Astragaloside IV alleviates silica‑induced pulmonary fibrosis via inactivation of the TGF‑β1/Smad2/3 signaling pathway.

The aim of the present study was to investigate the anti‑fibrotic effects of astragaloside IV (ASV) in silicosis rats, and to further explore the potential underlying molecular mechanisms. A silica‑induced rat model of pulmonary fibrosis was successfully constructed. Hematoxylin and eosin and Masson's trichrome staining were performed to observe the pathological changes in lung tissues. Immunohistochemical analysis was used to assess the expression levels of Collagen I, fibronectin and α‑smooth muscle actin (α‑SMA). A hemocytometer and Giemsa staining were used to evaluate the cytological characteristics of the bronchoalveolar lavage fluid. ELISA was used to detect the levels of the inflammatory cytokines tumor necrosis factor‑α, interleukin (IL)‑1β and IL‑6. Reverse transcription‑quantitative PCR and western blotting were performed to detect the mRNA and protein expression levels of genes associated with the transforming growth factor (TGF)‑β1/Smad signaling pathway. ASV alleviated silica‑induced pulmonary fibrosis, and reduced the expression of collagen I, fibronectin and α‑SMA. In addition, the results of the present study suggested that the ASV‑mediated anti‑pulmonary fibrosis response may involve reduction of inflammation and oxidative stress. More importantly, ASV suppressed silica‑induced lung fibroblast fibrosis via the TGF‑β1/Smad signaling pathway, thereby inhibiting the progression of silicosis. In conclusion, the present study indicated that ASV may prevent silicosis‑induced fibrosis by reducing the expression of Collagen I, fibronectin and α‑SMA, and reducing the inflammatory response and oxidative stress, and these effects may be mediated by inhibiting the activation of the TGF‑β1/Smad signaling pathway.

Introduction

Silicosis is a disease caused by long-term exposure to a large amounts of free silica dust, characterized by diffuse nodular fibrosis of the lungs, which eventually damages lung function, leading to respiratory failure and even death (1). China has the largest population of patients with silicosis, and the annual direct economic losses caused by silicosis in the country amounts to >8 billion RMB. In developed countries, silicosis is also a significant occupational health concern (2,3). However, the pathogenesis of silicosis is currently unclear, and there is a lack of clinically effective therapeutic drugs (4,5). Therefore, it is crucial to study the pathogenesis of silicosis and explore novel preventative methods.

Silicosis is a complex chronic inflammatory process involving multiple cells (alveolar macrophages, alveolar epithelial cells, fibroblasts and lymphocytes, amongst others), cytokines and multiple mediators (6). Amongst these multiple factors, transforming growth factor (TGF)-β1 serves a key role. An increasing number of studies have demonstrated that TGF-β1 is a powerful fibrogenic cytokine, which serves an important regulatory role in cell proliferation, differentiation, migration, immune regulation and transformation of the extra-cellular matrix (ECM) in fibrotic diseases, and participates in tissue repair and fibrosis (7-9). In addition, several studies have suggested that gaining additional insight into biological events downstream of TGF-β1 signaling may lead to the identification of novel molecular targets for the treatment of silicosis and various other fibrotic lung conditions.

Since there are currently few treatments and medicines aimed at reversing silicosis or delaying disease progression, the potential efficacy of traditional Chinese medicines are increasingly being assessed (10). Astragaloside IV (ASV) is one of the primary active substances of Astragalus membranaceus, which has attracted significant attention due to its prominent immune-regulatory, anti-inflammatory, anti-asthmatic and anti-fibrotic properties (11). According to Yu et al (12), ASV can resist bleomycin (BLM)-induced pulmonary fibrosis by inhibiting oxidative stress and inflammatory response levels. Wang et al (13) also reported that ASV can reduce the progression of renal fibrosis by inhibiting the mitogen-activated protein kinase pathway and TGF-β1/Smad signaling pathways. However, there is lack of data regarding the effects of ASV on silica-induced lung silicosis fibroblast fibrosis. Therefore, the aim of the present study was to investigate the effects of ASV on silicosis and explore its potential mechanisms using in vivo experiments, in the hope of identifying a novel potential target for the treatment of silicosis.

