Literature DB >> 33489809

Coexistence of a novel CCNY-ALK and ATIC-ALK double-fusion in one patient with ALK-positive NSCLC and response to crizotinib: a case report.

Xuan Wu1, Hanqiong Zhou1, Zhen He1, Zhe Zhang1, Wen Feng2, Jiuzhou Zhao3, Haiyang Chen1, Shuai Wang1, Wei Wang4, Qiming Wang1.   

Abstract

Anaplastic lymphoma kinase (ALK) rearrangement, one of the common oncogene rearrangements in the mutational history of lung adenocarcinoma, occurs in approximately 5% of non-small cell lung cancer (NSCLC) patients who could be effectively treated with ALK tyrosine kinase inhibitors (TKIs). The earlier phase III PROFILE 1014 study has shown that crizotinib, a first-generation ALK-TKI, significantly improved progression-free survival (PFS) compared with platinum-based chemotherapy in patients with previously untreated advanced ALK-positive NSCLC. Thus, clinicians must screen potential candidates for this driver alteration to guide ALK inhibitor therapy with a molecular testing platform capable of capturing all ALK fusions. Echinoderm microtubule-associated proteins, including the EML4 gene, are the most common ALK rearrangement partner. With the widespread use of the next-generation sequencing (NGS) techniques, which could approach enable the simultaneous screening of multiple genetic alterations, increasingly ALK rearrangement partners have been documented. However, the concurrent two ALK rearrangements within the same patient have rarely previously been reported. Here, we describe a novel CCNY-ALK (C1:A20) and ATIC-ALK (A7:A20), coexisting in the same case with poorly differentiated NSCLC and providing evidence of its sensitivity to ALK inhibitors. The newly identified rearrangement partners can be added to the list of ALK rearrangements that occurred in ALK-positive NSCLC, as it could lead to prolonged disease control. Also, while different ALK rearrangement variants might bring differing clinical outcomes, we discuss the impact of the co-mutations of these two ALK rearrangements on the sensitivity to ALK inhibitors. However, the impact of co-mutations on the pathogenesis of NSCLC should be further studied to supply more theoretical insight that co-mutations present for personalized anti-cancer therapy. 2020 Translational Lung Cancer Research. All rights reserved.

Entities:  

Keywords:  5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC); Anaplastic lymphoma kinase (ALK); case report; cyclin Y (CCNY); non-small cell lung cancer (NSCLC)

Year:  2020        PMID: 33489809      PMCID: PMC7815378          DOI: 10.21037/tlcr-20-1049

Source DB:  PubMed          Journal:  Transl Lung Cancer Res        ISSN: 2218-6751


Introduction

Anaplastic lymphoma kinase (ALK)-positive non-small cell lung cancer (NSCLC), which results in dysregulation and incorrect signaling through the ALK kinase domain, comprises approximately 4% of all lung cancer and carries an excellent prognosis with ALK tyrosine kinase inhibitors (TKIs) (1,2). ALK rearrangement is usually taken into consideration when deciding on the administration of ALK-TKIs for the management of NSCLC. With the popularity of next-generation sequencing (NGS) technology, besides EML4-ALK, other rearrangement types sensitive to ALK-TKIs, including SPECC1L-ALK, PLEKHM2-ALK, and WDPCP-ALK, have been detected (3-5); however, the case with ALK double rearrangement is rare (6). Also, considering the disparate clinical outcome of different ALK variants, it is imperative to test the response of both double and new types of rearrangement to ALK-TKIs. Some previous reports have confirmed that patients with double ALK rearrangements may be sensitive to crizotinib. Here, we present the case of an ALK-positive poorly differentiated NSCLC patient with cyclin Y (CCNY)-ALK and 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC)-ALK, treated with crizotinib and achieved a partial response for at least six months. This patient with the novel double-ALK rearrangement responded to crizotinib and a novel CCNY-ALK rearrangement was detected. In the CCNY-ALK rearrangement, the breakpoint occurs in intron 1 of CCNY and in intron 19 of ALK, the promotor region of CCNY and the entire intracellular kinase domain of ALK was retained. This is the first paper to report the novel double-ALK rearrangement of CCNY-ALK and ATIC-ALK that respond to crizotinib treatment. We present the following article in accordance with the CARE reporting checklist (available at http://dx.doi.org/10.21037/tlcr-20-1049).

