA
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGACCATG
miR-181-5p	F: ACACTCCAGCTGGGAACATTCAACGCTGTCG
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTCACCG
miR-199-5p	F: ACACTCCAGCTGGGCCCAGTGTTCAGACTAC
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAACAGGT
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT
Myog	F: CATCCCCCTATTTCTACCA
	R: TTACACACCTTACACGCCC
MyHC	F: GGTGGTGGAAAGAAAGGG
	R: CAAAGTGGGGGTGAGTGCCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTCACCG
GAPDH	F: ACAGCAACAGGGTGGTGGAC
	R: TTTGAGGGTGCAGCGAACTT

qRT-PCR, real-time quantitative polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blotting analysis

A radio-immunoprecipitation assay (RIPA) lysis buffer (Yisheng Biological Technology Co., Ltd., Shanghai, China) including proteinase suppressors was applied to isolate total protein. The concentration of total protein was detected by employing bicinchoninic acid (BCA) method (ComWin Biotech Co., Ltd., Beijing, China). A 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate 20 µg of protein samples. Next, the samples were put onto a polyvinylidene difluoride (PVDF) membrane. After being blocked with 5% non-fat milk for 1 hour, the membrane was incubated with the antibodies overnight at 4 °C. The results were scanned by Quantity One software (version 4.6.9, Bio-Rad Laboratories, Hercules, CA, USA). The antibodies used in this part were as following, CD90 (Invitrogen Catalog #MA1-80650); CD44 (Invitrogen Catalog #MA5-17520); CD45 (Invitrogen Catalog #12-0461-82); Cav1 (Bioss,bs-1453R); MyHC (proteintech, 22281-1-AP); Goat anti-rabbit cy3 (proteintech SA00009-2); GAPDH (proteintech, 60004-1-Ig); MyoD (proteintech, 18943-1-AP); Collagen III (Bioss, bs-0549R); Collagen I (abcam, ab260043); LAMC1 (cell signaling, #92921); MMP1 (Affinify, DF6325); MMP9 (abcam, ab76003); HOXA11 (Bioss, bs-666R); Elastin (Bioss, bs-1756R); Calponin (abcam, ab46794); Vimentin (abcam, ab92547); GFP (abcam, ab1218).

Establishment of green fluorescent protein stable transfection ADSC cell line

The ADSCs cells were plated in a 3.5 cm dish with a plating density of 50%. After 24 hours of cell attachment, the multiplicity of infection (MOI) value was 10 for green fluorescent protein (GFP) virus (Hanbio, Shanghai, China) infection. After 72 h of infection, fresh medium was replaced and puromycin (cat no. X10020; XYbio; Hangzhou; China) was added at a concentration of 5 µg/mL. Then, the cell fluorescence and status were observed under a fluorescence microscope. After puromycin screening, there were some cells death in the beginning and the fluorescence was weaker. With prolongation of the selection time, the status of cells was improved; the fluorescence was increased and could be passaged stably, indicating that a stable transgenic strain of ADSCs-GFP had been successfully constructed.

Flow cytometry analysis of ADSCs surface markers

The ADSCs were harvested by trypsinization and resuspended in PBS containing 4% fetal bovine serum (FBS). Cells were then stained with fluorescein isothiocyanate (FITC)-conjugated anti-human CD44, CD90, and CD45 antibodies (eBioscience, Inc., San Diego, CA, USA). Flow cytometry was carried out by FACSDiva (Canto, Becton, Dickinson and Co. Biosciences, San Jose, CA, USA), and FACS analysis was executed utilizing FlowJo software (Tree Star, Ashland, OR, USA).

Dual-luciferase reporter assay

After 48 h of transfection, the cells were seeded into 24-well plates. After incubation for 24 h, the construction of a dual fluorescein reporter vector was achieved by the 3'UTR of wild type (WT) and mutant (MUT) Cav1 being cloned into pGL3-RB-REPORTTM. The miR-124-3p mimic and PGL3-3'UTR-WT or PGL3-3'UTR-MUT were co-transfected into cells by applying Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). Finally, the luciferase activity was assessed using the Dual-Luciferase Reporter Assay System (Promega Corp., Madison, WI, USA).