Materials and methods

Animals and groups

A total of 60 male Sprague Dawley rats, weighing 180-200 g were used in the present study. All rats had ad libitum access to standard rat feed and tap water. The animals were randomly divided into four groups (n=15 per group): i) Control group, 1 ml saline and 0.25 ml air; ii) ASV group, intraperitoneal injection of 20 mg/kg ASV; ii) silicosis model group, 1 ml silica dust suspension (50 mg/ml) and 0.25 ml air; and iv) silicosis model group + ASV, 1 ml silica dust suspension (50 mg/ml) and 0.25 ml air, followed by ASV injected intraperitoneally. The flowchart of the animal experimental procedures is shown in Fig. 1. The present study was approved by the Ethics Committee of The Second Hospital of Shandong University and all procedures were performed in strict accordance with the recommendations outlined in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

Figure 1

Flowchart of animal experimental procedures. BALF, bronchoalveolar lavage fluid.

Silica-induced rat model

All animals were anesthetized with 1% pentobarbital sodium (35 mg/kg, Dainippon Sumitomo Pharma) and fixed on a 60° inclined board with the help of rubber bands. The tongue of the mice was pulled and held using blunt forceps. Under the head mirror, endotracheal intubation was performed using an epidural anesthesia catheter with a connector attaching it to a 1-ml syringe that was inserted into the trachea to the point of the tracheal bifurcation. The crystalline particles were suspended in normal sterile saline and the suspension (50 mg/ml) was vigorously mixed using a Stuart® vortex shaker (Cole-Palmer) prior to instillation. For pathological tissue extraction, the rats were anesthetized with 1% pentobarbital sodium (35 mg/kg, Dainippon Sumitomo Pharma) and fixed on the plate. After the bronchoalveolar lavage fluid (BALF) was collected, the rats were euthanized by bloodletting. Then the pathological organs were collected immediately after animal euthanasia.

Hematoxylin and eosin (H&E) staining

Briefly, the lung tissues were fixed in 4% paraformaldehyde for 24 h at 37°C. Subsequently, they were embedded in paraffin and cut into 5 µm sections using a microtome. Dewaxing and dehydration were performed using xylene and ethanol aqueous solution, followed by H&E staining. The sections were stained with hematoxylin for 5 min and eosin for 3 min at 37°C.

Masson's trichrome staining

The dewaxed deparaffinized 5-µm lung tissue sections were fixed in Bouin's solution over-night at 37°C, washed twice with distilled water, and stained with Mayer's hematoxylin and acid Ponceau for 5 and 10 min at 37°C, respectively, then rinsed with distilled water 3 times. Subsequently, the sections were dissolved in a 1% phosphomolybdic acid aqueous solution. After 10-15 min, the sample was transferred to aniline blue and stained at 37°C for 20 min. Finally, the sections were rapidly dehydrated in 95% alcohol, followed by hyaluronic acidification with dimethylbenzene (DAB).

Bronchoalveolar lavage fluid (BALF) and inflammatory cell counting

A tracheal tube was inserted into the trachea with a sufficient volume of Hank's Balanced Salt Solution (1 ml each time) to collect BALF. Following BALF collection, one part of the re-suspended BALF cells were used for differential counting of inflammatory cells, including neutrophils, lymphocytes and macrophages, using Giemsa staining (15 min at 37°C). The remaining re-suspended BALF cells were later used for calculating the total cell count using a hemocytometer.

Measurement of TNF-a, interleukin (IL)-1β and IL-6 levels by ELISA

Concentrations of IL-6 (cat. no. ab178013; Abcam), IL-1β (cat. no. ab214025; Abcam) and TNF-a (cat. no. ab181421; Abcam) in the lung tissues were assessed using commercially available ELISA kits (USCN Business Co., Ltd.) according to the manufacturer's protocol (14).

Evaluation of oxidative stress in tissues

Lung samples were homogenized in ice-cold 250 mM sucrose solution to determine the levels of malondialdehyde (MDA), reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione peroxidase (GSH-px). For the detection of MDA, the tissue was homogenized in 1 ml PBS. MDA was determined using the thiobarbituric acid reactive substance method, and catalase as described previously (15). For the detection of ROS, intra-cellular reactive levels were evaluated using dihydroethidium staining, as described previously (16). For the detection of SOD, nitroblue tetrazolium, riboflavin and tetrametyletylene-diamine were used in accordance with the Beauchamp and Fridovich method (17). For the detection of GSH-px, the tissue antioxidant capacity was measured as described previously by Moron et al (18).

