Literature DB >> 33522630

Selection and identification of an ssDNA aptamer to NB4 cell.

Xian-Hui Zhang1, Wei Wang2, Xin Chen3.   

Abstract

This study was to find the aptamers with high affinity and specificity binding to acute promyelocytic leukemia (APL) NB4 cell line. These aptamers targeted NB4 cells were selected from a random single-stranded DNA (ssDNA) library of systematic evolution of ligands by exponential enrichment (CELL-SELEX). The binding rate of FITC-ssDNA library and NB4 cells was monitored using flow cytometry and fluorescence microscope. After cloned and sequenced, the structure, specificity, and affinity of these candidate aptamers were further analyzed. After a total of 19 rounds of selection, the ssDNA library was enriched and the BR (19.9%) of the 16th round was 12 times of the first round (1.6%). Three enriched aptamers were obtained from 21 positive clones of the 16th round, and the predicted secondary structures of these aptamers were mainly stem-loop. The aptamer CX9 had the highest affinity, and the equilibrium dissociation constant (Kd) was 16.2 nM. The fluorescence intensity of CX9 binding to NB4 cells was stronger than HL60 and K562 cells under fluorescence microscopy. The study indicates that aptamer CX9 exhibits high affinity and specificity with NB4 cells and lay a foundation for the rapid diagnostic method to detect APL with fluorescence-labeled aptamer.
© 2021 The Authors. Journal of Clinical Laboratory Analysis published by Wiley Periodicals LLC.

Entities:  

Keywords:  APL; CELL-SELEX; NB4 cell; aptamer; leukemia

Year:  2021        PMID: 33522630      PMCID: PMC8059720          DOI: 10.1002/jcla.23718

Source DB:  PubMed          Journal:  J Clin Lab Anal        ISSN: 0887-8013            Impact factor:   2.352


INTRODUCTION

Acute promyelocytic leukemia (APL) is a unique subtype of acute myeloid leukemia and accounts for 10%–15% of all acute myeloid leukemia. APL is characterized by 15;17 chromosome translocation with breakpoints within promyelocytic leukemia (PML) gene on 15 and the retinoic acid alpha receptor gene (RARa) on 17. The translocation leads to the formation of PMLRARA fusion protein, which interference the structure of POD and block myeloid differentiation. In the past three decades, the treatment of all‐trans retinoic acid and (ATRA) and arsenic trioxide (ATO) has been expected to cure the majority of APL patients and improved the long‐term survival to 80–90% or higher. , However, early death with hemorrhage and the risk of relapse remain to be a challenge. Early detection and diagnosis of new and recurring patients are vital. Currently, immunophenotyping via immunohistochemistry and flow cytometric analysis plays a pivotal role in the detection and diagnosis of APL. However, it is nonspecific for the surface biomarkers used for immunophenotyping APL. And it is difficult to determine the disease status, when there are only a few leukemic cells with similar immunophenotypic to normal cells in relapsed patients. In addition, fluorescent labeled antibodies are hard to preserve and expensive, which limit their application for the primary laboratory. Therefore, it is necessary to establish a new strategy to detect APL and discover new biomarkers. Aptamers, which are synthetic single strand oligonucleotides, can bind their target with high specificity and affinity. They are screened from large oligonucleotide pools by the SELEX technology. Their characteristics are superior to antibodies in many aspects. They may substitute antibodies to determine the levels and inhibit the bioactivities of their target. There are broad application prospects of aptamers in the treatment of varied diseases. Cell‐SELEX uses intact living cells as a screening target. Compared to SELEX based on known targets, its major advantage is that it can simultaneously target a variety of membrane proteins with natural conformations as target molecules during the screening process. And it is not necessary to know the types of cell surface proteins and their expression levels in advance. Aptamers screening for tumor cells has brought new ideas and methods for drug screening, clinical diagnosis, disease treatment, and basic medical research. In previous studies, we have selected aptamers targets staphylococcal enterotoxin A (SEA) and B (SEB), which have been proven to bind these toxins and inhibit their biological activity in vivo and in vitro. In this study, NB4 cells were used as the target cell and specific aptamers were selected by cell‐SELEX to provide new molecule candidates for the targeted diagnosis and treatment of APL.