Lipidation experiment

After the ADSC-GFP cells were expanded and cultured, they were collected and seeded in a 24-well plate pre-coated with gelatin. Each well was added with 1 mL DMEM high-sugar complete medium and cultured at 37 °C, 5% CO2. When the cells had adhered to the wall and grown about 90%, the medium was changed to lipid induction medium for culture. The induction solution was changed every 3 days. After 14 days, Oil red O staining was carried out according to the instructions.

Oil red O staining

The ADSCs were cultivated in DMEM and gathered on the 7th day and 14th day, respectively. The cells were fixed with 10% formalin, washed with 60% isopropanol, and stained with Oil red O working fluid. Then, after being fixed in glycerin gelatin, the cells were observed under a microscope (Olympus optics, Tokyo, Japan). Finally, the results were counted under the microscope.

Osteogenesis experiment

After the ADSC-GFP cells were expanded and cultured, the cells are collected and seeded in a 24-well plate pre-coated with gelatin. Each well received 1 mL of DMEM high-sugar complete medium and was cultured at 37 °C, 5% CO2. When the cells had adhered to the wall and grown about 90%, they were transferred to an osteoinduction medium for culture. The induction solution was changed every 3 days. After 2 weeks, alizarin red staining was performed following the manufacturer’s instructions.

Alizarin red staining

The ADSC cells (2×104/mL) were added into 24-well plates and cultured under normal conditions. Every 3 days, the medium was replaced. After 2 weeks of incubation, the cells were washed twice with PBS and stained with 0.2% alizarin red for 20 minutes. Finally, the cells were washed with distilled water, air-dried at room temperature, resuspended in 10% acetic acid, and quantified spectrophotometrically at a wavelength of 450 nm.

Rat PFD model

A total of 25 female SD rats, 6–8 weeks old, were purchased from Changzhou Cavens Company (Changzhou, China) and divided into 5 groups (each group 5 rats). An 18f catheter was inserted into the rat’s vagina, and fixed with a single 3-0 silk thread. A Foley balloon was filled with water (2.5–3.0 mL) and connected to a pressure sensor to generate pressure on the pelvic support tissue. After 4 hours, the catheter was fetched and removed from the vagina together with the pressure sensor. At 14 days after vaginal dilation, the leak point pressure (LPP) was tested to ensure establishment of the PFD model.

LPP test

The cells were injected into groups according to the experiment and kept for 7 days. Rats in each group were tested for LPP. Two days before the LPP test, a bladder catheter was interposed into the PFD rat and attached to the pressure transducer and micro-infusion pump through a shut-off valve. Under anesthesia with urethane, the bladder was palpated to empty and filled with normal saline at a rate of 5 mL/hour through the micro-infusion pump. Pressure was increased gradually until the rat leaked saline through the urethra. When the first signs of urethral leakage appeared, the external abdominal pressure was quickly removed. In the absence of detrusor muscle contraction, the peak pressure LPP at the time of leakage was recorded. The LPP was counted by subtracting the bladder baseline pressure from peak bladder pressure. The bladder was drained and refilled, and the process was repeated 3 times in each rat. Finally, mean bladder baseline pressure and mean LPP were counted for each rat.

Hematoxylin and eosin (HE) and Masson staining

After the in vitro tests were completed, complete urethra, vagina and fascia tissue, and bladder tissue were extracted and fixed with 4% paraformaldehyde (PFA) overnight. The urethra and surrounding tissues were dehydrated, inserted in paraffin wax, incised into 5 µm sections and dewaxed usually. Then, HE and Masson staining were carried out. For the HE staining, the tissues were stained with hematoxylin for 5 minutes, washed with distilled water until they showed blue-purple, and then stained with eosin. Next, the tissue sections were rinsed with distilled water and dehydrated with absolute ethanol. Finally, neutral gum was added to the tissue sections and they were sealed. For the Masson staining, the tissues were firstly washed with PBS and then stained with the prepared weight iron hematoxylin staining solution for 5–10 min. Then, the acidic ethanol differentiation solution was used to differentiate for 5–15 s; Masson blue solution was utilized to return blue for 3–5 min and washed with distilled water for 1 min. Next, the tissues were stained with Ponceau red magenta staining solution for 5–10 min. Finally, neutral gum was added to the tissue sections and they were sealed. Tissue histomorphology was surveyed and photographed under a light microscope.