Immunohistochemical analysis

Briefly, endogenous peroxidase activity within the sections was quenched by incubating the sections with 3% H2O2 for 10 min after dewaxing and hydration. Lung tissues were incubated in a humidified chamber with primary antibodies directed against Collagen I (1:100; cat. no. AF7001; Affbiotech), fibronectin (1:100; cat. no. WL00712a; Wanleibio) and α-SMA (1:100; cat. no. WL02510; Wanleibio) overnight at 4°C. On the following day, the lung tissues were washed with PBS and incubated with a IgG antibody (1:100; cat. no. ab150077; Abcam) at 37°C for 45 min. In the negative controls, the primary antibody was replaced with PBS. Subsequently, tissues were counterstained with DAB.

Reverse transcription-quantitative PCR (RT-qPCR) analysis

Total RNA was isolated from lung tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific Inc.) and then the extracted RNA was reverse transcribed to cDNA using Sensiscript RT kit (Thermo Fisher Scientific, Inc.). The reverse transcription temperature protocol was denaturation at 70°C for 10 min followed by reverse transcription at 42°C for 15 min. Subsequently, qPCR was performed using BeyoFast™ SYBR Green qPCR mix (Beyotime Institute of Biotechnology) according to the manufacturer's protocol (19) The thermocycling conditions were as follows: 95°C for 5 min; followed by 30 cycles of 95°C for 30 sec, 56°C for 30 sec and extension step at 72°C for 1 min. The sequences of the primers are presented in Table I.

Table I

Sequences of the primers.

Gene	Forward, 5′-3′	Reverse, 5-3′
Collagen I	TCCTGCCGATGTCGCTATCC	TCGTGCAGCCATCCACAAGC
Fibronectin	TCGCTTTGACTTCACCACCA	TGAGACCCAGGAGACCACG
α-SMA	GGGCATCCACGAAACCACCT	GAGCCGCCGATCCAGACAGA
TGF-β1	AACAATTCCTGGCGTTACCT	GCCCTGTATTCCGTCTCCTT
TGFβ1RI	GACCTTTGCCGATGCTTTCT	GACCTTTGCCGATGCTTTCT
TGFβ1RII	TGTGAGAAGCCGCAGGAAGT	CAGAGTGAAGCCGTGGTAGGT
Smad2	TTTGCCGAGTGCCTAAGTGA	AGGTTACAGCCTGGTGGGAT
Smad3	AGGGCTTTGAGGCTGTCTACC	CCCATTCAGGTGTAGCTCGAT
Smad7	ACTGGTGCGTGGTGGCATACT	CCGATCTTGCTCCTCACTTTCTG
β-actin	CACTGTGCCCATCTACGAGG	TAATGTCACGCACGATTTCC

α-SMA, α-Smooth muscle actin; β-actin, β-non-muscle; TGF-β1, transforming growth factor-β1; TGFβR, transforming growth factor-βreceptor.

Western blotting

According to the manufacturer's protocol (20), proteins were extracted using RIPA Lysis Buffer (Beyotime Institute of Biotechnology) and concentration was measured using a bicinchoninic acid assay. Protein samples (30 µg) were loaded on an 8% SDS-gel, resolved using SDS-PAGE and transferred to a PVDF membrane. After blocking with 5% non-fat dry milk for 2.5 h at 37°C, the PVDF membrane was incubated with primary antibodies: TGF-β1 (1:500; cat. no. WL01076a; Wanleibio), TGFβ1RI (1:400; cat. no. WL03150; Wanleibio), TGFβ1RII (1:500; cat. no. A1415; ABclonal), Smad2 (1:500; cat. no. WL02286; Wanleibio), phospho-(p-)Smad2 (1:1,000; cat. no. E-AB-21129; Elabscience), Smad3 (1:500; cat. no. ab52903; Abcam), p-Smad3 (1:1,000; cat. no. ab52903; Abcam) or Smad7 (1:1,000; cat. no. WL02975; Wanleibio) overnight at 4°C. The following day, the protein samples were incubated with an IgG antibody (1:500; cat. no. ab254262,; Abcam) at room temperature for 45 min. Signals were visualized using ECL reagent, and densitometry analysis was performed using Gel-Pro-Analyzer version 4.0 (Media Cybernetics, Inc.).

Statistical analysis

SPSS version 19.0 (IBM Corp.) was used to analyze all the data. Data are presented as the mean ± standard deviation. Differences amongst multiple groups were statistically analyzed using a one-way ANOVA with a post hoc Bonferroni test. P<0.05 was considered to indicate a statistically significant difference.