MATERIAL AND METHODS

SELEX library and primers

The ssDNA library consisted of a random sequence of 40nt as a central region and two fixed 18nt as primer hybridization regions. All oligonucleotides were synthesized and purified by Invitrogen (Guangzhou, China). The sequences of library and primers are as follows: Library:5′‐ATACCAGCTTATTCAATT–N40–AGATAGTAAGTGCAATCT‐3′. “P1” forward primer: 5′‐ATACCAGCTTA TTCAATT‐3′. “P2” reverse primer: 5′‐AGATTGCACTTACTATCT‐3′. “P3” forward primer: 5′‐FITC‐ATACCAGCTTATTCAATT‐3′. “P4” reverse primer: 5′‐Biotin‐AGATTGCACTTACTATCT‐3′. “P5” forward primer: 5′‐TAMRA‐ATACCAGCTTATTCAATT‐3′.

Cells and cell culture

Acute myeloid leukemia (AML) cell lines NB4 cells, HL60 cells, and CML K562 cells provided by the blood institute of Union Hospital of Fujian Medical University. All cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS and 100 units/ml penicillinstreptomycin (Invitrogen). Cells were washed with phosphate‐buffered saline (Invitrogen) three times and then resuspended in the selection buffer. The selection buffer was prepared by adding 4.5 g/L glucoses, 5 mM MgCl2, 0.1 mg/ml yeast tRNA (Invitrogen), and 1 mg/ml bovine serum albumin (BSA) (Amresco) into PBS. All cells were incubated in an incubator with 37℃ and 5% CO2.

Cell‐SELEX process

The selection processes were performed similarly as described before. The initial ssDNA pool (2000 pmol) was dissolved in 1 ml of the selection buffer, denatured by heating at 95℃ for 5 min, and placed on ice for 10 min immediately. Firstly, 4× 106K562 and HL60 cells were incubated with the initial DNA pool at 37℃ for 30 min with shaking. Next, the supernatant was used for the first round selection, which was incubated with 6 × 106 NB4 cells at 37℃ for 60 min with shaking. After the incubation, unbound ssDNA supernatant was removed and the cells were washed with washing buffer (4.5 g/L glucose, 5 mM MgCl2, PH 7.5) 2–5 times. The washing time was increased with selection round. Finally, cells with bound ssDNA were resuspended with 500 µl ddH2O, followed by incubation at 94℃ for 10 min. Then, the bound ssDNA was used as templates for amplified with P3 and P4 primers (5 min at 94°C, 15 to 30 cycles of 30S at 94°C, 30S at 57°C, and 30S at 72°C, followed by 5 min at 72°C). DNA products of FITC‐labeled sense and biotin‐labeled antisense were synthesized. All PCR products were purified using a Biospin gel extraction kit (Bioer Technology, Hangzhou, China). The M‐280 streptavidin Dynabeads (Dynal) was used to separate the biotinylated strands from the FITC‐labeled strands based on the manufacturer's protocol. The FITC‐labeled ssDNA was used for binding assay and the next round library. In order to obtain aptamers with high affinity, the selective pressure was increased by reducing the target cell number, ssDNA concentration, and incubation time, and by increasing washing times. To increase the specificity of aptamers, the mixed liquor of K562 and HL60 was used for counter selection.

Cloning, sequencing, and bioinformatics analysis

After rounds of cell‐SELEX selection, the affinity analysis showed the library was enriched. The enriched ssDNA was amplified using unlabeled P1 and P2 primers and then were purified and cloned into pGEM‐T vector (Promega, Madison, WI, USA). After being transformed into Escherichia coli DH5, the cultured colonies were chosen randomly and sequenced by Huada Genomics Institute (Beijing, China). The aptamer sequences were analyzed by Chromas software, and the secondary structure was predicted by Dnaman.

Flow cytometric analysis of aptamer binding to target cells

Flow cytometric analysis was used to monitor the enrichment of the ssDNA library every three rounds. FITC‐labeled ssDNA library (50 pmol) or selected individual aptamers (50 pmol) was then incubated with 1 × 106 cells in 500 μ L of binding buffer at 37°C for 30 mins. After incubation, the cells were washed three times with the washing buffer. The fluorescence intensity was determined with a FACS Aria SORP flow cytometer (BD Bioscience, USA) by counting 10,000 events. The FITC‐labeled initial library was used as a negative control. The affinity of the selected individual aptamers was also analyzed as described above but with varying concentration of ssDNA aptamer (10 to 150 nM/L) and a constant amount of NB4 cells (6 × 106). The GraphPad Prism 6.0 software was used to calculate the Kd value via nonlinear regression analysis.