Immunofluorescence staining

Immunofluorescence detection of cells

After 2 weeks of fibroblast differentiation of ADSCs, myosin heavy chain (MyHC) expression was tested by immunofluorescence. The cells were fixed in 4% PFA for 15–20 minutes, washed with PBS 3 times, made to be transparent in PBS with 0.2% Triton X-100 for 20 minutes, and closed with bovine serum albumin (BSA). After being washed with PBS, the cells were hatched with rabbit anti-rat collagen I overnight at 4 °C, and they were further incubated with Alexa488-labeled goat anti-rabbit IgG antibody at room temperature in the dark for 1 hour, mounted with 50% glycerin, and photographed under a fluorescence microscope.

Tissue immunofluorescence detection

The tissues slices were soaked in the antigen retrieval solution and microwaved for 20 minutes on high heat. Then, PBS was used to wash the slice surface and repeated 3 times for 5 minutes. After the tissue slices were incubated with H2O2 for 10 minutes at room temperature, they were blocked with 5% BSA at 37 °C for 1 hour. After dilution, they were incubated with the primary antibodies at 37 °C for 2 hours, and then hatched with secondary antibodies at 37 °C for 1 hour. Lastly, the tissue slices were stained with Hoechst at room temperature for 15 minutes. The results were observed and photographed under a microscope.

Data statistics

All data statistics were executed by the statistical software Graphpad 8.0 (San Diego, CA, USA) and SPSS 22.0 (IBM, Chicago, IL, USA). The differences between 2 groups were determined by the Student’s t-test. The differences among 3 or more than 3 groups were analyzed via one-way analysis of variance (ANOVA) with the Bonferroni post hoc test. Statistical difference was considered at P<0.05.

Results

ADSCs were separated successfully from rats

After 24 hours, the primary culture medium was replaced, and the adherent cells revealed a polygonal or elongated shape, with anomalous morphology, a large nucleus, less cytoplasm, and intense light refraction (). Along with the increase of culture time, these cells became larger and longer with more of a spindle-shape, and the cell colonies were formed. The cells continued to proliferate in the colonies. After about 5–7 days, the bottom of the culture dish was covered with cells, and the cells were arranged in a spiral shape (). We used passage to purify cells, which made them long and fuse. After more than 3 repetitions of purification and culture, there was almost no change in cell shape, indicating that it had been passaged stably (). The expression of CD44, CD90, and CD45 in ADSCs was tested through flow cytometry. The outcomes showed that CD44 and CD90 were highly expressed, while CD45 was lowly expressed, in ADSCs (). These findings demonstrated that the ADSCs had been successfully isolated from rats.

Figure 1

Isolation and identification of ADSCs and the successful construction of the ADSC-GFP cell line. (A) The condition of primary ADSCs after adherent growth for 24 hours; (B) the condition of ADSC primary cultures at the 6th day; (C) the condition of the third-generation ADSCs after being cultured for 7 days; (D) the expression of surface markers CD44, CD90, and CD45 in the third-generation ADSCs was tested by flow cytometry; (E) the expression of surface markers CD44, CD90, and CD45 in the third-generation ADSCs was detected by flow cytometry; (F) after adipogenic induction, the Oil red O staining for the third-generation ADSCs; (G) after osteogenic differentiation, the Alizarin red staining for the third-generation ADSCs. (H) The myogenic differentiation was tested by immunofluorescence. Amplification of (A-C), (F-G): 100×; scale: 20 µm. ADSCs, adipose-derived stem cells.