Results

ASV alleviates silica-induced pulmonary fibrosis in silicosis rats

H&E staining was performed to examine the pathological changes in the lung. As shown in Fig. 2A, compared with the control group, severe inflammatory damage was observed in the silicosis group, including infiltration of inflammatory cells, fused alveolar walls, as well as injury and thickening of the bronchial epithelial cell lining. However, when treated with ASV, these symptoms were significantly alleviated. Masson's trichrome staining was used to observe the changes in collagen fibers and ECM secretion in lung tissue (Fig. 2B). In the disease model group, notable fibrosis and strong collagen deposition were observed, and these pathological changes were alleviated in the ASV treated group.

Figure 2

ASV alleviates silica-induced pulmonary fibrosis in silicosis rats. (A) H&E staining of lung sections in different groups. (B) Masson's trichrome staining of lung sections in different groups. Magnification, ×400. Scale bar, 25 µm. ASV, astragaloside IV; H&E, hematoxylin and eosin.

ASV treatment reduces the expression of Collagen I, fibronectin and α-SMA

To evaluate the role of ASV on silica-induced fibroblast fibrosis, the changes in the expression of Collagen I, fibronectin and α-SMA were determined. As shown in Fig. 3A, increased mRNA expression levels of Collagen I, fibronectin and α-SMA were observed in the silicosis group compared with the control group (all P<0.05). Notably, ASV treatment significantly reduced the mRNA expression levels of these genes (P<0.05). Furthermore, immunohistochemistry was performed to verify these results, and the results showed that the staining was notably stronger in the silicosis group and weaker in the silicosis + ASV group (Fig. 3B). Accordingly, the mean density of Collagen I, fibronectin and α-SMA in the lung tissue increased significantly in the silicosis group when compared with that in the control group (P<0.05; Fig. 3C).

Figure 3

ASV treatment reduces the expressions of Collagen I, fibronectin and α-SMA. (A) mRNA expression of Collagen I, fibronectin and α-SMA. (B) Immunohistochemical staining of lung sections in different groups. Magnification, ×400. Scale bar, 25 µm. (C) Average IOD of Collagen I, fibronectin and α-SMA in different groups. ***P<0.001 vs. Control; ###P<0.001 vs. Silicosis. α-SMA, α-smooth muscle actin; ASV, astragaloside IV; IOD, integral light density.

ASV-mediates an anti-pulmonary fibrosis response via reduction in inflammation

As shown in Fig. 4A, the cytological characteristics of BALF were affected by the administration of silica. Specifically, the total cell, neutrophil, lymphocyte and macrophage counts in the silicosis group were notably increased compared with the control group (all P<0.05). By contrast, the addition of ASV significantly decreased the total cell, neutrophil, lymphocyte and macrophage counts when compared with the silicosis group (all P<0.05).

Figure 4

ASV-mediates an anti-pulmonary fibrosis response via a reduction in inflammation. (A) Cytological BALF parameters, including total cell, neutrophil, lymphocyte and macrophage counts, were significantly increased in the Silicosis group compared with the control group. ASV treatment significantly decreased the levels of these parameters. (B) ASV decreased the levels of inflammatory cytokines: TNF-α, IL-1β and IL-6. ***P<0.001 vs. Control; #P<0.05, ##P<0.01, ###P<0.001 vs. Silicosis. ASV, astragaloside IV; BALF, bronchoalveolar lavage fluid; TNF-α, tumor necrosis factor-α; IL, interleukin.

Furthermore, the levels of TNF-α, IL-1β and IL-6 in lung tissues were quantified using ELISA. As shown in Fig. 4B, compared with the control group, silica exposure significantly increased the levels of TNF-α, IL-1β and IL-6 in lung tissues (all P<0.05). However, treatment with ASV resulted in a significant downregulation in the levels of these cytokines (all P<0.05).

ASV-mediates an anti-pulmonary fibrosis response via reduction of oxidative stress

As shown in Fig. 5A and B, the ROS levels and MDA concentration in the silicosis group were significantly higher compared with the control group, and treatment with ASV significantly decreased the ROS and MDA levels when compared with the silicosis group (all P<0.05). Furthermore, there was a significant decrease in the SOD and GSH-px concentrations in the silicosis group compared with the control group (P<0.05). However, following treatment with ASV, an increase in SOD and GSH-px levels was observed (Fig. 5C and D).