Fluorescence microscope assays for aptamers

Fluorescence microscope IX81 (Olympus, Japan) assay was performed to determine the specificity of each selected aptamer visually. The best candidate aptamer with TAMRA‐labeled was incubated with NB4 cells (1 × 106) and the mixture of HL60 and K562 cell (each 0.5 × 106), respectively, in 500 µl binding buffer at 37℃ for 30 min. After washing three times with washing buffer, the cells were observed by fluorescence microscope.

RESULTS

The enrichment of ssDNA library

The enrichment of the ssDNA library was monitored by flow cytometric every three rounds. The binding rate of ssDNA libraries was gradually increased with the number of screening rounds until the 16th round. As shown in Figure 1, there was no further increase after additional 3 rounds selection. The result indicated that the oligonucleotides with high binding affinity to NB4 cells had already been enriched at the 16th round.
FIGURE 1

The binding rate of aptamer pool in the SELEX experiment

The binding rate of aptamer pool in the SELEX experiment

Cloning, sequencing and secondary structure of selected Aptamers

The enriched library of the 16th round was chosen to be amplified and cloned. Two positive clones were selected and sequenced randomly. The result showed three enriched aptamers. There were two CX1, three CX5, and sixteen CX9 sequences, respectively. Details of three selected aptamers are shown in Table 1. The predicted secondary structures of three aptamers are mainly stem‐loop (Figure 2).
TABLE 1

The sequence, dG, BR, and Kd of clone aptamers

AptamerRandom sequence of the selected aptamersdG kcal/molBR%Kd nM
CX1CGTCGTGCTATAATGTCTAACCCCGGCAAGTTTTCCATCG−0.629.7n.d.
CX5CGCAAATGGGTTTTTTATTCTTTTTGGATTTTGGGTGTGG−0.3212.6n.d.
CX9CCATATGTGAGTTTCTTTTTTTGTTTCTCTTGGGCGGGCG−1.3317.216.2

Abbreviations: dG, free energy; BR, binding rate; Kd, dissociation constant; n.d., not determined.

FIGURE 2

The predicted secondary structures of three enriched aptamers

The sequence, dG, BR, and Kd of clone aptamers Abbreviations: dG, free energy; BR, binding rate; Kd, dissociation constant; n.d., not determined. The predicted secondary structures of three enriched aptamers

Binding rate of these selected aptamers

Flow cytometric analysis was also performed to determine the binding affinity of selected aptamers to NB4 cell. The analysis revealed that the BRs of CX1, CX5, and CX9 reached 9.7%, 12.6%, and 17.2%, respectively.

Affinity and specificity of CX9 aptamer

The best candidate aptamer CX9 was used for further analysis. The FITC‐labeled CX9 aptamer was diluted with the concentration range of 0–150 nm. Then, a fixed amount of live NB4 cells (1 × 106) was combined with the various concentrations aptamers in the binding buffer, and the fluorescence intensity was measured by flow analysis. These data were obtained and analyzed by GraphPad.Prism. V4.03 software, and the saturation combination curve was obtained, as shown in Figure 3. It could be seen that the dissociation constant Kd value of the aptamer CX9 is 16.2 ± 3.22 nM.
FIGURE 3

Binding affinity of the aptamer CX9 with NB4 cells

Binding affinity of the aptamer CX9 with NB4 cells TAMRA‐labeled aptamer CX9 was used to verify the specificity with NB4 cells. As show in Figure 4, the scattered, light, red fluorescence could be seen under fluorescence microscopy when aptamers incubated with NB4 cells. While incubating with HL60 and K562 cells, there was no obvious red fluorescence. The result showed that CX9 aptamer could recognize the target cells specifically.
FIGURE 4

