Literature DB >> 33550920

Long Noncoding RNA FGD5-AS1 Knockdown Decrease Viability, Migration, and Invasion of Non-Small Cell Lung Cancer (NSCLC) Cells by Regulating the MicroRNA-944/MACC1 Axis.

Jian Lv1,2, Qinyong Li2, Ruiqiang Ma2, Zhen Wang2, Yingyu Yu2, Huan Liu2, Yuanxiu Miao2, Shujuan Jiang1,3,4.   

Abstract

OBJECTIVE: Long noncoding RNA FGD5 antisense RNA 1 (FGD5-AS1) participates in the regulation of non-small cell lung cancer (NSCLC) progression, but the underlying mechanisms are not fully revealed. This study aimed to determine the regulatory mechanism of FGD5-AS1 on the viability, migration, and invasion of NSCLC cells.
METHODS: QRT-PCR was performed to measure the expression of FGD5-AS1, microRNA-944 (miR-944), and MACC1 in NSCLC. The correlation between FGD5-AS1 and clinicopathological features of NSCLC patients was analyzed. The viability of NSCLC cells were detected using MTT assay, and the migration and invasion were measured by transwell assay. Additionally, dual-luciferase reporter assay was used to demonstrate the interactions among FGD5-AS1, miR-944, and MACC1. Furthermore, exosomes were isolated from NSCLC cells and identified by transmission electron microscopy (TEM) and western blot. Then, the macrophages treated with exosomes were co-cultured with NSCLC cells to assess the effect of exosomes containing lower FGD5-AS1 level on NSCLC.
RESULTS: The expression of FGD5-AS1 and MACC1 was increased in NSCLC, but miR-944 expression was decreased. FGD5-AS1 expression had significantly correlation with TNM stage and metastasis in NSCLC patients. FGD5-AS1 knockdown decreased the viability, migration, and invasion of NSCLC cells. Additionally, FGD5-AS1 and MACC1 were both targeted by miR-944 with the complementary binding sites at 3' UTR. In the feedback experiments, miR-944 inhibition or MACC1 overexpression reversed the reduction effect of FGD5-AS1 knockdown on the tumorigenesis of NSCLC. Moreover, silencing of FGD5-AS1 suppressed macrophages M2 polarization, and eliminated the promoting effects of exosomes mediated macrophages on NSCLC cell migration and invasion.
CONCLUSIONS: FGD5-AS1 knockdown attenuated viability, migration, and invasion of NSCLC cells by regulating the miR-944/MACC1 axis, providing a new therapeutic target for NSCLC.

Entities:  

Keywords:  MACC1; long noncoding RNA FGD5-AS1; microRNA-944; non-small cell lung cancer; viability

Mesh:

Substances:

Year:  2021        PMID: 33550920      PMCID: PMC7887693          DOI: 10.1177/1533033821990090

Source DB:  PubMed          Journal:  Technol Cancer Res Treat        ISSN: 1533-0338


Introduction

Lung cancer is an important leading cause of cancer death worldwide.[1] Non-small cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancers.[2] Despite the improvements for NSCLC treatment in chemotherapy, radiotherapy, and surgery, the overall cure and survival rates for NSCLC remain low, particularly in metastatic disease.[3] Existing research has been exhibited that combination therapy (using immunotherapies or targeted therapies) may be the ultimate curative option for NSCLC patients.[4] Thus, it is essential to investigate the precise molecular mechanism for NSCLC treatment. Long noncoding RNAs (lncRNAs) are noncoding RNA transcripts, taking part in the progression of lung cancers, such as lung squamous cell carcinoma,[5] lung adenocarcinoma,[6] and small cell lung cancer.[7] Long noncoding RNA FGD5 antisense RNA 1 (FGD5-AS1), one of the lncRNAs, has been demonstrated to participate in a host of cancers. For instances, FGD5-AS1 promotes tumorigenesis of colorectal cancer through regulating the microRNA-302e (miR-302e)/CDCA7 axis.[8] FGD5-AS1 inhibits miR-129-5p expression to induce glioblastoma progression by targeting ZEB1.[9] Notably, FGD5-AS1 regulates miR-107 to increase FGFRL1 expression, contributing to NSCLC cell proliferation.[10] Exosomes (70 to 120 nm) are involved in cells communication by transferring nucleic acids and proteins.[11] Recently, certain exosomal lncRNAs are reported to play critical roles in cancer development. Tumor-derived exosome lncRNA GAS5 acts as biomarker for early-stage NSCLC diagnosis.[12] Interestingly, exosomal lncRNA MALAT-1 promotes growth and attenuates apoptosis of NSCLC cells.[13] However, the relationship between exosomal FGD5-AS1 and NSCLC needs to be further studied. It has been clearly proved that numerous miRNAs have anti-tumor effect on biological processes of NSCLC. For instances, miR-146a restrains cell growth and induces apoptosis in NSCLC cells.[14] MiR-126 retards NSCLC cell proliferation via targeting EGFL7.[15] MiR-200c silencing promotes the invasive and aggressive of NSCLC cells.[16] Notably, miR-944 overexpression attenuates NSCLC cell viability by inhibiting EPHA7 expression.[17] However, the specific regulatory relationship between FGD5-AS1 and miR-944 in NSCLC remains undefined. Metastasis-associated in colon cancer-1 (MACC1) is a critical regulator in the development of cancers. For instances, MACC1 promotes the proliferation and inhibits apoptosis of colorectal cancer cell.[18] MACC1 overexpression predicts poor prognosis and contributes to the tumor cell metastasis of gastric cancer.[19] MACC1 overexpression is related to a later TNM stage in pancreatic cancer.[20] Importantly, MACC1 expression is up-regulated and serves as a potential biomarker in NSCLC.[21] Nevertheless, the potential regulatory mechanism of FGD5-AS1 related to MACC1 in NSCLC is still unknown. In this study, we detected the expression of FGD5-AS1, miR-944, and MACC1. Then, we explored the effects of FGD5-AS1 on viability, migration, and invasion of NSCLC cells. Moreover, we verified whether miR-944 is a target of FGD5-AS1. The relationship between miR-944 and MACC1 was also confirmed. The effect of exosomes containing lower FGD5-AS1 level on tumorigenesis of NSCLC cells was evaluated. Our study may provide a novel therapeutic target for NSCLC.