Figure 5

ASV-mediates an anti-pulmonary fibrosis response via reduction of oxidative stress. (A) ROS, (B) MDA, (C) SOD and (D) GSH-px levels in the different groups. ***P<0.001 vs. Control; #P<0.05, ##P<0.01, ###P<0.001 vs. Silicosis. MDA, malondialdehyde; ROS, oxygen species; SOD, superoxide dismutase; GSH-px, glutathione peroxidase; ASV, astragaloside IV.

ASV suppresses silica-induced lung fibrosis via the TGF-β1-Smads signaling pathway

The TGF-β/Smads signaling pathway is well-established as the primary pathway under-lying pulmonary fibrosis (21). To further explore whether ASV exerted its anti-fibrotic effect via this signaling pathway, the mRNA and protein expression levels of genes associated with this pathway were assessed. At the transcriptional level, the expression of TGF-β1, TGFβ1RI and TGFβ1RII increased significantly following exposure to silica (Fig. 6A). Amongst the downstream genes, there were no statistically significant differences in Smad2 and Smad3 in any of the groups; however, the mRNA expression levels of Smad7 were significantly downregulated (P<0.05). Interestingly, the administration of ASV reversed the changes in the expression of the above genes (Fig. 6B).

Figure 6

ASV suppresses silica-induced pulmonary fibrosis via the TGF-β1-Smads signaling pathway. mRNA expression levels of (A) TGF-β1, TGFβRI and TGFβRII; and (B) Smad2, Smad3 and Smad7. ***P<0.001 vs. Control; ###P<0.001 vs. Silicosis. ASV, astragaloside IV; TGF-β1, transforming growth factor-β1; TGFβR, transforming growth factor-β receptor.

As shown in Fig. 7A-E, the protein expression levels of TGF-β1, TGFβ1RI, TGFβ1RII, p-Smad2/Smad2 and p-Smad3/Smad3 were significantly increased in the Silicosis group compared with the Control group, whereas the Smad7 protein expression levels were decreased significantly (P<0.05). Treatment with ASV significantly decreased the protein expression levels of TGF-β1, TGFβ1RI, TGFβ1RII, p-Smad2/Smad2 and p-Smad3/Smad3, and increased the expression of Smad7 protein when compared the Silicosis group.

Figure 7

ASV suppresses silica-induced pulmonary fibrosis via the TGF-β1-Smads signaling pathway. Protein expression of (A) TGF-β1, (B) TGFβRI, (C) TGFβRII; (D) p-Smad2/Smad2; (E) p-Smad3/Smad3, and (F) Smad7. ***P<0.001 vs. Control; #P<0.05, ##P<0.01, ###P<0.001 vs. Silicosis. ASV, astragaloside IV; TGF-β1, transforming growth factor-β1; TGFβR, transforming growth factor-β receptor; p-, phospho.

Discussion

A large body of data suggests that activated fibroblasts serve a critical role in driving the development of pulmonary fibrosis (22,23). Fibroblasts express high levels of α-SMA, fibronectin and collagen, andpromote wound healing and fibrosis remodeling. In addition, fibroblasts can cause excessive deposition of ECM (collagen I and collagen III) (24). In the present study, it was shown that exposure to silica caused severe pathological damage to lung tissues, including increased formation of lung nodules, increased infiltration of inflammatory cells, and thickening of the alveolar walls and bronchial epithelial cells. However, treatment with ASV alleviated these symptoms. Furthermore, it was shown that ASV treatment reduced the expression of Collagen I, fibronectin and α-SMA, consistent with a previous study, in which it was shown that a-SMA, Collagen I, Collagen III, FSP-1, fibronectin and Vimentin ablation attenuated fibrosis in lung tissue samples from mice (25). Collectively, the above data showed that ASV delayed silica-induced pulmonary fibrosis and that it possesses anti-silicosis fibrosis effects.