Establishment of GFP stable transfection ADSC cell line as well as adipogenic and osteogenic experiments

Flow cytometry was used to verify the successful construction of ADSCs-GFP. As illustrated in , flow cytometry showed that the positive rates of CD44, CD90, and CD45 were 97.8%, 99.2%, and 0.422%, respectively, indicating that CD44 and CD90 were highly expressed, whilst CD45 was silenced in the ADSCs-GFP. We then used Oil Red O staining to analyze the fat-forming experiment of ADSCs-GFP. It was revealed () that ADSCs-GFP cells could be massively adipated under normal culture conditions. Besides, we also used Alizarin Red staining to analyze the osteogenesis experiment of ADSCs-GFP. The results of show that ADSCs-GFP cells could be prone to osteogenic differentiation under normal conditions. Moreover, we used 5-azacytidine (5-aza) to induce the myogenic differentiation of ADSC-GFP to further verify the successful verification of ADSC-GFP. The myogenic differentiation was shown in . The fluorescence images and white light images taken by the microscope after stable transfection of GFP into ADSC cells were displayed in . Besides, the flow cytometry of GFP expression was showed in . Furthermore, the qRT-PCR results showed that the expression of miR-124-3p, miR-140-5p, and miR-181-5p were significantly increased after 5-Aza induced ADSC-GFP myogenic differentiation, compared with the ADSCs-GFP group (). Above all, this section of results revealed that the ADSCs-GFP model was successfully established and it was prone to osteogenic and lipid differentiation.

Figure 2

The mRNA expression of key miRNAs after 5-Aza induces ADSC-GFP myogenic differentiation. The fluorescence images (A) and white light images (B) taken by the microscope after stable transfection of GFP into ADSC cells were displayed. (C) The expression of GFP was tested by flow cytometry. Through qRT-PCR, the mRNA expression levels of miR-199-5p (D), miR-124-3p (E), miR-140-5p (F), miR-194-5p (G), miR-129-5p (H), miR-132-3p (I), miR-181-5p (J) were analyzed. **P<0.01 vs. ADSCs-GFP group. ADSCs-GFP, adipose-derived stem cells-green fluorescent protein; qRT-PCR, real-time quantitative polymerase chain reaction.

MiR-124-3p mimics promote the myogenic differentiation of ADSCs

To explore the influences of miR-124-3p on ADSCs, we transfected miR-124-3p mimics into ADSCs and enticed myogenic differentiation. After 48 hours transfection, the levels of myogenic markers, containing Cav1, Myog, and MyHC, were analyzed by qRT-PCR and immunofluorescence to verify the transfection efficiency. As shown in , miR-124-3p was up-regulated in ADSCs. Besides, miR-124-3p facilitated myogenesis in ADSCs, leading to the increased expression of Myog and MyHC, the decreased expression of Cav1, as revealed by by qRT-PCR (). In addition, immunofluorescence results showed that, compared with the NC group, the expression of MyHC in the miR-124-3p mimics group was significantly fortified, and the expression of Cav1 was significantly reduced (). Together, these consequences suggested that miR-124-3p promoted myogenesis in ADSCs.

Figure 3

MiR-124-3p over-expression accelerates the myogenic differentiation of ADSCs. The expression of miR-124-3p (A), Cav1 (B), Myod (C), and MyHC (D) were tested by qRT-PCR. The expression of Cav1 (E) and MyHC (F) were detected by immunofluorescence. ADSCs, adipose-derived stem cells. *P<0.05, **P<0.01 vs. ADSCs-GFP group.

MiR-124-3p promotes the myogenesis of ADSCs by targeting and regulating the expression of Cav1

We used the target prediction algorithm TargetScan (www.targetscan.org) to probe the potential target genes of miR-124-3p. Finally, we discovered that Cav1 was one of the target genes of miR-124-3p (). Besides, elucidates that the introduction of miR-124-3p mimic weakened the luciferase activity of cells containing Cav1 3'UTR-WT instead of Cav1 3'UTR-MUT, compared with mimic NC group. The qPCR, western blotting, and immunofluorescence analyses illustrated that the expression of MyoG, MyoD, and MyHC in the miR-124-3p mimic group was significantly increased, whilst the expression of Cav1 was significantly reduced, compared with the miR-124-3p mimic NC group (). Moreover, compared with the ADSC-GFP, 10 µmol/L 5-Aza, or empty vector group, the expression levels of MyoG, MyoD, and MyHC in the Cav1 overexpression group decreased while the expression levels of Cav1 increased (). The results of this section implied that miR-124-3p directly targeted Cav1 to affect its expression on ADSCs.