Materials and Methods

Tissue Samples

Sixty-five NSCLC patients were collected from our hospital between June 2017 and June 2019. Patients had received neither radiotherapy nor chemotherapy prior to resection. Sixty-five NSCLC tissue specimens (NSCLC group) and paired adjacent tissues (Control group) were obtained from the NSCLC patients underwent operation. Patient cohort was separated into high FGD5-AS1 (n = 33) group and low FGD5-AS1 group (n = 32) according to the median FGD5-AS1 expression. This study was permitted by our hospital ethics committee, and informed consents were obtained from each patient.

Cell Culture

Human NSCLC cell lines, H358, H1299, PC-9 and A549 and human bronchial epithelial cells BEAS-2B (American Type Culture Collection, VA, USA) were cultured in DMEM (Invitrogen, Carlsbad, CA, USA) supplied with 10% fetal bovine serum (FBS) at 37°C with 5% CO2. To induce differentiation into macrophages, THP-1 cells (1 × 106) were incubated with 100 ng/mL PMA (Abcam, La Jolla, California, USA) for 24 hours.

Cell Transfection

A short hairpin RNA (shRNA) was designed to target regions of FGD5-AS1, as well as its corresponding scramble negative control (NC) was synthesized by GenePharma (Shanghai, China). Then they were inserted into the pGLVU6/Puro vector (GenePharma) to construct sh-FGD5-AS1 -1, sh-FGD5-AS1-2, and sh-NC. The miR-944 mimics, miR-944 inhibitor, miR-NC, pcDNA3.1-NC (pcDNA-NC), and pcDNA-MACC1 were purchased from GenePharma. A549 and H1299 cells grown to 85% confluence were transfected or co-transfected with these above agents using Lipofectamine 3000 reagent (Invitrogen). Forty-eight hours post-transfection, A549 and H1299 cells were used for further assays.

Exosome Extraction and Identification

Transfected A549 cells were cultured in a complementary medium until 85% confluence, then the medium was replaced the defined medium without FBS. Two days post-culturing, we collected the supernatants and centrifuged them at 300 × g for 15 min, 2000 × g for 15 min, and 10,000 × g for 30 min. The supernatants were filtrated through a 0.22 µm PVDF filter (Millipore, USA). Then the supernatants were harvested to isolate exosomes by ultracentrifugation at 120,000 × g for 70 min twice. Pellets of exosomes were dropped on a 200-mesh copper mesh and incubated at 25°C for 5 min. Then, the exosomes were stained with 1% phosphotungstic acid for 1 min, rinsed 2 times with distilled water. Next, the copper mesh was observed using transmission electron microscopy (TEM)-1400 plus (JEOL, Tokyo, Japan).

Western Blot

Total proteins were extracted from cells and exosomes, and then transferred into SDS-PAGE. Separated protein was transferred onto polyvinylidene fluoride membranes, blocked with 5% skimmed milk, and incubated at 4°C overnight with primary antibodies, including anti-MACC1 (1:1000, ab226803, Abcam), -TSG101 (1:1000, ab125011, Abcam), -CD63 (1:1000, ab134045, Abcam), -CD81 (1:1000, ab79559, Abcam), -Bax (1:1000, ab32503, Abcam), -Bcl-2 (1:1000, ab32124, Abcam), and -β-actin (1:5000, ab6276, Abcam). Afterward, the membranes were subjected to HRP-conjugated secondary antibody against rabbit (1:5000, ab6721, Abcam). The immunoblots were measured through enhanced chemiluminescence, and quantified by ImageLab software (Bio-Rad, Hercules, CA, USA).

The Cell Co-Culture System

We constructed a co-culture system with A549 cells and macrophages through inoculating the cells in the upper and lower chambers, respectively. The A549 cells were divided into the A549, A549 + M (A549 cells were co-cultured with macrophages), A549 + M + Exo-sh-NC (A549 cells were co-cultured with macrophages incubated with 0.2 μg/µL exosomes isolated from A549 cells transfected with sh-NC), and A549 + M + Exo-sh-FDG5-AS1 group (A549 cells were co-cultured with macrophages incubated with 0.2 μg/µL exosomes isolated from A549 cells transfected with sh-FGD5-AS1).

Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)

Total RNA was extracted from tissues, cells, and exosomes using the TRIzol reagent (Invitrogen) and was reverse-transcribed into cDNA by PrimeScript RT reagent kit (Takara, Otsu, Japan). QRT-PCR reaction was performed on ABI 7500HT Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with following conditions: 95°C for 5 min, 40 cycles of 72°C for 34 s and 60°C for 20 s. Relative expression was calculated utilizing the 2-ΔΔCt method, and FGD5-AS1, miR-944, and MACC1 expression was normalized to GAPDH, U6, and β-actin expression, respectively. The primer sequences were shown in Table 1.
Table 1.

Primers Sequences.

Name of primerSequences (5’-3’)
FGD5-AS1-FGAAGGGCCGAAGAGCTCAAT
FGD5-AS1-RGGCTCGCAAAGTGTCTGTTG
GAPDH-FTATGATGATATCAAGAGGGTAGT
GAPDH-RTGTATCCAAACTCATTGTCATAC
miR-944-FGCGGCGGAAATTATTGTACATC
miR-944-RATCCAGTGCAGGGTCCGAGG
CD68-FCTTCTCTCATTCCCCTATGGACA
CD68-RGAAGGACACATTGTACTCCACC
CD163-FTTTGTCAACTTGAGTCCCTTCAC
CD163-RTCCCGCTACACTTGTTTTCAC
CD206-FGGGTTGCTATCACTCTCTATGC
CD206-RTTTCTTGTCTGTTGCCGTAGTT
ARG1-FGGTTTTTGTTGTTGCGGTGTTC
ARG1-RCTGGGATACTGATGGTGGGATGT
iNOS-FAGGGACAAGCCTACCCCTC
iNOS-RCTCATCTCCCGTCAGTTGG
U6-FGCTTCGGCAGCACATATACTAAAAT
U6-RCGCTTCACGAATTTGCGTGTCAT
MACC1-FTCTGTATGAACTTATTGTGGCTC
MACC1-RCATAGGCAGGTTTCCACATC
IL-12-FGAGGGGACAACAAGGAGT
IL-12-RTCAGGGAGAAGTAGGAATG
β-actin-FGGGAAATCGTGCGTGACATTAAG
β-actin-RTGTGTTGGCGTACAGGTCTTTG

ARG1, Arginase 1; IL-12, interleukin-12.

