| Literature DB >> 33518145 |
Zuodong Chen1, Tong Xing1, Jiaolong Li1, Lin Zhang1, Yun Jiang2, Feng Gao3.
Abstract
Oxidative stress has always been a hot topic in poultry science. However, studies concerning the effects of redox status and glucose metabolism induced by hydrogen peroxide (H2O2) in the breast muscle of broilers have been rarely reported. This study was aimed to evaluate the impact of intraperitoneal injection of H2O2 on oxidative damage and glycolysis metabolism of breast muscle in broilers. We also explored the activation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway to provide possible mechanism of the redox imbalance. Briefly, a total of 320 one-day-old Arbor Acres chicks were randomly divided into 5 treatments with 8 replicates of 8 birds each (noninjected control, 0.75% saline-injected, 2.5, 5.0, and 10.0% H2O2-injected treatments). Saline group was intraperitoneally injected with physiological saline (0.75%) and H2O2 groups received an intraperitoneal injection of H2O2. The dosage of the injection was 1.0 mL/kg BW. All birds in the saline and H2O2 groups were injected on days 16 and 37 of the experimental period. At 42 d of age, 40 birds (8 cages per group and one chicken per cage) were selected to be stunned electrically (50 V, alternating current, 400 Hz for 5 s each one), and then immediately slaughtered via exsanguination. The results showed that broilers in the H2O2 injection group linearly exhibited higher contents of reactive oxygen species, carbonyl and malondialdehyde, and lower total antioxidant capacity and glutathione peroxidase activities. With the content of H2O2 increased, the H2O2 groups linearly downregulated the mRNA expressions of GPX, CAT, HMOX1, NQO1, and Nrf2 and its downstream target genes. In addition, H2O2 increased serum activities of creatine kinase and lactate dehydrogenase. Meanwhile, in the pectoral muscle, the glycogen content was linearly decreased, and the lactate content was linearly increased in muscle of broilers injected with H2O2. In addition, the activities of glycolytic enzymes including pyruvate kinase, hexokinase, and lactate dehydrogenase were linearly increased after exposure to H2O2. In conclusion, H2O2 injection could impair antioxidant status and enhance anaerobic metabolism of breast muscle in broilers.Entities:
Keywords: Nrf2 signaling pathway; antioxidant capacity; broiler; glycolysis metabolism; hydrogen peroxide; reactive oxygen species
Mesh:
Substances:
Year: 2020 PMID: 33518145 PMCID: PMC7858176 DOI: 10.1016/j.psj.2020.11.029
Source DB: PubMed Journal: Poult Sci ISSN: 0032-5791 Impact factor: 3.352
Composition and nutrient levels of the basal diets.
| Item | 1–21 d | 22–42 d |
|---|---|---|
| Ingredients (%) | ||
| Corn | 57.61 | 62.27 |
| Soybean meal | 31.00 | 23.00 |
| Corn gluten meal | 3.29 | 6.00 |
| Soybean oil | 3.11 | 4.00 |
| Limestone | 1.20 | 1.20 |
| Dicalcium phosphate | 2.00 | 2.00 |
| L-lysine | 0.34 | 0.35 |
| DL-methionine | 0.15 | 0.08 |
| Salt | 0.30 | 0.30 |
| Premix | 1.00 | 1.00 |
| Calculated nutrient levels | ||
| ME (MJ/kg) | 12.56 | 13.19 |
| CP (%) | 21.10 | 19.60 |
| Ca (%) | 1.00 | 0.95 |
| Available phosphorus (%) | 0.46 | 0.39 |
| Lysine (%) | 1.20 | 1.05 |
| Methionine (%) | 0.50 | 0.42 |
| Methionine + cysteine (%) | 0.85 | 0.76 |
| Analyzed nutrient levels | ||
| CP (%) | 20.83 | 19.25 |
| Ca (%) | 1.02 | 0.98 |
| Total phosphorus (%) | 0.65 | 0.62 |
Abbreviations: Ca, calcium; ME, metabolizable energy.
The crude protein (CP) content was 60%. Per kilogram of diet.
Premix provided per kilogram of diet: vitamin A, 12,000 IU; cholecalciferol for vitamin D3, 2,500 IU; DL-α-tocopheryl acetate for vitamin E, 20 IU; menadione sodium bisulfate, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8.0 mg; nicotinamide, 40 mg; choline chloride, 400 mg; calcium pantothenate, 10 mg; pyridoxine HCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B 12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8.0 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc sulfate), 60 mg; I (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg.