Figure 4

Cav1 is a target of miR-124-3p. (A) The potential binding sites between miR-124-3p and Cav1. (B) Luciferase reporter activity in ADSCs transfected with WT, MUT 3'-UTR of Cav1. **P<0.01 vs. mimic NC. (C) qRT-RCR reveals mRNA expression levels of Cav1, Myod, Myog, and MyHC in ADSCs. (D) Western blot reveals the protein levels of Cav1, Myod, Myog, and MyHC in ADSCs. (E) The expression of MyHC was detected by immunofluorescence. (C-E) *P<0.05, **P<0.01 vs. ADSC-GFP; #P<0.05, ##P<0.01 vs miR-124-3p mimic NC; &&P<0.01 vs. empty vector. qRT-PCR, real-time quantitative polymerase chain reaction; ADSCs, adipose-derived stem cells.

Results of LPP test, HE, and Masson staining of urethral and surrounding tissues in each group

After construction of the PFD rat model, the LPP in the PFD model group were found to be smaller than those in the Control group, indicating that the PFD models had been successfully established (). After 4 weeks of ADSC-GFP transplantation, the LPP in the PFD group were significantly increased. Furthermore, the intervention of 5-Aza and miR-124-3p mimics could also increase the value of LPP ().

Figure 5

Animal modeling experiment. Results of LPP (A), HE (B), and Masson staining (C) in the urethra and surrounding tissues among the 5 groups. Amplification, 100×; scale, 20 µm. LPP, leak point pressure; HE, hematoxylin and eosin. **P<0.01 vs. PFD.

In the Control group, the results of HE staining suggested that the arrangement of muscle fibers in urethral and surrounding tissues was intensive, with a complete muscular layer and no rupture, and was pink in color. Nevertheless, the muscular layer of the urethral wall was destroyed, thin, loose, deranged, and shrunken in the PFD model group. Transplantation of ADSC-GFP could distinctly boost the arrangement and density of muscle fibers to tighten the muscular layer and connective tissues of the fascia in the PFD group. Additionally, the muscle fiber structure was completely repaired in the group co-transfected with 5-Aza and miR-124-3p mimics. It was also revealed that 5-Aza could complete the reparative influence of ADSCs on the muscle fiber structure in the PFD group ().

Masson staining led to collagen fibers that were stained blue in color with homogeneous staining and a larger stained area. In the PFD group, the collagen fibers were stained light blue, loose and deranged, and the proportion of connective tissues was obviously fortified. The partial vascular wall was thickened with hyalinization. After ADSC-GFP transplantation, collagen staining was boosted with a regular arrangement. The co-transfection of miR-124-3p mimics and 5-Aza could boost collagen expression, facilitate the repair of structure and tighten the muscular layer and fascia. The 5-Aza could inhibit the impact of ADSCs on the repair of the collagen structure in the PFD group ().

The fascia formation-associated protein expression in rat urethra and surrounding tissues

The RT-PCR results revealed that, compared with the Control group, the expression of miR-124-3p, desmin, calponin, vimentin, elastin, Col1a1, Col3a1, and HOXA11 in the PFD model group was significantly reduced, and the expression of Cav1, LAMC1, MMP1, and MMP9 were significantly increased (). The interventions of ADSC-GFP, 5-Aza, and miR-124-3p mimics could increase the expression of miR-124-3p, desmin, calponin, vimentin, elastin, Col1a1, Col3a1, and HOXA11, while reducing the levels of Cav1, LAMC1, MMP1, and MMP9 ().

Figure 6

The mRNA expression of fascia formation-related genes in the urethra and surrounding tissues were analyzed by qRT-PCR. The mRNA expression of miR-124-3p (A), Cav1 (B), desmin (C), calponin (D), vimentin (E), elastin (F), Col1a1 (G), Col3a1 (H), LAMC1 (I), MMP-1 (J), MMP-9 (K), HOXA11 (L). qRT-PCR, real-time quantitative polymerase chain reaction. *P<0.05, **P<0.01 vs. PFD.