Case presentation

A 32-year-old man with a ten pack per year smoking history was admitted to our hospital for thoracic examination complaining of coughing and hemoptysis for more than one month. Chest computed tomography (CT) reveals a left hilar mass, measured 84 mm × 53 mm, accompanied by pulmonary atelectasis in association with pleural effusion, obstructive pneumonia, enlargement of the hilum of the left lung, and mediastinal lymph nodes (). No metastases were found by magnetic resonance imaging (MRI) of the brain. CT-guided pulmonary puncture pathology analysis showed poorly differentiated NSCLC (cT4N3M1a, stage Iva). Immunohistochemistry analysis was positive for thyroid transcription factor 1, CK, LCA, Vim, and 80% by Ki-67, but negative for CK5/6, CK7, NapsinA, and P40 (). Fluorescent in situ hybridization (FISH) was performed on the biopsy sample to identify the ALK rearrangement status, and ALK-positive NSCLC was confirmed with positive and atypical signals to seek more potential treatments in patients with NSCLC. Also, immunohistochemistry (ALK D5F3 antibody) reveals strong expression of ALK protein at the primary lung lesion (). To further identify the rearrangement type of ALK gene, we evaluate the genetic alteration of a collected pathological tissue sample using the DNA-based NGS (Burning Rock, Guangzhou, China) with a gene panel comprising eight lung cancer-related genes (EGFR, ALK, ERBB2, BRAF, MET, ROS1, RET, and KRAS). The concurrent two ALK rearrangements are found, including a novel CCNY-ALK (C1:A20) and ATIC-ALK (A7:A20). Besides, no added driver events with robust transforming potential have been detected. For novel CCNY-ALK rearrangement, the first intron of CCNY and the 19th intron of ALK were broken and rearranged; an abundance rate of 16.64% was observed. The fusion sequence is GTGGGCAGTTGGAAACAGTAATCCAATCTACAGCAGATGGAGATTCAGTT<>AAGTGACGTCTAGGGGTGGGGGCGAGCTTTCACCATCGTGATGGACACTG. In the novel ATIC-ALK rearrangement, the 7th intron of ATIC and the 19th intron of ALK were broken and rearranged, with an abundance of 16.33%. The fusion sequence is AGAGTGGGCTAGTGCATTACATAGGGTGGGAGCCAAACAGGAGCTGCGCC<>AACGCGGGAGGTGGAGTTTGCAGCGAGCCAAGATCGCACCACTGCACTCC (). Then the patient was given oral crizotinib (250 mg, twice daily) as a first-line treatment. Clinical symptoms of dyspnea and cough were improved, and the size of lung mass decreased sharply a month later (). Partial response was further confirmed after six months (). There were no severe toxic effects during the whole crizotinib therapy. However, since then, the patient never came to the hospital again and lost to follow up in the hospital.
Figure 1

CT scans before and after therapy. (A) CT scans before crizotinib treatment. (B) CT scans after 1 month of treatment with crizotinib. (C) CT scans after 6 months of treatment with crizotinib (C). CT scans showed significant shrinkage of the lung mass together with mediastinal and hilar lymph nodes. CT, computed tomography.

Figure 2

Immunohistochemistry analysis revealed immunoreactivity to CK (A), CK7 (B), Ki-67 (C), TTF-1 (D), CK56 (E), Napsin A (F), and P40 (G). Original magnification of images: ×100 for CK, CK7, Ki-67, TTF-1 and ×200 for CK56, Napsin A, P40 (immunohistochemical staining). (H) Immunohistochemistry staining showed strong ALK receptor tyrosine kinase protein expression (×200). (I) Fluorescent in situ hybridization showed fused, split red-green signals, and single red signals (×100). CK, cytokeratin; TTF-1, thyroid transcription factor 1; ALK, anaplastic lymphoma kinase.

Figure 3

Identification of CCNY-ALK and ATIC-ALK coexists in an NSCLC patient. (A) IGV shows the breakpoints on the ATIC, ALK, and CCNY gene detected by capture-based next-generation sequencing. (B) CCNY-ALK genomic DNA rearrangement and the resulting transcript. (C) ATIC-ALK genomic DNA rearrangement and the resulting transcript. CCNY, cyclin Y; ALK, anaplastic lymphoma kinase; ATIC, 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase, NSCLC, non-small-cell lung cancer; UTR, untranslated regions; IGV, integrative genomics viewer.