Primers Sequences. ARG1, Arginase 1; IL-12, interleukin-12.

Dual-Luciferase Reporter Assay

The potential binding sites of FGD5-AS1 and miR-944 or miR-944 and MACC1 were predicted by Starbase or TargetScan, respectively. We generated FGD5-AS1 and MACC1 sequences with wide type (WT) or mutated (MUT) miR-944-binding sites and cloned them into psiCHECK-2 vectors (YouBio, Hunan, China). A549 and H1299 cells were co-transfected with above luciferase vectors and miR-NC or miR-944 mimics using Lipofectamine 3000 (Invitrogen).

MTT Assay

A549 and H1299 cells (2 × 103/well) were seeded into 96-well plates and incubated at 37°C under a 5% CO2 atmosphere. After 24, 48, 72, and 96 h of culturing, cell viability was detected using the MTT cell proliferation assay kit (Sigma) according to the manufacturer’s protocol.

Cell Migration and Invasion

Cell migration and invasion assays were performed using 24-well plates and 8-mm transwell inserts (Corning, New York, NY, USA). Cells (2 × 104 cells/well) suspended in 200 mL serum-free medium were seeded into the upper chamber. The lower chamber was supplemented with medium containing 10% FBS. For invasion assay, the upper chambers were per-coated with matrigel (50 mL/well; Sigma). Twenty-four hours post-culturing, cells were stained with 0.1% crystal violet for 0.5 h, the nonmigrating or noninvading cells were discarded. Six visual fields were randomly chosen to calculate the migration.

Statistical Analysis

Data were statistically analyzed using GraphPad Prism 7.0 (GraphPad, San Diego, CA, USA). Data are presented as mean ± standard deviation. Differences between 2 groups or among multiple groups were assessed by Student’s t-test or 1-way ANOVA followed by Tukey’s post-hoc test. The correlation significance was evaluated by Pearson correlation analysis. Differences were considered statistically significant at P < 0.05.

Results

FGD5-AS1 Expression Was Markedly Increased in NSCLC Tissues

FGD5-AS1 expression in NSCLC tissues was measured by qRT-PCR. The FGD5-AS1 expression in tumor tissues was considerably increased compared with that in the adjacent tissues in NSCLC patients (P < 0.01, Figure 1A). Additionally, FGD5-AS1 expression in tumor tissues from patients in TNM III/IV was higher than that in TNM I/II (P < 0.01, Figure 1B). The clinicopathological features displayed that FGD5-AS1 expression had significant correlation with TNM stage and metastasis in NSCLC patients (P < 0.05, Table 2). Furthermore, FGD5-AS1 expression was markedly increased in H358, H1299, PC-9, and A549 cells compared with that in the BEAS-2B cells. The A549 and H1299 cells were used for subsequent assays on account of relative high FGD5-AS1 expression.
Figure 1.

FGD5-AS1 expression was markedly increased in non-small cell lung cancer (NSCLC) tissues. (A) The expression of FGD5-AS1 in NSCLC tissues and adjacent tissues was measured by qRT-PCR. **P < 0.01 vs. adjacent tissues; (B) Relative expression of FGD5-AS1 in NSCLC tissues of patients at the TNM I/II and TNM III/IV. **P < 0.01 vs. TNM I/II; (C) QRT-PCR was performed to detect the expression of FGD5-AS1 in BEAS-2B, H358, H1299, PC-9, and A549 cells. **P < 0.01 vs. BEAS-2B.

Table 2.

Correlation Between FGD5-AS1 Expression and Clinicopathological Features in Non-Small Cell Lung Cancer Patients.

CharacteristicsNFGD5-AS1 (Low)32 (High)33 P value
Age0.908
<60years351718
≥60 years301515
Gender0.724
Male401921
Females251312
TNM stage0.015*
I-II392415
III-IV26818
Metastasis0.018*
NO312011
YES341222
Differentiation0.174
Well/moderate291712
Poor/undifferentiated361521

Note: *P < 0.05.

FGD5-AS1 expression was markedly increased in non-small cell lung cancer (NSCLC) tissues. (A) The expression of FGD5-AS1 in NSCLC tissues and adjacent tissues was measured by qRT-PCR. **P < 0.01 vs. adjacent tissues; (B) Relative expression of FGD5-AS1 in NSCLC tissues of patients at the TNM I/II and TNM III/IV. **P < 0.01 vs. TNM I/II; (C) QRT-PCR was performed to detect the expression of FGD5-AS1 in BEAS-2B, H358, H1299, PC-9, and A549 cells. **P < 0.01 vs. BEAS-2B. Correlation Between FGD5-AS1 Expression and Clinicopathological Features in Non-Small Cell Lung Cancer Patients. Note: *P < 0.05.

FGD5-AS1 Knockdown Inhibited the Tumorigenesis of NSCLC Cells

To explore the effect of FGD5-AS1 on tumorigenesis of NSCLC cells, FGD5-AS1 expression was blocked by the transfection of sh-FGD5-AS1 -1 and sh-FGD5-AS1-2 in A549 and H1299 cells (P < 0.01, Figure 2A). Sh-FGD5-AS1 -1 was used for subsequent functional assays due to its relatively high knockdown efficiency. MTT assay showed that sh-FGD5-AS1 -1 significantly decreased the viability of A549 and H1299 cells at 72 and 96 h post-culturing (P < 0.01, Figure 2B). Transwell assay revealed that FGD5-AS1 knockdown significantly decreased the migration and invasion rates of A549 and H1299 cells (P < 0.01, Figure 2C and D). Bax and Bcl-2 are biomarkers of apoptosis. Silencing of FGD5-AS1 -1 markedly increased the Bax protein level, while decreased the Bcl-2 protein level in A549 and H1299 cells (P < 0.01, Figure 2E).
Figure 2.