Western blotting results illustrated that, relative to the Control group, the expression of Elastin, Collagen I, Collagen III, and HOXA11 in the PFD model group were visibly reduced, whilst the expression of Cav1, LAMC1, MMP1, and MMP9 were significantly increased (). We found that ADSC-GFP, 5-Aza, and miR-124-3p mimics could increase the expression of elastin, Collagen I, Collagen III, and HOXA11, but decrease the expression of Cav1, LAMC1, MMP1, and MMP9 ().

Figure 7

The protein expression of fascia formation-related genes in the urethra and surrounding tissues were tested by western blotting. The protein expression levels were detected by western blotting (A). The protein expression of Cav1 (B), elastin (C), Collagen I (D), Collagen III (E), LAMC1 (F), MMP-1 (G), MMP-9 (H), HOXA11 (I). *P<0.05, **P<0.01 vs. PFD.

Immunofluorescence results showed that vimentin, desmin, and calponin expression levels in the PFD model group were significantly lower than those in the Control group (). The ADSC-GFP, 5-Aza, and miR-124-3p mimics could all increase the expression of vimentin, desmin, and calponin (). However, the content of GFP were not significantly different among the groups (). Immunofluorescence results showed that Collagen III and Elastin expression levels in the PFD model group were significantly lower than those in the Control group (). The ADSC-GFP, 5-Aza, and miR-124-3p mimics could all increase the expression of Collagen III and Elastin (). Together, these outcomes suggested that miR-124-3p facilitated the survival ADSC-GFP fat transplantation by regulating many key factors in vivo.

Figure 8

The protein expression of fascia formation-related genes in the urethra and surrounding tissues were detected by immunofluorescence. (A) The expression of GFP + calponin, GFP + desmin and GFP + vimentin were detected by immunofluorescence. (B) The protein levels of vimentin, desmin and calponin. (C) The protein levels of GFP + calponin, GFP + desmin and GFP + vimentin. (D) The expression of Collagen III and elastin were detected by immunofluorescence. (E) The protein levels of Collagen III and elastin. *P<0.05, **P<0.01 vs. PFD.

Discussion

The incidence of PFD is high among adult women (25). Stem cells can be easily isolated and expanded from various adult tissues, and the transplantation of ADSCs has been a goal of PFD treatment (26). Additionally, certain miRNAs have been shown to positively modulate ADSCs (27,28). Hence, the aim of our study was to probe the impacts of miR-124-3p-modified ADSCs on PFD recovery.

Many previous studies have demonstrated some functions of ADSCs, including that ADSCs could be successfully separated and ADSCs represented apoptosis potential for adipogenic and osteogenic differentiation (29,30). In line with the above, our study also discovered these kinds of functions in ADSCs. Besides, bone marrow mesenchymal stem cell (BMSC) transplantation has been shown to enhance the LPP in a rat model of PFD (31). In a rat model, the function of bladder was able to be enhanced by MSC injection (32). In our study, we discovered that miR-124-3p, miR-140-5p, and miR-181-5p were highly expressed in ADSCs. Guo et al. (33) revealed that miR-140-5p silencing facilitated osteogenesis of ADSCs through targeting BMP2 and TLR4. Through autophagy activation, exosomes derived from miR-181-5p-modified ADSCs prevented liver fibrosis (34). However, the impacts of miR-124-3p on ADSCs has not yet been reported. So, we chose to study miR-124-3p in the current research experiments. In different tissues and cells, miR-124-3p was pervasive, and could modulate number of pathophysiologic processes via targeting mRNAs (35,36). Besides, miR-124-3p was discovered to be upregulated in MSCs mice (37). Hence, miR-124-3p combined with the injection of ADSCs could strengthen ADSCs transplantation by increasing the LPP of PFD rats. As a result, miR-124-3p combined with ADSC injection could further repair tissue structures, and tighten the muscular connective tissues and fascia. All the above-mentioned functions were affirmed by this experiment.