CT scans before and after therapy. (A) CT scans before crizotinib treatment. (B) CT scans after 1 month of treatment with crizotinib. (C) CT scans after 6 months of treatment with crizotinib (C). CT scans showed significant shrinkage of the lung mass together with mediastinal and hilar lymph nodes. CT, computed tomography. Immunohistochemistry analysis revealed immunoreactivity to CK (A), CK7 (B), Ki-67 (C), TTF-1 (D), CK56 (E), Napsin A (F), and P40 (G). Original magnification of images: ×100 for CK, CK7, Ki-67, TTF-1 and ×200 for CK56, Napsin A, P40 (immunohistochemical staining). (H) Immunohistochemistry staining showed strong ALK receptor tyrosine kinase protein expression (×200). (I) Fluorescent in situ hybridization showed fused, split red-green signals, and single red signals (×100). CK, cytokeratin; TTF-1, thyroid transcription factor 1; ALK, anaplastic lymphoma kinase. Identification of CCNY-ALK and ATIC-ALK coexists in an NSCLC patient. (A) IGV shows the breakpoints on the ATIC, ALK, and CCNY gene detected by capture-based next-generation sequencing. (B) CCNY-ALK genomic DNA rearrangement and the resulting transcript. (C) ATIC-ALK genomic DNA rearrangement and the resulting transcript. CCNY, cyclin Y; ALK, anaplastic lymphoma kinase; ATIC, 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase, NSCLC, non-small-cell lung cancer; UTR, untranslated regions; IGV, integrative genomics viewer. The Medical Ethics Committee approved this study of Henan Cancer Hospital of Zhengzhou University, and the participating patients gave consent. All procedures performed in studies involving human participants were in accordance with the Helsinki Declaration (as revised in 2013). The patient gave written consent for his personal or clinical details, along with any identifying images to be published in this study. A copy of the written consent is available for review by the Editor of this journal. The case has not been reported before and is not being considered for publication elsewhere.

Discussion

The ALK gene is fused with several genes, which are essential in the constitutive activation of the chimeric protein and its subcellular localization. The N-terminal rearrangement partner of the ALK gene provides a promoter that encodes driver fusion oncoproteins, which induces cancer by acting on the downstream signaling pathway (7). While ALK rearrangements are associated with unregulated tyrosine kinase activity, TKIs are established effective therapy in the ALK-rearranged subpopulation for prolonged disease control and have been proven superior to chemotherapy in the previous phase III clinical trials (8,9). Given the superior and confirmed efficacy of ALK inhibitors shown in patients with advanced ALK-positive NSCLC, identifying the novel ALK rearrangement is meaningful, both for improving survival outcomes of patients and wiser medical decision-making of oncologists, which underlines the significance of NGS to discover (10,11). Using the NGS technology, which allows sequencing a high number of nucleotides in a brief time frame at an affordable cost, rarer partner genes to ALK have been identified. Also, the new type of variant expanded the spectrum of ALK rearrangement and provided more insight into precise treatment with ALK-TKIs for the maximum benefit to NSCLC patients. CCNY, a newly identified PFTK1 interacting protein, plays an increasingly important role in the progression of tumor invasion and metastasis and is overexpressed in NSCLC, associated with NSCLC proliferation and tumorigenesis (12). Although there is no direct evidence to support CCNY-ALK as a driver alteration, considering the overexpression of CCNY in samples of NSCLC, there is a possibility that CCNY-ALK rearrangement acts as a driver alteration. 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) is a common partner. The ribonucleotide comprises approximately 1% ALK rearrangement in anaplastic large cell lymphomas (ALCL) and inflammatory myofibroblastic tumors (IMT) (13). However, to the best of our knowledge, CCNY-ALK (C1:A20) and ATIC-ALK (A7:A20) had not been reported in NSCLC before. Also, the response of patients with NSCLC harboring the CCNY-ALK and ATIC-ALK to ALK inhibitors is still unknown. However, in our patient, immunohistochemistry reveals strong expression of ALK protein in tumor cells. The patient responded well to crizotinib and achieved a partial response for over six months.