FGD5-AS1 knockdown inhibited the tumorigenesis of non-small cell lung cancer (NSCLC) cells. (A) The transfection efficiency of sh-NC, sh-FGD5-AS1 -1, and sh-FGD5-AS1-2 in A549 and H1299 cells was measured by qRT-PCR. **P < 0.01 vs. sh-NC; (B) The viability of A549 and H1299 cells was measured by MTT assay. **P < 0.01 vs. sh-NC; (C and D) Transwell assay was performed to measure the migration and invasion rates of A549 and H1299 cells. **P < 0.01 vs. sh-NC; (E) Relative protein levels of Bax and Bcl-2 in A549 and H1299 cells were measured by western blot. **P < 0.01 vs. sh-NC.

FGD5-AS1 knockdown inhibited the tumorigenesis of non-small cell lung cancer (NSCLC) cells. (A) The transfection efficiency of sh-NC, sh-FGD5-AS1 -1, and sh-FGD5-AS1-2 in A549 and H1299 cells was measured by qRT-PCR. **P < 0.01 vs. sh-NC; (B) The viability of A549 and H1299 cells was measured by MTT assay. **P < 0.01 vs. sh-NC; (C and D) Transwell assay was performed to measure the migration and invasion rates of A549 and H1299 cells. **P < 0.01 vs. sh-NC; (E) Relative protein levels of Bax and Bcl-2 in A549 and H1299 cells were measured by western blot. **P < 0.01 vs. sh-NC.

MiR-944 Served as a Target of FGD5-AS1

To confirm the downstream mechanism of FGD5-AS1 in NSCLC, we predicted the targets of FGD5-AS1. A binding site of miR-944 on the 3’ UTR of FGD5-AS1 was predicated by Starbase (Figure 3A). FGD5-AS1 knockdown markedly up-regulated miR-944 expression in A549 and H1299 cells (P < 0.01, Figure 3B). Then, dual-luciferase reporter assay determined that miR-944 mimics dramatically decreased the luciferase activity of WT FGD5-AS1 reporter vector in A549 and H1299 cells (P < 0.01, Figure 3C). Additionally, miR-944 expression was considerably inhibited in tumor tissues of NSCLC patients (P < 0.01, Figure 3D). Interestingly, a negative correlation between the FGD5-AS1 and miR-944 expression was observed in NSCLC tissues (N = 65, r = -0.3399, P = 0.0056, Figure 3E).
Figure 3.

MiR-944 served as a target of FGD5-AS1. (A) Starbase showed the predicted binding site between FGD5-AS1 and miR-944; (B) The expression of miR-944 was high-expressed by the transfection of sh-FGD5-AS1 -1 in A549 and H1299 cells. **P < 0.01 vs. sh-NC; (C) Relative luciferase activity in A549 and H1299 cells was measured by dual-luciferase reporter assay. **P < 0.01 vs. miR-NC; (D) QRT-PCR was performed to confirm the expression of miR-944 in non-small cell lung cancer (NSCLC) tissues and adjacent tissues. **P < 0.01 vs. adjacent tissues; (E) The expression of FGD5-AS1 was negatively correlated with miR-944 in NSCLC tissues.

MiR-944 served as a target of FGD5-AS1. (A) Starbase showed the predicted binding site between FGD5-AS1 and miR-944; (B) The expression of miR-944 was high-expressed by the transfection of sh-FGD5-AS1 -1 in A549 and H1299 cells. **P < 0.01 vs. sh-NC; (C) Relative luciferase activity in A549 and H1299 cells was measured by dual-luciferase reporter assay. **P < 0.01 vs. miR-NC; (D) QRT-PCR was performed to confirm the expression of miR-944 in non-small cell lung cancer (NSCLC) tissues and adjacent tissues. **P < 0.01 vs. adjacent tissues; (E) The expression of FGD5-AS1 was negatively correlated with miR-944 in NSCLC tissues.

MiR-944 Overexpression Inhibited Progression of NSCLC In Vitro

To assess the biological function of miR-944 in NSCLC, miR-944 was increased or decreased by the transfection of miR-944 mimics or miR-944 inhibitor into A549 and H1299 cells (P < 0.01, Figure 4A). Following the miR-944 overexpression, the viability of A549 and H1299 cells was dramatically decreased at 72 and 96 h post-culturing (P < 0.01, Figure 4B). As depicted in Figure 4C and D, miR-944 overexpression could significantly reduce migration and invasion rates of A549 and H1299 cells (P < 0.01). The protein level of Bax was markedly increased, while the protein level of Bcl-2 was decreased in A549 and H1299 cells after miR-944 overexpression (P < 0.01, Figure 4E).
Figure 4.

MiR-944 overexpression inhibited progression of non-small cell lung cancer (NSCLC) in vitro. (A) The transfection efficiency of miR-NC, miR-944 mimics, and miR-944 inhibitor was demonstrated using qRT-PCR in A549 and H1299 cells. **P < 0.01 vs. miR-NC; (B) MTT assay were performed after transfected with miR-944 mimics or miR-NC in A549 and H1299 cells. **P < 0.01 vs. miR-NC; (C and D) The effects of miR-944 overexpression on migration and invasion rates of A549 and H1299 cells were assessed. **P < 0.01 vs. miR-NC; (E) Western blot was performed to evaluate the protein levels of Bax and Bcl-2 in A549 and H1299 cells. **P < 0.01 vs. miR-NC.

MiR-944 overexpression inhibited progression of non-small cell lung cancer (NSCLC) in vitro. (A) The transfection efficiency of miR-NC, miR-944 mimics, and miR-944 inhibitor was demonstrated using qRT-PCR in A549 and H1299 cells. **P < 0.01 vs. miR-NC; (B) MTT assay were performed after transfected with miR-944 mimics or miR-NC in A549 and H1299 cells. **P < 0.01 vs. miR-NC; (C and D) The effects of miR-944 overexpression on migration and invasion rates of A549 and H1299 cells were assessed. **P < 0.01 vs. miR-NC; (E) Western blot was performed to evaluate the protein levels of Bax and Bcl-2 in A549 and H1299 cells. **P < 0.01 vs. miR-NC.

