| Literature DB >> 33522630 |
Xian-Hui Zhang1, Wei Wang2, Xin Chen3.
Abstract
This study was to find the aptamers with high affinity and specificity binding to acute promyelocytic leukemia (APL) NB4 cell line. These aptamers targeted NB4 cells were selected from a random single-stranded DNA (ssDNA) library of systematic evolution of ligands by exponential enrichment (CELL-SELEX). The binding rate of FITC-ssDNA library and NB4 cells was monitored using flow cytometry and fluorescence microscope. After cloned and sequenced, the structure, specificity, and affinity of these candidate aptamers were further analyzed. After a total of 19 rounds of selection, the ssDNA library was enriched and the BR (19.9%) of the 16th round was 12 times of the first round (1.6%). Three enriched aptamers were obtained from 21 positive clones of the 16th round, and the predicted secondary structures of these aptamers were mainly stem-loop. The aptamer CX9 had the highest affinity, and the equilibrium dissociation constant (Kd) was 16.2 nM. The fluorescence intensity of CX9 binding to NB4 cells was stronger than HL60 and K562 cells under fluorescence microscopy. The study indicates that aptamer CX9 exhibits high affinity and specificity with NB4 cells and lay a foundation for the rapid diagnostic method to detect APL with fluorescence-labeled aptamer.Entities:
Keywords: APL; CELL-SELEX; NB4 cell; aptamer; leukemia
Year: 2021 PMID: 33522630 PMCID: PMC8059720 DOI: 10.1002/jcla.23718
Source DB: PubMed Journal: J Clin Lab Anal ISSN: 0887-8013 Impact factor: 2.352
FIGURE 1The binding rate of aptamer pool in the SELEX experiment
The sequence, dG, BR, and Kd of clone aptamers
| Aptamer | Random sequence of the selected aptamers | dG kcal/mol | BR% | Kd nM |
|---|---|---|---|---|
| CX1 | CGTCGTGCTATAATGTCTAACCCCGGCAAGTTTTCCATCG | −0.62 | 9.7 | n.d. |
| CX5 | CGCAAATGGGTTTTTTATTCTTTTTGGATTTTGGGTGTGG | −0.32 | 12.6 | n.d. |
| CX9 | CCATATGTGAGTTTCTTTTTTTGTTTCTCTTGGGCGGGCG | −1.33 | 17.2 | 16.2 |
Abbreviations: dG, free energy; BR, binding rate; Kd, dissociation constant; n.d., not determined.
FIGURE 2The predicted secondary structures of three enriched aptamers
FIGURE 3Binding affinity of the aptamer CX9 with NB4 cells
FIGURE 4Specificity analysis of TAMRA‐labeled aptamer CX9 with NB4 cell, K562, and HL60