Conclusions

Our study was the first to report two ALK rearrangements, a novel CCNY-ALK and ATIC-ALK, coexisting in one patient with NSCLC responded well to crizotinib. However, whether both CCNY-ALK and ATIC-ALK rearrangement transcripts are sufficient to induce tumor formation is unclear and will be studied in future research. The article’s supplementary files as
  13 in total

1.  The NPM-ALK and the ATIC-ALK fusion genes can be detected in non-neoplastic cells.

Authors:  B Maes; V Vanhentenrijk; I Wlodarska; J Cools; B Peeters; P Marynen; C de Wolf-Peeters
Journal:  Am J Pathol       Date:  2001-06       Impact factor: 4.307

2.  Next-generation Sequencing Identified a Novel WDPCP-ALK Fusion Sensitive to Crizotinib in Lung Adenocarcinoma.

Authors:  Zhen He; Xuan Wu; Shuxiang Ma; Cuicui Zhang; Zhe Zhang; Shuai Wang; Sheng Yu; Qiming Wang
Journal:  Clin Lung Cancer       Date:  2019-06-14       Impact factor: 4.785

3.  Ceritinib versus chemotherapy in ALK-positive lung cancer.

Authors:  Hilary Marshall
Journal:  Lancet Respir Med       Date:  2016-11-10       Impact factor: 30.700

Review 4.  Therapeutic targeting of anaplastic lymphoma kinase in lung cancer: a paradigm for precision cancer medicine.

Authors:  Ryohei Katayama; Christine M Lovly; Alice T Shaw
Journal:  Clin Cancer Res       Date:  2015-05-15       Impact factor: 12.531

5.  SPECC1L-ALK: A novel gene fusion response to ALK inhibitors in non-small cell lung cancer.

Authors:  Li Ma; Quan Zhang; Yujie Dong; Haoyang Li; Jinghui Wang
Journal:  Lung Cancer       Date:  2020-03-18       Impact factor: 5.705

6.  Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

Authors:  Igor Letovanec; Stephen Finn; Panagiota Zygoura; Paul Smyth; Alex Soltermann; Lukas Bubendorf; Ernst-Jan Speel; Antonio Marchetti; Daisuke Nonaka; Kim Monkhorst; Henrik Hager; Miguel Martorell; Aleksandra Sejda; Richard Cheney; Javier Hernandez-Losa; Eric Verbeken; Walter Weder; Spasenija Savic; Alessia Di Lorito; Atilio Navarro; Enriqueta Felip; Arne Warth; Paul Baas; Peter Meldgaard; Fiona Blackhall; Anne-Marie Dingemans; Hendrik Dienemann; Rafal Dziadziuszko; Johan Vansteenkiste; Cathal O'Brien; Thomas Geiger; Jon Sherlock; Jeoffrey Schageman; Urania Dafni; Roswitha Kammler; Keith Kerr; Erik Thunnissen; Rolf Stahel; Solange Peters
Journal:  J Thorac Oncol       Date:  2017-11-27       Impact factor: 15.609

7.  Coexistence of a Novel PRKCB-ALK, EML4-ALK Double-Fusion in a Lung Adenocarcinoma Patient and Response to Crizotinib.

Authors:  Jing Luo; Dejian Gu; Huasong Lu; Si Liu; Jinliang Kong
Journal:  J Thorac Oncol       Date:  2019-12       Impact factor: 15.609

Review 8.  New generation anaplastic lymphoma kinase inhibitors.

Authors:  Angelo Delmonte; Marco Angelo Burgio; Alberto Verlicchi; Giuseppe Bronte; Paola Cravero; Paola Ulivi; Giovanni Martinelli; Lucio Crinò
Journal:  Transl Lung Cancer Res       Date:  2019-11

Review 9.  ALK in lung cancer: past, present, and future.

Authors:  Alice T Shaw; Jeffrey A Engelman
Journal:  J Clin Oncol       Date:  2013-02-11       Impact factor: 44.544

10.  PLEKHM2-ALK: A novel fusion in small-cell lung cancer and durable response to ALK inhibitors.

Authors:  Tao Li; Fan Zhang; Zhaozhen Wu; Longgang Cui; Xiaochen Zhao; Jinliang Wang; Yi Hu
Journal:  Lung Cancer       Date:  2019-11-06       Impact factor: 5.705

View more
  1 in total

1.  Concomitant novel ALK-SSH2, EML4-ALK and ARID2-ALK, EML4-ALK double-fusion variants and confer sensitivity to crizotinib in two lung adenocarcinoma patients, respectively.

Authors:  Hong Tao; Zhe Liu; Jing Mu; Fei Gai; Zhan Huang; Liang Shi
Journal:  Diagn Pathol       Date:  2022-02-10       Impact factor: 2.644

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.