Specificity analysis of TAMRA‐labeled aptamer CX9 with NB4 cell, K562, and HL60

Specificity analysis of TAMRA‐labeled aptamer CX9 with NB4 cell, K562, and HL60

DISCUSSION

Acute promyelocytic leukemia is distinguished by a large number of hyper granular promyelocytes in the blood and bone marrow of patients. Although most of the APL patients have been induced complete remission, it is still urgent to detect rare tumor cells for early diagnosis. The NB4 cell line, which is characterized by t (15;17) translocation and highly sensitive to the differentiation induced by ATRA and ATO, is an ideal cell for studying the proliferation and differentiation of APL. In this study, we identified three aptamers and their structure targets NB4 cells. Further analysis revealed that the aptamer CX9 could bind NB4 with high sensitivity and specificity. Aptamers are short ssDNA or ssRNA, which bind extensive targets including metal ions, bacteria, proteins, and cells with their three‐dimensional structure. , , RNA could form abundant 3D structures and was used as the initial oligonucleotide pools previously. Currently, due to their high stability, DNA pools are more widely used for the selection of new aptamers. In this study, a total length of 76nt ssDNA library was chemically synthesized, consisting of a random middle 40nt sequence flanked by a 18nt fixed sequence. The library, with approximately 1014–1016 random ssDNA, was applied to generate aptamers against SEA in our previous study successfully. CELL‐SELEX technology, which is used for developing aptamers specific to whole cells, has been performed to screen aptamers binding to diverse tumor cells, such as prostate cancer, breast cancer, , ovarian cancer cell, gastric cancer, and liver cancer. Cell‐SELEX is carried out in the native state of the target cell without any prior knowledge of the membrane protein, which not only enhances the success of screening, but also has the potential to discover new cell biomarkers. Besides, the optimization of screening process plays a crucial role to success. Herein, with the selection rounds, we reduced the pool concentration, the number of PCR cycles and incubation time and increased the washing times to enhance the pressure and save time. In order to reduce the nonspecific ssDNA, k562 and HL6 cells were used for counter selection since the second round. The cells status is also vital to enrich target‐specific aptamers efficiently. More than 5% dead cells may lead to the failure of the experiment. Therefore, during the selection process, the experimental environment was strictly controlled to ensure state the cells. The living cells were guaranteed to free from pollution and maintain a stable state by using a low speed and low temperature centrifugation to separate the bound or unbound ssDNA with NB4 cells. Nucleic acid not only takes biological genetic information, but also has the structure information. ssRNA or ssDNA can form structures with high thermal stability like stem ring, convex ring, fake knot, G‐four polymers to embed the crack of target molecules, and bind to target cells. In our study, a total of 22 clones from the 16th round were chosen to identify the enriched specific sequences and predict their secondary structure. The sequencing results showed that one sequence had bimodal, which might be due to two or more T‐vectors transformed to one bacterium. Other candidates were classified into three families based on the same DNA sequences and named by the debut candidates. Dnaman software was used to predict the secondary structure of three aptamers. Simulated diagram displayed that these secondary structures of the three aptamers were mainly circle and convex ring, which might be the spot of aptamers combined with target cells. Each aptamer contained an unclosed semicircle with different size and position, which was due to the common fixed sequence on both sides. These BRs of the three aptamers with NB4 living cells were further analyzed by flow cytometry. It showed that CX9 had the highest binding rate of 17.2%. In general, the secondary structure with lower free energy was more stable. Besides, the number of repeats was considered important in preselecting potential aptamers. CX9 with the lowest free energy and high BR also had the absolute predominance in the number of repeats, suggesting that CX9 might be the ideal candidate. Therefore, it was chosen for further characterization of its affinity and specificity with NB4 cell. The dissociation constant Kd value of the aptamer CX9 was as low as 16.2 nM, indicating a high affinity CX9 with NB4 cells. FITC‐labeled ssDNA was used in the SELEX process, and fluorescence microscope was also performed to observe the combination of the ssDNA pools and NB4 living cells. However, there were more cluster nonspecific green light with lower brightness under the fluorescence microscope, which was called spontaneous fluorescence. Therefore, TAMRA was chosen as an alternative fluorescence to avoid cell spontaneous fluorescence when we analyzed the specificity of CX9 with NB4 cells. The results showed CX9 could recognize the NB4 cells specifically and rarely binding to K562 cell and HL60 cell. With the advanced in aptamers selection and modification, a number of aptamers have been on the road to clinical application. Based on their unique characteristics, such as lack of immunogenicity, small molecular weight, chemical synthesis, and easily modification, high thermal stability, and better tissue penetration, aptamers hold great potential for cancer imaging, diagnosis, and therapy. In conclusion, in the study, we successfully select an aptamer CX9 targeting NB4 cell with high affinity and specificity and lay a foundation for the rapid diagnostic method to detect APL with fluorescence‐labeled aptamer. Future studies are still needed to validate the target molecule and function of CX9 to NB4 cell.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.
  17 in total

1.  Nucleic Acid Selection and the Challenge of Combinatorial Chemistry.

Authors:  Scott E. Osborne; Andrew D. Ellington
Journal:  Chem Rev       Date:  1997-04-01       Impact factor: 60.622

2.  Selection of aptamers for molecular recognition and characterization of cancer cells.

Authors:  Zhiwen Tang; Dihua Shangguan; Kemin Wang; Hui Shi; Kwame Sefah; Prabodhika Mallikratchy; Hui William Chen; Ying Li; Weihong Tan
Journal:  Anal Chem       Date:  2007-05-27       Impact factor: 6.986

Review 3.  Acute promyelocytic leukemia: evolving therapeutic strategies.