The primer sequences used for real-time quantitative PCR analysis.
| Gene | GenBank number | Primer sequence (5′→3′) | Product size (bp) |
|---|---|---|---|
| Nrf2 | Forward: CAGGCCGTCTTGAAGCTCATCTC | 179 | |
| Reverse: CTTGCCTCTCCTGCGTATATCTCG | |||
| HMOX1 | Forward: ACGTCGTTGGCAAGAAGCATCC | 181 | |
| Reverse: TTGAACTTGGTGGCGTTGGAGAC | |||
| NQO1 | Forward:TCGCCGAGCAGAAGAAGATTGAAG | 191 | |
| Reverse: GGTGGTGAGTGACAGCATGGC | |||
| SOD | Forward: GGTGACCTCGGCAATGTGACTG | 93 | |
| Reverse:AATGATGCAGTGTGGTCCGGTAAG | |||
| CAT | Forward: CACGTATTCAGGCACTGCTGGAC | 86 | |
| Reverse: ACGAGAAGTGGCTTGCGTGTATG | |||
| GPx | Forward: AAGTGCTGCTGGTGGTCAACG | 155 | |
| Reverse: GTTGGTGGCGTTCTCCTGGTG | |||
| GAPDH | Forward: GGTAGTGAAGGCTGCTGCTGATG | 200 | |
| Reverse: AGTCCACAACACGGTTGCTGTATC |
Abbreviations: CAT, catalase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPx, glutathione peroxidase; HMOX1, heme oxygenase 1; Nrf2, nuclear factor erythroid two-related factor 2; NQO1, NAD(P)H quinone dehydrogenase 1; SOD, superoxide dismutase.
Effects of intraperitoneal injection of H2O2 on the antioxidant activities and the content of oxidative products in the breast muscle of broilers.
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| Control | Saline | 2.5% H2O2 | 5.0% H2O2 | 10.0% H2O2 | ANOVA | Linear | Quadratic | |
| ROS generation(% of NC) | 100.00 ± 1.23d | 97.88 ± 1.92d | 109.81 ± 3.11c | 129.92 ± 4.04b | 138.62 ± 3.14a | <0.001 | <0.001 | 0.717 |
| T-AOC, U/mg of protein | 0.26 ± 0.02a | 0.22 ± 0.01a,b | 0.18 ± 0.02b,c | 0.17 ± 0.03b,c | 0.15 ± 0.01c | <0.001 | <0.001 | 0.112 |
| T-SOD, U/mg of protein | 56.57 ± 3.46 | 57.33 ± 4.03 | 55.34 ± 2.11 | 53.18 ± 2.90 | 49.18 ± 2.71 | 0.371 | 0.055 | 0.651 |
| GSH-Px, U/mg of protein | 14.27 ± 1.96a | 14.39 ± 1.93a | 10.47 ± 1.84a,b | 9.64 ± 1.18a,b | 8.27 ± 1.39b | 0.044 | 0.003 | 0.538 |
| Protein carbonyl, nmol/mg of protein | 2.19 ± 0.10c | 2.15 ± 0.09c | 2.39 ± 0.11c | 2.91 ± 0.08b | 3.33 ± 0.12a | <0.001 | <0.001 | 0.210 |
| MDA, nmol/mg of protein | 0.47 ± 0.02c | 0.49 ± 0.01b,c | 0.52 ± 0.01b | 0.60 ± 0.02a | 0.64 ± 0.01a | <0.001 | <0.001 | 0.761 |
Results are represented as the mean value ± SE (n = 8). The differences between the mean values obtained in each treatment were evaluated by the analyses of variance (ANOVA; SPSS 19.0). Differences among the means were tested using Duncan's multiple-range tests. a,b,c,dMeans in a row without a common superscript letter significantly differ (P < 0.05).
Abbreviations: GSH-Px, glutathione peroxidase; MDA, malondialdehyde; ROS, reactive oxygen species; T-AOC, total antioxidant capacity; T-SOD, total superoxide dismutase.
The control group was the noninjected treatment. The saline group: Birds were injected intraperitoneally with physiological saline buffer (0.75%) with an injection dosage of 1.0 mL/kg BW. The 2.5% H2O2, 5.0% H2O2 and 10.0% H2O2 groups: Birds were given an intraperitoneal injection of 2.5, 5.0 and 10.0% H2O2 with an injection dosage of 1.0 mL/kg BW.
Orthogonal polynomial contrast was used to determine linear and quadratic effects of increasing concentrations of H2O2 injection.
Effects of intraperitoneal injection of H2O2 on activities of serum CK and LDH in broiler chickens.
| Items | Treatments | |||||||
|---|---|---|---|---|---|---|---|---|
| Control | Saline | 2.5% H2O2 | 5.0% H2O2 | 10.0% H2O2 | ANOVA | Linear | Quadratic | |
| CK, U/mL | 2.18 ± 0.17b | 2.29 ± 0.19b | 2.56 ± 0.24b | 2.49 ± 0.21b | 3.28 ± 0.18a | 0.004 | 0.001 | 0.539 |
| LDH, U/mL | 2.54 ± 0.29 | 2.77 ± 0.17 | 2.34 ± 0.23 | 2.93 ± 0.32 | 3.28 ± 0.34 | 0.172 | 0.070 | 0.414 |
Results are represented as the mean value ± SE (n = 8). The differences between the mean values obtained in each treatment were evaluated by the analyses of variance (ANOVA; SPSS 19.0). Differences among the means were tested using Duncan's multiple-range tests. a,bMeans in a row without a common superscript letter significantly differ (P < 0.05).
