| Literature DB >> 33518102 |
Jihene Lachheb1, Adam Jbenyeni2, Jihene Nsiri3, Imen Larbi3, Faten Ammouna3, Imen El Behi3, Abdeljelil Ghram3.
Abstract
Infectious bursal disease (IBD), an acute, highly contagious, and immunosuppressive avian disease, is caused by infectious bursal disease virus (IBDV) and constitutes one of the main threats to the poultry industry, worldwide. This study was performed to isolate and characterize IBDV isolates circulating in Tunisia. Eleven collected bird samples were identified using an SYBR Green-based one-step real-time reverse transcriptase polymerase chain reaction. The full-length genome sequencing of 7 of the 11 IBDV isolates has been realized. VP2 gene data showed limited sequence variations for all the 7 tested samples. The few nucleotide changes were silent and the deduced amino acid sequences were identical with the exception of a unique and characteristic nonsilent mutation (C1203) detected for the TN37/19 isolate, with a change of amino acid (L) to (F) at position 401. In addition, the serine-rich heptapeptide SWSASGS, characteristic of virulent IBDV, as well the amino acid residues, conserved in most very virulent IBDV (vvIBDV) strains, were detected in all the Tunisian tested isolates. Nucleotide sequences of VP5 gene revealed the presence of 5 substitutions leading to changes in the amino acid sequences of the virus. Two of these mutations were unique and characteristic of the Tunisian isolates. Besides, the alternative AUG start codon, characteristic of vvIBDV, was observed in all obtained VP5 gene sequences. The Tunisian protein sequences of VP1 showed E242 and the TDN triplet at positions 145, 146, and 147, a motif specific of vvIBDV. Phylogenetic analyses of the 5 genes confirmed the sequence alignment results and showed that the Tunisian strains are closely related to the very virulent Algerian IBDV strains.Entities:
Keywords: Tunisia; full genome; phylogeny; vvIBDV
Mesh:
Substances:
Year: 2020 PMID: 33518102 PMCID: PMC7858174 DOI: 10.1016/j.psj.2020.11.035
Source DB: PubMed Journal: Poult Sci ISSN: 0032-5791 Impact factor: 3.352
Summary table of flock sample history.
| Sample code/years of isolation | Production type | Age (days) | All number | Region |
|---|---|---|---|---|
| TN575/13 | B | 24 | NS | NS |
| TN54/17 | B | 30 | 24,000 | Nadhour |
| TN160/17 | B | 37 | 24,000 | Sfax |
| TN106/18 | B | 23 | NS | Zaghouan |
| TN19/19 | B | 30 | 6,400 | Morneg, El Ksibi |
| TN20/19 | B | 25 | 10,000 | Ghobet Legha, Korba |
| TN37/19 | B | 26 | 15,000 | Soliman |
| TN46/19 | B | 28 | 17,000 | Soliman |
| TN57/19 | B | 33 | 7,100 | Ben Arous |
| TN74/19 | B | 26 | 19,000 | Boumhel |
| TN95/19 | BC | NS | 50 | Ben Arous |
B= Broilers.
BC= Backyard Chicken.
Primers used for the RT-PCR amplification of all genes.
| Target regions | Primers 5′-3′ | Positions | Length (bp) | References |
|---|---|---|---|---|
| F: GGATACGATCGGTCTGAC | 1-1,263 | 1,263 | ||
| The following of | F: GCCCAGAGTCTACACCAT | 736-1,478 | 743 | |
| F: GGATACGATGGGTCTGAC | 1-695 | 695 | ||
| F: GCATAGCCCAGCTACTTGA | 662-1,384 | 722 | ||
| F:CGGTGAGGATGACAAGCCCC | 756-1,522 | 767 | ||
| F:ACCCTTGTGCTAGACCAGTG | 1,518-1,997 | 480 | ||
| F: ATACAGCAAAGATCTCGGG | 1,839-2,827 | 988 | ||
| F:GGTCTAGAAAGTTGGCTGGTCCCGGAGCATT | 2,233-3,172 | 939 | ||
| F: GCAGGAGCATTCGGCTTC | 1,446-2,466 | 1,020 |
Nucleotide and amino acid substitutions in all genes between Tunisian and other IBDV strains.
| Strains | Nucleotide mutations | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| VP1 | VP5 | VP2 | ||||||||
| 275 | 807 | 823 | 1195 | 1490 | 2209 | 2621 | 15 | 16 | 1200 | |
| TN | G | T | T | A | A | A | C | A | A | C |
| Others | T | A | A | G | G | C/T | A | T | C | A/G |
Figure 1Phylogenetic tree of the Gumboro disease virus based on the alignment of the nucleotide sequences of the VP1 gene. Tunisian isolates are marked with a red diamond.
Figure 2Phylogenetic tree of the Gumboro disease virus based on the alignment of the nucleotide sequences of the VP2 gene. Tunisian isolates are marked with a red diamond.
Figure 3Phylogenetic tree of the Gumboro disease virus based on the alignment of the nucleotide sequences of the VP3 gene. Tunisian isolates are marked with a red diamond.
Figure 4Phylogenetic tree of the Gumboro disease virus based on the alignment of the nucleotide sequences of the VP4 gene. Tunisian isolates are marked with a red diamond.
Figure 5Phylogenetic tree of the Gumboro disease virus based on the alignment of the nucleotide sequences of the VP5 gene. Tunisian isolates are marked with a red diamond.