MACC1 Was Targeted by miR-944

TargetScan was used to predict the binding site for miR-944 on the 3’ UTR of MACC1 (Figure 5A). MiR-944 mimics significantly declined the luciferase activity of WT MACC1 reporter vector in A549 and H1299 cells (P < 0.01, Figure 5B). Furthermore, MACC1 expression in tumor tissues was markedly increased by contrast to that in the adjacent tissues in NSCLC patients (P < 0.001, Figure 5C). There was a negative correlation between the expression of miR-944 and MACC1 in NSCLC tissues (N = 65, r = -0.3307, P = 0.0071, Figure 5D). Notably, western blot assay revealed that transfection of miR-944 mimics could clearly inhibit MACC1 protein expression in A549 and H1299 cells (P < 0.01, Figure 5E).
Figure 5.

MACC1 was targeted by miR-944. (A) TargetScan exhibited the predicted binding site between MACC1 and miR-944; (B) Dual-luciferase reporter assay was performed to measure the relative luciferase activity in A549 and H1299 cells. **P < 0.01 vs. miR-NC; (C) QRT-PCR was used to detect the expression of MACC1 in non-small cell lung cancer (NSCLC) tissues and adjacent tissues. **P < 0.01 vs. adjacent tissues; (D) The expression of MACC1 was negatively correlated with miR-944 in NSCLC tissues; (E) The protein expression of MACC1 in A549 and H1299 cells was measured by western blot. **P < 0.01 vs. miR-NC.

MACC1 was targeted by miR-944. (A) TargetScan exhibited the predicted binding site between MACC1 and miR-944; (B) Dual-luciferase reporter assay was performed to measure the relative luciferase activity in A549 and H1299 cells. **P < 0.01 vs. miR-NC; (C) QRT-PCR was used to detect the expression of MACC1 in non-small cell lung cancer (NSCLC) tissues and adjacent tissues. **P < 0.01 vs. adjacent tissues; (D) The expression of MACC1 was negatively correlated with miR-944 in NSCLC tissues; (E) The protein expression of MACC1 in A549 and H1299 cells was measured by western blot. **P < 0.01 vs. miR-NC.

FGD5-AS1 Knockdown Impeded Tumorigenesis of NSCLC Cells by Regulating the miR-944/MACC1 Axis

MACC1 expression was increased by the transfection of pcDNA-MACC1 in A549 cells (P < 0.01, Figure 6A). To verify whether FGD5-AS1 regulates the miR-944/MACC1 axis in NSCLC, feedback experiments were performed in A549 cells. As illustrated in Figure 6B to D, FGD5-AS1 knockdown visibly reduced the viability, migration, and invasion of A549 cells (P < 0.01). MACC1 overexpression or miR-944 inhibition reversed the inhibitory effect of sh-FGD5-AS1 -1 on tumorigenesis of A549 cells (P < 0.01). In addition, silencing of FGD5-AS1 -1 not only increased the protein level of Bax, but also decreased the protein level of Bcl-2 (P < 0.01). MACC1 overexpression or miR-944 inhibition rescued the effects of sh-FGD5-AS1 -1 on the protein levels of apoptosis biomarkers (P < 0.05, Figure 6E).
Figure 6.

FGD5-AS1 knockdown impeded tumorigenesis of non-small cell lung cancer (NSCLC) cells by regulating the miR-944/MACC1 axis. (A) The transfection efficiency of pcDNA-NC and pcDNA-MACC1 was demonstrated using qRT-PCR in A549 cells. **P < 0.01 vs. pcDNA-NC; (B-D) Overexpression of MACC1 or inhibition of miR-944 reversed the inhibitory effects of FGD5-AS1 knockdown on viability, migration, and invasion of A549 cells. **P < 0.01 vs. sh-NC; ##P < 0.01 vs. sh-FGD5-AS1 -1. (E) Relative protein levels of Bax and Bcl-2 in A549 cells were detected by western blot. **P < 0.01 vs. sh-NC; ##P < 0.01, #P < 0.05 vs. sh-FGD5-AS1 -1.

FGD5-AS1 knockdown impeded tumorigenesis of non-small cell lung cancer (NSCLC) cells by regulating the miR-944/MACC1 axis. (A) The transfection efficiency of pcDNA-NC and pcDNA-MACC1 was demonstrated using qRT-PCR in A549 cells. **P < 0.01 vs. pcDNA-NC; (B-D) Overexpression of MACC1 or inhibition of miR-944 reversed the inhibitory effects of FGD5-AS1 knockdown on viability, migration, and invasion of A549 cells. **P < 0.01 vs. sh-NC; ##P < 0.01 vs. sh-FGD5-AS1 -1. (E) Relative protein levels of Bax and Bcl-2 in A549 cells were detected by western blot. **P < 0.01 vs. sh-NC; ##P < 0.01, #P < 0.05 vs. sh-FGD5-AS1 -1.

Silencing of FGD5-AS1 Inhibited Macrophages M2 Polarization

Exosomes were isolated from supernatants of NSCLC cells and identified by TEM (Figure 7A). Then, we determined the presence of exosomal markers TSG101, CD63, and CD81 (Figure 7B). Above data suggested that exosomes were isolated from NSCLC cell successfully. As displayed in Figure 7C, the expression of macrophage marker CD68 was significantly enhanced in the THP-1 + PMA group (P < 0.01). The FGD5-AS1 expression was markedly increased in the exosomes isolated from A549 and H1299 cells compared with those in the exosomes isolated from BEAS-2B cells (P < 0.01, Figure 7D). Exosomes isolated from A549 cells were used for subsequent assays due to relatively high expression of FGD5-AS1. Next, FGD5-AS1 expression was significantly decreased in exosomes isolated from A549 cells transfected with sh-FGD5-AS1 (P < 0.01, Figure 7E). Importantly, the expression of M2 macrophage markers CD163, CD206, and arginase 1 (ARG1) in macrophages was increased by treatment with exosomes isolated from A549 cells transfected with sh-NC (P < 0.05), and silencing of FGD5-AS1 markedly down-regulated the expression of M2 macrophage markers compared with those in macrophages treated with exosomes isolated from A549 cells transfected with sh-NC (P < 0.01, Figure 7F). Treatment with exosomes isolated from A549 cells transfected with sh-NC, the expression of M1 macrophage markers iNOS and interleukin-12 (IL-12) was decreased in macrophages (P < 0.05), while treatment with exosomes isolated from A549 cells transfected with sh-FGD5-AS1 significantly increased the expression of M1 macrophage markers by contrast to those in macrophages treated with exosomes isolated from A549 cells transfected with sh-NC (P < 0.01, Figure 7G).
Figure 7.