In most cell types, caveolins, the main component of caveolae, are necessary for small invagination of the plasma membrane (38). Caveolae serve as a signal platform for recruiting a large number of signal molecules, including mitogen-activated protein kinase (MAPK), insulin receptor, and epidermal growth factor receptor (39). As one of the caveolin genes, Cav1 is obviously expressed in adipocytes (40), endothelial cells (41), and smooth muscle cells (40). The genes Cav1 and Cav2 form homo-oligomers or hybrid oligomers and act as scaffold proteins, which bind to signal molecules through their caveolin scaffold domains, thus activating or suppressing signal pathways (42). Through an MAPK pathway-dependent mechanism, Cav1 is crucial in the differentiation of human ADSCs into hepatocyte-like cells (43). However, the deeper mechanisms about the impacts of Cav1 in ADSCs has not yet been elucidated. It has been shown that Cav1 might be a key factor in muscle regeneration (44). By targeting Cav1, miR-3074-3p functioned as a positive regulator of myogenic differentiation (23). These previous reports demonstrated that Cav1 may play different roles in myoblasts or ADSCs; meanwhile, Cav1 may associate with some miRNAs. In our paper, we concluded that miR-124-3p facilitated ADSCs via targeting Cav1. Future investigations into the precise mechanisms underlying Cav1-dependent regulation in ADSCs may offer valuable insights into the development of therapeutics for PFD.

Myogenic differentiation of adipose stem cells is tightly modulated by myogenic regulatory factors (MRFs), such as MyoD, MyHC, and others. In the embryo, and as a fundamental regulator of skeletal muscle lineage determination, MyoD is up-regulated in activated MSCs as an early response to muscle injury (45,46). Sung et al. (47) indicated that MyoD was overexpressed in equine ADSCs, which boosted the potential for myogenic differentiation. During differentiation, the mRNA and protein levels of MyoD1 was reduced by overexpression of miR-483 (48). So far, 8 myosin heavy chain (MyHC) isoforms have been found in mammalian skeletal muscle, but only 4 isoforms are expressed in adult skeletal muscle, namely MyHC-1, MyHC-IIa, MyHC-IIb, and MyHC-II (49). The MyHC gene has different expression patterns in different species and different skeletal muscles (50). However, the influence of MyHC in ADSCs has not yet been reported. Furthermore, the results of immunofluorescence analysis manifested that the number of MyHC-positive myotubes was decreased by miR-483 (48). In line with the above studies, we discovered that miR-124-3p directly targeted MyoD and MyHC to affect its expression on ADSCs.

In addition to MRFs, several other factors are differentially expressed during myogenic differentiation. These factors, such as elastin, Collagen I, Collagen III, HOXA11, LAMC1, MMP1, and MMP9, might emerge as key players in muscle myogenesis by participating in the processes of ADSCs (51,52). Extracellular matrix (ECM) proteins (mainly containing collagen and elastin) have the function of maintaining skin integrity and elasticity, which has become the focus of research for treatment with ADSCs (51). Along with the result of elastin, we found the protein levels of collagen I and III gradually declined in ADSCs. We tested the increases of LAMC1, MMP-1, MMP-9, and HOXA11 mRNA and protein levels. It has been hinted that MMP-1 displays collagenolytic activity, MMP-9 degrades elastin, and HOXA11 mainly repressed the expression of MMP-1 and MMP-9 (53,54). Consistent with the above research, we discovered that these factors might play vital roles in the development of ADSCs.

In this article, we discovered that miR-124-3p regulated Cav1 expression in ADSCs, thereby enhancing myogenesis and influencing PFD. Taken together, our outcomes suggested that miR-1214-3p may be regarded as a positive regulator of ADSCs through the regulation of Cav1 expression, and may have the potential to accelerate PFD. However, there were some limitations in our paper. This is just a preliminary experiment in the role of miR-124-3p and Cav1 on myogenic differentiation of ADSCs during PFD, and further rescue experimental studies are needed to confirm our findings.

The article’s supplementary files as