| Literature DB >> 33533740 |
Guo-Ping Mao1,2,3, Ming-Hui Niu1, Ying-Hong Cui4, Rui-Ling Tang4, Wei Chen4, Bang Liu4, Zuping He4,1.
Abstract
Spermatogonial stem cells (SSCs) have great applications in both reproductive and regenerative medicine. Primates including monkeys are very similar to humans with regard to physiology and pathology. Nevertheless, little is known about the isolation, the characteristics, and the culture of primate SSCs. This study was designed to identify, isolate, and culture monkey SSCs. Immunocytochemistry was used to identify markers for monkey SSCs. Glial cell line-derived neurotrophic factor family receptor alpha-1 (GFRA1)-enriched spermatogonia were isolated from monkeys, namely Macaca fascicularis (M. fascicularis), by two-step enzymatic digestion and magnetic-activated cell sorting, and they were cultured on precoated plates in the conditioned medium. Reverse transcription-polymerase chain reaction (RT-PCR), immunocytochemistry, and RNA sequencing were used to compare phenotype and transcriptomes in GFRA1-enriched spermatogonia between 0 day and 14 days of culture, and xenotransplantation was performed to evaluate the function of GFRA1-enriched spermatogonia. SSCs shared some phenotypes with rodent and human SSCs. GFRA1-enriched spermatogonia with high purity and viability were isolated from M. fascicularis testes. The freshly isolated cells expressed numerous markers for rodent SSCs, and they were cultured for 14 days. The expression of numerous SSC markers was maintained during the cultivation of GFRA1-enriched spermatogonia. RNA sequencing reflected a 97.3% similarity in global gene profiles between 0 day and 14 days of culture. The xenotransplantation assay indicated that the GFRA1-enriched spermatogonia formed colonies and proliferated in vivo in the recipient c-KitW/W (W) mutant mice. Collectively, GFRA1-enriched spermatogonia are monkey SSCs phenotypically both in vitro and in vivo. This study suggests that monkey might provide an alternative to human SSCs for basic research and application in human diseases.Entities:
Keywords: Macaca fascicularis; characterization; isolation and culture; spermatogonial stem cells; transplantation and transcriptomes
Mesh:
Year: 2021 PMID: 33533740 PMCID: PMC8152426 DOI: 10.4103/aja.aja_95_20
Source DB: PubMed Journal: Asian J Androl ISSN: 1008-682X Impact factor: 3.285
The sequences of gene primers used for reverse transcription-polymerase chain reaction
| Forward | TGGAAACAGAGATGCTGGTG | 300 | 55 | |
| Reverse | GGGCTTCCTAGACCAAATCC | |||
| Forward | ATCATCCTCCTCCACCACAG | 292 | 55 | |
| Reverse | TCATTTGGCACAACTTCAGC | |||
| Forward | CTAGTGGACCAGAGCCTTCG | 312 | 54 | |
| Reverse | GCCCTCACACTTGACCAGTT | |||
| Forward | TCGGTTCTCCTACTCCTTAGC | 240 | 60 | |
| Reverse | CCGCTTTTAGGGGTTCAGGT | |||
| Forward | TGCTGAACAAAGTGCTGTCC | 299 | 56 | |
| Reverse | TCCATCCTCAAATCCCAGTT | |||
| Forward | GTTCAGCCAAACGACCATCT | 296 | 58 | |
| Reverse | ACACTCGGACCACATCCTTC | |||
| Forward | ATCACTGCCACCCAGAAGAC | 302 | 55 | |
| Reverse | ACCTGGTGCTCAGTGTAGCC | |||
DAZL, DEAD-box helicase 4; THY1, thy-1 cell surface antigen; GFRA1, glial cell line-derived neurotrophic factor family receptor alpha-1; UCHL1, ubiquitin C-terminal hydrolase L1; OCT4, POU class 5 homeobox 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase
The reads and gene numbers in glial cell line-derived neurotrophic factor family receptor alpha-1-enriched spermatogonia stem cells of Macaca fascicularis
| Freshly separated GFRA1-enriched spermatogonia | 47,027,940 | 20,886 |
| GFRA1-enriched spermatogonia after culture for 14 days | 47,440,288 | 20,886 |
GFRA1, glial cell line-derived neurotrophic factor family receptor alpha-1