Silencing of FGD5-AS1 inhibited macrophages M2 polarization. (A) Exosomes isolated from supernatants of A549 cells were detected by transmission electron microscopy (TEM). Scale bar = 200 nm; (B) Western blot analysis of exosomes markers TSG101, CD63, and CD81; (C) The mRNA expression of macrophage marker CD68 was measured by qRT-PCR. **P < 0.01 vs. THP-1; (D) The expression of FGD5-AS1 was measured by qRT-PCR in the exosomes isolated from the BEAS-2B, A549, and H1299 cells. **P < 0.01 vs. BEAS-2B; (E) QRT-PCR was performed to confirm the expression of FGD5-AS1 in exosomes isolated from A549 cells. **P < 0.01 vs. sh-NC; (F) The mRNA expression of M2 macrophages markers CD163, CD206, and arginase 1 (ARG1) was measured by qRT-PCR in macrophages. *P < 0.05 vs. Control, ##P < 0.01 vs. Exo-sh-NC; (G) The mRNA expression of M1 macrophage markers iNOS and interleukin 12 (IL-12) was detected by qRT-PCR in macrophages. *P < 0.05 vs. Control, ##P < 0.01 vs. Exo-sh-NC.

Silencing of FGD5-AS1 inhibited macrophages M2 polarization. (A) Exosomes isolated from supernatants of A549 cells were detected by transmission electron microscopy (TEM). Scale bar = 200 nm; (B) Western blot analysis of exosomes markers TSG101, CD63, and CD81; (C) The mRNA expression of macrophage marker CD68 was measured by qRT-PCR. **P < 0.01 vs. THP-1; (D) The expression of FGD5-AS1 was measured by qRT-PCR in the exosomes isolated from the BEAS-2B, A549, and H1299 cells. **P < 0.01 vs. BEAS-2B; (E) QRT-PCR was performed to confirm the expression of FGD5-AS1 in exosomes isolated from A549 cells. **P < 0.01 vs. sh-NC; (F) The mRNA expression of M2 macrophages markers CD163, CD206, and arginase 1 (ARG1) was measured by qRT-PCR in macrophages. *P < 0.05 vs. Control, ##P < 0.01 vs. Exo-sh-NC; (G) The mRNA expression of M1 macrophage markers iNOS and interleukin 12 (IL-12) was detected by qRT-PCR in macrophages. *P < 0.05 vs. Control, ##P < 0.01 vs. Exo-sh-NC.

Silencing of FGD5-AS1 Eliminated the Promoting Effects of Exosomes Mediated Macrophages on NSCLC cell Migration and Invasion

To verify the effect of exosomes containing lower FGD5-AS1 level on the tumorigenesis of NSCLC cells, the migration and invasion capacity of A549 cells co-culture with exosomes-treated macrophages were assessed. As elucidated in Figure 8A and B, macrophages treated with exosomes isolated from A549 cells transfected with sh-NC raised the migration and invasion of A549 cells (P < 0.05). Moreover, macrophages treated with exosomes containing lower FGD5-AS1 level decreased the migration and invasion of A549 cells compared to those in macrophages treated with exosomes containing higher FGD5-AS1 level (P < 0.05).
Figure 8.

Silencing of FGD5-AS1 eliminated the promoting effects of exosomes mediated macrophages on NSCLC cell migration and invasion. (A and B) The migration and invasion rates of A549 cells co-culture with macrophages treated with exosomes were assessed by transwell assay. *P < 0.05 vs. A549 + M, #P < 0.01 vs. A549 + M + Exo-sh-NC.

Silencing of FGD5-AS1 eliminated the promoting effects of exosomes mediated macrophages on NSCLC cell migration and invasion. (A and B) The migration and invasion rates of A549 cells co-culture with macrophages treated with exosomes were assessed by transwell assay. *P < 0.05 vs. A549 + M, #P < 0.01 vs. A549 + M + Exo-sh-NC.