Authors:  Martin S Tallman; Chadi Nabhan; James H Feusner; Jacob M Rowe
Journal:  Blood       Date:  2002-02-01       Impact factor: 22.113

4.  Detection of Circulating Tumor Cells in Breast Cancer Patients by Nanopore Sensing with Aptamer-Mediated Amplification.

Authors:  Xinqiong Li; Peng Zhang; Linqin Dou; Yu Wang; Ke Sun; Xialin Zhang; Guiqin Song; Changjian Zhao; Kaiju Li; Yunjin Bai; Xiaojun Zeng; Cuisong Zhou; Binwu Ying; Jie Chen; Jia Geng
Journal:  ACS Sens       Date:  2020-05-26       Impact factor: 7.711

5.  The acute promyelocytic leukemia-specific PML-RAR alpha fusion protein inhibits differentiation and promotes survival of myeloid precursor cells.

Authors:  F Grignani; P F Ferrucci; U Testa; G Talamo; M Fagioli; M Alcalay; A Mencarelli; F Grignani; C Peschle; I Nicoletti
Journal:  Cell       Date:  1993-08-13       Impact factor: 41.582

6.  Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores.

Authors:  Milada Ikanovic; Walter E Rudzinski; John G Bruno; Amity Allman; Maria P Carrillo; Sulatha Dwarakanath; Suneetha Bhahdigadi; Poornima Rao; Johnathan L Kiel; Carrie J Andrews
Journal:  J Fluoresc       Date:  2007-01-31       Impact factor: 2.217

7.  Curative strategies in acute promyelocytic leukemia.

Authors:  Martin S Tallman; Jessica K Altman
Journal:  Hematology Am Soc Hematol Educ Program       Date:  2008

8.  Retinoic acid and arsenic trioxide for acute promyelocytic leukemia.

Authors:  Francesco Lo-Coco; Giuseppe Avvisati; Marco Vignetti; Christian Thiede; Sonia Maria Orlando; Simona Iacobelli; Felicetto Ferrara; Paola Fazi; Laura Cicconi; Eros Di Bona; Giorgina Specchia; Simona Sica; Mariadomenica Divona; Alessandro Levis; Walter Fiedler; Elisa Cerqui; Massimo Breccia; Giuseppe Fioritoni; Helmut R Salih; Mario Cazzola; Lorella Melillo; Angelo M Carella; Christian H Brandts; Enrica Morra; Marie von Lilienfeld-Toal; Bernd Hertenstein; Mohammed Wattad; Michael Lübbert; Matthias Hänel; Norbert Schmitz; Hartmut Link; Maria Grazia Kropp; Alessandro Rambaldi; Giorgio La Nasa; Mario Luppi; Fabio Ciceri; Olimpia Finizio; Adriano Venditti; Francesco Fabbiano; Konstanze Döhner; Michaela Sauer; Arnold Ganser; Sergio Amadori; Franco Mandelli; Hartmut Döhner; Gerhard Ehninger; Richard F Schlenk; Uwe Platzbecker
Journal:  N Engl J Med       Date:  2013-07-11       Impact factor: 91.245

9.  Single-Strand DNA-Like Oligonucleotide Aptamer Against Proprotein Convertase Subtilisin/Kexin 9 Using CE-SELEX: PCSK9 Targeting Selection.

Authors:  Roohollah Sattari; Abbasali Palizban; Hossein Khanahmad
Journal:  Cardiovasc Drugs Ther       Date:  2020-08       Impact factor: 3.727

10.  Molecular Recognition of Human Liver Cancer Cells Using DNA Aptamers Generated via Cell-SELEX.

Authors:  Jiehua Xu; I-Ting Teng; Liqin Zhang; Stefanie Delgado; Carole Champanhac; Sena Cansiz; Cuichen Wu; Hong Shan; Weihong Tan
Journal:  PLoS One       Date:  2015-05-04       Impact factor: 3.240

View more
  1 in total

Review 1.  Applications of Smartphone-Based Aptasensor for Diverse Targets Detection.

Authors:  Ying Lan; Baixun He; Cherie S Tan; Dong Ming
Journal:  Biosensors (Basel)       Date:  2022-06-30
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.