Abbreviations: CK, creatine kinase; LDH, lactate dehydrogenase.
The control group was the noninjected treatment. The saline group: Birds were injected intraperitoneally with physiological saline buffer (0.75%) with an injection dosage of 1.0 mL/kg BW. The 2.5% H2O2, 5.0% H2O2 and 10.0% H2O2 groups: Birds were given an intraperitoneal injection of 2.5, 5.0 and 10.0% H2O2 with an injection dosage of 1.0 mL/kg BW.
Orthogonal polynomial contrast was used to determine linear and quadratic effects of increasing concentrations of H2O2 injection.
Effects of intraperitoneal injection of H2O2 on the contents of glycogen, lactate and key muscle glycolytic enzymes in breast muscle of broiler chickens.
| Items | Treatments | ANOVA | ||||||
|---|---|---|---|---|---|---|---|---|
| Control | Saline | 2.5% H2O2 | 5.0% H2O2 | 10.0% H2O2 | Linear | Quadratic | ||
| Glycogen, μmol/g | 4.46 ± 0.07a | 4.47 ± 0.05a | 3.72 ± 0.03b | 3.70 ± 0.05b | 3.41 ± 0.04c | <0.001 | <0.001 | 0.007 |
| Lactate, μmol/g | 149.83 ± 12.95b | 154.12 ± 3.85b | 140.27 ± 9.48b | 164.56 ± 4.90a,b | 184.24 ± 11.61a | 0.022 | 0.013 | 0.162 |
| GP, μmol/g | 158.75 ± 13.04b | 163.06 ± 3.89a,b | 147.69 ± 9.50b | 171.95 ± 4.89a,b | 191.06 ± 11.58a | 0.029 | 0.021 | 0.151 |
| HK, U/g of protein | 13.11 ± 0.85b | 12.79 ± 0.54b | 13.54 ± 0.81b | 17.07 ± 1.62a | 18.51 ± 1.54a | <0.001 | <0.001 | 0.525 |
| PK, U/g of protein | 8.04 ± 0.62c | 8.14 ± 0.49c | 8.71 ± 0.53b,c | 10.66 ± 1.03a,b | 11.22 ± 0.94a | 0.011 | 0.001 | 0.933 |
| LDH, U/mg of protein | 3.14 ± 0.16c | 3.31 ± 0.11c | 3.83 ± 0.12b | 3.74 ± 0.15b | 4.43 ± 0.16a | <0.001 | <0.001 | 0.642 |
Results are represented as the mean value ± SE (n = 8). The differences between the mean values obtained in each treatment were evaluated by the analyses of variance (ANOVA; SPSS 19.0). Differences among the means were tested using Duncan's multiple-range tests. a,b,cMeans in a row without a common superscript letter significantly differ (P < 0.05).
Abbreviations: GP, glycolytic potential, 2[glycogen] + [lactate]; HK, hexokinase; LDH, lactate dehydrogenase; PK, pyruvate kinase.
The control group was the noninjected treatment. The saline group: Birds were injected intraperitoneally with physiological saline buffer (0.75%) with an injection dosage of 1.0 mL/kg BW. The 2.5% H2O2, 5.0% H2O2 and 10.0% H2O2 groups: Birds were given an intraperitoneal injection of 2.5, 5.0 and 10.0% H2O2 with an injection dosage of 1.0 mL/kg BW.
Orthogonal polynomial contrast was used to determine linear and quadratic effects of increasing concentrations of H2O2 injection.
Figure 1Effects of H2O2 on the relative mRNA expressions of Nrf2 and antioxidative capacity–related genes of breast muscle in broilers. The control group was the noninjected treatment. The saline group: Birds were injected intraperitoneally with physiological saline buffer (0.75%) with an injection dosage of 1.0 mL/kg BW. The 2.5% H2O2, 5.0% H2O2 and 10.0% H2O2 groups: Birds were given an intraperitoneal injection of 2.5, 5.0, and 10.0% H2O2 with an injection dosage of 1.0 mL/kg BW. Data are means ± SE of 8 replicates of one bird per cage (n = 8). The differences between the mean values obtained in each treatment were evaluated by the analyses of variance (ANOVA; SPSS 19.0). Differences among the means were tested using Duncan's multiple-range tests. a,b,cMeans in a row without a common superscript letter significantly differ (P < 0.05). Abbreviations: CAT, catalase; GPx, glutathione peroxidase; HMOX1, heme oxygenase 1; Nrf2, nuclear factor erythroid two-related factor 2; NQO1, NAD(P)H quinone dehydrogenase 1; SOD, superoxide dismutase.