Discussion

Up-regulation of lncRNAs in diverse cancers including NSCLC is involved in the regulation of oncological behaviors.[22,23] In this study, FGD5-AS1 expression was clearly increased in NSCLC tissues and cells, indicating that FGD5-AS1 may be an oncogenic lncRNA of NSCLC. In fact, FGD5-AS1 is up-regulated in various cancers, such as colorectal cancer,[8] glioblastoma,[9] and oral cancer.[24] In the present study, FGD5-AS1 overexpression had significant correlation with TNM stage and metastasis in NSCLC patients. We conjecture that FGD5-AS1 overexpression may predict a poor prognosis for NSCLC. Similarly, previous researches have demonstrated that several lncRNAs are up-regulated and correlated with poor prognosis in NSCLC patients. For instances, lncRNA UCA1 overexpression is visibly related to tumor size and TNM stage in NSCLC patients.[25] LncRNA PVT1 expression is increased in NSCLC patients and is markedly correlated with metastasis and histological grade.[26] LncRNA MIR210HG expression is evidently correlated to metastasis and TNM stage, and NSCLC patients with high lncRNA MIR210HG level have poor outcomes.[27] Above all, we suggest that FGD5-AS1 may be closely related to the development of NSCLC. Previous researches have been determined that FGD5-AS1 has promoting effect on the tumorigenesis of different cancers. In colorectal cancer, FGD5-AS1 inhibits miR-302e expression to facilitate malignant progression of cell by targeting CDCA7.[8] FGD5–AS1 silencing attenuates the proliferative, migratory, and invasive abilities of renal cell carcinoma cells.[28] Notably, FGD5-AS1 binds with miR-140-5p to increase WEE1 expression, promoting NSCLC cell viability, invasion, and autophagy.[29] In this study, FGD5-AS1 knockdown inhibited NSCLC cell viability, migration, and invasion, suggesting that FGD5-AS1 knockdown may have anti-tumor effect on the progression of NSCLC. Prior researches have determined that lncRNAs interact with miRNAs to exert its oncogenic effect in NSCLC. For instances, lncRNA SNHG1 overexpression accelerates malignancy in NSCLC via inhibiting miR-101-3p expression.[30] LncRNA NORAD functions as an oncogene lncRNA in NSCLC by decreasing miR-520a-3p expression.[31] LncRNA MALAT1 promotes NSCLC cell migration and invasion via repressing miR-206 expression.[32] Here, miR-944 contained complementary binding sites with FGD5-AS1, suggesting that FGD5-AS1 may be involved in NSCLC by regulating miR-944 expression. Increasing researches have been exhibited that miR-944 is down-regulated and plays key role in tumor development. MiR-944 expression is severely inhibited and miR-944 overexpression attenuates the cell growth in breast cancer.[33] MiR-944 restrains the tumorigenesis of hepatocellular carcinoma via regulating IGF-1 R.[34] Importantly, miR-944 is down-regulated and performs an anti-tumor effect in lung adenocarcinoma.[35] In this study, we observed that miR-944 attenuated the viability, migration, and invasion of NSCLC cells, suggesting that miR-944 may act as an anti-onco-miR in NSCLC. In addition, miR-944 was demonstrated to be a target of FGD5-AS1. The expression of miR-944 was inhibited and inversely related to FGD5-AS1 expression in NSCLC tissues, indicating that FGD5-AS1 may exert cancer-promoting effect on NSCLC cells by decreasing miR-944 expression. Feedback experiments were used to verify this conjecture. The results displayed that miR-944 inhibition apparently reversed the inhibitory effects of FGD5-AS1 knockdown on NSCLC cell viability, migration, and invasion. Taken together, FGD5-AS1 knockdown may decrease the tumorigenesis of NSCLC cells via suppressing miR-944 expression. MACC1 has been found to be an oncogenic gene, and MACC1 expression is increased in lung cancer.[36,37] Similarly, MACC1 expression was significantly up-regulated in NSCLC tissues in this study, suggesting that MACC1 may be an oncogene in NSCLC. Numerous studies have been demonstrated that MACC1 exerts pro-tumor effect in lung cancers. For instances, MACC1 overexpression is related to postoperative recurrence in lung adenocarcinoma.[38] MACC1 knockdown attenuates cell proliferation and promotes cell apoptosis via modulating β-catenin pathway in lung adenocarcinoma.[39] Additionally, MACC1 is involved in different cancer progression as a target gene for miR-944. For instances, miR-944 serves as an inhibitor of metastasis in gastric cancer via targeting MACC1.[40] MiR-944 attenuates cell migration and invasion in nasopharyngeal carcinoma via regulating MACC1.[41] MiR-944 impedes cell growth in colorectal cancer via regulating MACC1.[42] In the present study, MACC1 was a target of miR-944, the expression of MACC1 and miR-944 was inversely correlated in the NSCLC tissues. We suspect that miR-944 involves in the development of NSCLC by targeting MACC1. Considering the interaction between FGD5-AS1 and miR-944, we hypothesize that FGD5-AS1 may increase MACC1 expression by inhibiting miR-944 expression in NSCLC. Encouragingly, feedback experiments exhibited that MACC1 up-regulation reversed the inhibitory effects of FGD5-AS1 knockdown on NSCLC cell viability, migration, and invasion. To sum up, we suggest that FGD5-AS1 knockdown attenuates viability, migration, and invasion of NSCLC cells via regulating the miR-944/MACC1 axis. Certain cancer cell-derived exosomes transport lncRNA into macrophages which cause macrophages M2 polarization, promoting the cancer development. For example, exosomal lncRNA RPPH1 promotes macrophages M2 polarization to increase proliferation and metastasis of colorectal cancer cells.[43] Here, exosomes containing lower FGD5-AS1 level was transported to macrophages. The up-regulation of M1 polarization and down-regulation of M2 polarization markers caused by FGD5-AS1 silencing indicated that FGD5-AS1 silencing may attenuate macrophages M2 polarization. It has been documented that exosomal lncRNAs participate in the tumorigenesis of different cancers. Exosomes shuttle ZFAS1 to promote the proliferation and inhibit the apoptosis of esophageal squamous cell carcinoma cell via decreasing miR-124 and increasing STAT3 expression.[44] Restrained lncRNA SBF2-AS1 in M2 macrophage-derived exosomes induces constraining tumorigenic ability of pancreatic cancer cells.[45] Interestingly, exosomal lncRNA UFC1 contributes to NSCLC progression via suppressing PTEN expression.[46] In this study, FGD5-AS1 silencing eliminated the promoting effects of exosomes mediated macrophages on NSCLC cell migration and invasion. We conjecture that exosomes containing lower FGD5-AS1 level may inhibit macrophages M2 polarization to decrease NSCLC cell migration and invasion. The specific regulatory function of exosomal FGD5-AS1 in the development of NSCLC relating the macrophages M2 polarization needs to be further studied. There are some limitations in this study. First, the expression of FGD5-AS1, miR-944, and MACC1 is not measured in exosomes isolated from clinical samples. Second, the regulatory mechanism of miR-944/MACC1 axis involving M2 macrophage polarization is not analyzed. Third, there are many other downstream targets of FGD5-AS1 that have not yet been determined in NSCLC. Fourth, this study is limited to the cellular level and in vivo experiments are needed. Related experiments will be considered in our future studies. In conclusion, FGD5-AS1 expression was increased in NSCLC tissues and cells. FGD5-AS1 knockdown increased MACC1 expression by inhibiting miR-944 expression to decrease viability, migration, and invasion of NSCLC cells. Moreover, FGD5-AS1 silencing may suppress macrophages M2 polarization, and eliminate the promoting effects of exosomes mediated macrophages on NSCLC cell migration and invasion (Supplemental Figure 1). Our research may give a potential therapeutic target for NSCLC.
  46 in total

1.  MACC1 silencing inhibits cell proliferation and induces cell apoptosis of lung adenocarcinoma cells through the β-catenin pathway.

Authors:  S Zhang; Y Lai; L Guo; S Ou; X Ma
Journal:  Neoplasma       Date:  2018       Impact factor: 2.575

2.  Increased expression of the lncRNA PVT1 promotes tumorigenesis in non-small cell lung cancer.

Authors:  Yan-Rong Yang; Shu-Zhi Zang; Chun-Lei Zhong; Yun-Xia Li; Sha-Sha Zhao; Xian-Jun Feng
Journal:  Int J Clin Exp Pathol       Date:  2014-09-15

3.  LncRNA-ATB Promotes Lung Squamous Carcinoma Cell Proliferation, Migration, and Invasion by Targeting microRNA-590-5p/NF90 Axis.

Authors:  Jiayi Li; Rongmu Xia; Tao Liu; Xuemin Cai; Guojun Geng
Journal:  DNA Cell Biol       Date:  2020-01-14       Impact factor: 3.311

4.  Tumor-derived exosomal lncRNA GAS5 as a biomarker for early-stage non-small-cell lung cancer diagnosis.

Authors:  Chuling Li; Yanling Lv; Chenye Shao; Cen Chen; Tianli Zhang; Yuqing Wei; Hang Fan; Tangfeng Lv; Hongbin Liu; Yong Song
Journal:  J Cell Physiol       Date:  2019-04-29       Impact factor: 6.384

5.  FGD5-AS1 facilitates glioblastoma progression by activation of Wnt/β-catenin signaling via regulating miR-129-5p/HNRNPK axis.

Authors:  Lixin Wu; Xuqiang Zhu; Zhenyu Song; Mengguo Guo; Junxin Liang; Dongming Yan
Journal:  Life Sci       Date:  2020-06-22       Impact factor: 5.037

6.  LncRNA MALAT1 exerts oncogenic functions in lung adenocarcinoma by targeting miR-204.

Authors:  Jipeng Li; Jianhua Wang; Yin Chen; Shanfeng Li; Mingwei Jin; Huaying Wang; Zhe Chen; Wanjun Yu
Journal:  Am J Cancer Res       Date:  2016-05-01       Impact factor: 6.166

7.  Down-regulated lncRNA SBF2-AS1 in M2 macrophage-derived exosomes elevates miR-122-5p to restrict XIAP, thereby limiting pancreatic cancer development.

Authors:  Zi Yin; Yu Zhou; Tingting Ma; Sheng Chen; Ning Shi; Yiping Zou; Baohua Hou; Chuanzhao Zhang
Journal:  J Cell Mol Med       Date:  2020-04-16       Impact factor: 5.310

8.  miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells.

Authors:  Gang Chen; Ijeoma Adaku Umelo; Shasha Lv; Erik Teugels; Karel Fostier; Peter Kronenberger; Alex Dewaele; Jan Sadones; Caroline Geers; Jacques De Grève
Journal:  PLoS One       Date:  2013-03-26       Impact factor: 3.240

9.  MicroRNA-944 Affects Cell Growth by Targeting EPHA7 in Non-Small Cell Lung Cancer.

Authors:  Minxia Liu; Kecheng Zhou; Yi Cao
Journal:  Int J Mol Sci       Date:  2016-09-26       Impact factor: 5.923

10.  Exosome-transmitted lncRNA UFC1 promotes non-small-cell lung cancer progression by EZH2-mediated epigenetic silencing of PTEN expression.

Authors:  Xueyan Zang; Jianmei Gu; Jiayin Zhang; Hui Shi; Sinan Hou; Xueying Xu; Yanke Chen; Yu Zhang; Fei Mao; Hui Qian; Taofeng Zhu; Wenrong Xu; Xu Zhang
Journal:  Cell Death Dis       Date:  2020-04-02       Impact factor: 8.469

View more
  5 in total

Review 1.  Role of exosomal non-coding RNAs from tumor cells and tumor-associated macrophages in the tumor microenvironment.

Authors:  Zijie Xu; Yi Chen; Ling Ma; Yizhang Chen; Jingya Liu; Yuchen Guo; Ting Yu; Lianghui Zhang; Lingjun Zhu; Yongqian Shu
Journal:  Mol Ther       Date:  2022-04-09       Impact factor: 12.910

Review 2.  The role of long non-coding RNA FGD5-AS1 in cancer.

Authors:  Na He; Linbiao Xiang; Lei Chen; Haobin Tong; Keshen Wang; Jie Zhao; Feixue Song; Hanteng Yang; Xinyuan Wei; Zuoyi Jiao
Journal:  Bioengineered       Date:  2022-04       Impact factor: 6.832

Review 3.  Novel Insights into miR-944 in Cancer.

Authors:  Jinze Shen; Qurui Wang; Chenhao Liang; Xinming Su; Yufei Ke; Yunan Mao; Jie Fang; Shiwei Duan
Journal:  Cancers (Basel)       Date:  2022-08-31       Impact factor: 6.575

Review 4.  Long Non-Coding RNAs in Lung Cancer: The Role in Tumor Microenvironment.

Authors:  Shuang Dai; Ting Liu; Yan-Yang Liu; Yingying He; Tao Liu; Zihan Xu; Zhi-Wu Wang; Feng Luo
Journal:  Front Cell Dev Biol       Date:  2022-01-03

5.  Activation of FGD5-AS1 Promotes Progression of Cervical Cancer through Regulating BST2 to Inhibit Macrophage M1 Polarization.

Authors:  Guokun Liu; Xuan Du; Li Xiao; Qing Zeng; QianLing Liu
Journal:  J Immunol Res       Date:  2021-10-15       Impact factor: 4.818

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.