Accumulating evidence has indicated that silica induces inflammatory responses, including the secretion of inflammatory factors (26) and infiltration of inflammatory cells (27). In the present study, it was shown that in the silicosis group, total cell counts, as well as the neutrophil, lymphocyte and macrophage counts were high. Interestingly, ASV treatment reduced the expression of these cytological markers of lung injury. Additionally, the potential role of androgens in targeting neutrophils, lymphocytes and macrophages was determined, which is evident in the reduction of inflammatory cell infiltration. A study by Hou et al (28) showed that exposure to crystalline silica particles increased TNF-α, IL-1β and IL-6, levels, amongst other cytokines. TNF-α can accelerate EMT and up-regulates TGF-β1 expression in primary mouse lung fibroblasts (29) IL-1β can stimulate collagen expression and notably induces tissue destruction, accompanied by increased inflammation and collagen deposition (30). Consistent with the in vivo experiments, silicosis rats given ASV exhibited decreased levels of TNF-α, IL-1β and IL-6 in BALF, suggesting that ASV can delay the progression of pulmonary fibrosis by reducing the inflammatory response in lung tissues.

Oxidative stress is one of the key features of silica induced pulmonary fibrosis. Related studies have shown that the contact between alveolar macrophages and silica during the inflammatory process can produce oxidase, leading to the production of high levels of ROS, thereby further promoting inflammation in a feed-forward loop (31,32). Continued ROS production can cause phagocytic cell death, inflammatory cell recruitment and silica deposition, and cause irreversible lung damage (33). MDA is an indicator of oxidative stress. It reflects the quantities of oxidized free radicals in the body to a certain extent, and indirectly reflects the degree of oxidative stress, which is negatively correlated with lung function (34), and may lead to irreversible lung injury (27). Antioxidants, such as GSH-px and SOD, can not only resist the direct damage caused by oxidants, but also alters the course of inflammatory events associated with chronic lung diseases (27). In the present study, following exposure to silica, there was a significant decrease in GSH-px and SOD levels, as well as a significant increase in the levels of ROS and MDA in silicotic patients. Conversely, ASV reversed the expression of the above factors, suggesting that ASV could inhibit pulmonary fibrosis by reducing oxidative stress.

There is evidence that TGF-β1 can regulate epithelial cell apoptosis, fibroblast proliferation, myofibroblast differentiation and collagen synthesis, thus it may be essential in the progression of lung fibrosis in mice (35). In addition, TGF-β1 is upregulated in lung tissues of patients with pulmonary fibrosis and overexpression of active TGF-β1 induces prolonged and severe interstitial lung fibrosis in rats (36). TGF-β1 is known to serve its pro-fibrotic role by activating downstream mediators, including Smad2 and Smad3, and is negatively regulated by Smad7 expression (7,8). Specifically, TGF-β1 initially binds to TGF-βII phosphorylating it to activate TGFβRI. Subsequently, Smad2 and Smad3 are phosphorylated and activated by TGFβRI. The phosphorylated Smad2 and Smad3 binds to Smad4 to form the Smads complex, which is transferred to the nucleus by cytoplasmic nuclear transporters and acts on the TGF-β1 target gene to regulate transcription of target genes. When the external stimulus inducing the signal ends, p-Smads are rapidly dephosphorylated, and the Smads protein in the cytoplasm and nucleus is rapidly metabolized by the ubiquitin-proteasome system, returning the cytoplasmic levels to resting levels (29). Under pathological conditions, the p-Smad2/Smad2 ratio and p-Smad3/Smad3 ratio are increased. Chang et al (37) showed that following exposure to 100 µg/ml nano NiO, the phosphorylation levels of Smad2 and Smad3 genes and proteins in A549 cells both increased, suggesting that NiO leads to abnormal changes in Smad2 and Smad3. Consistent with previous studies, silica increased the expression of TGF-β1, TGF-βRI, TGF-βII, p-Smad2/Smad2 and p-Smad3/Smad3, and decreased Smad7 levels in the present study. Interestingly, the addition of ASV reversed the expression of these genes to a certain extent. Collectively, the data indicated that ASV can inhibit silica-induced pulmonary fibrosis by promoting negative feedback of the TGF-β1/Smads signaling pathway and inhibiting its positive feedback (Fig. 8).

Figure 8

Schematic diagram showing how ASV alleviates silica-induced pulmonary fibrosis by regulating TGF-β1/Smads pathway. ASV, astragaloside IV; TGF-β1, transforming growth factor-β1; TGFβR, transforming growth factor-β receptor; α-SMA, α-smooth muscle actin.

In conclusion, ASV elicits its anti-pulmonary fibrotic effect by decreasing silica-induced pulmonary fibrosis inflammation and oxidative stress, and the mechanism underlying the effects of ASV may involve the TGF-β1/Smads pathway. Thus, ASV may serve as a promising treatment for the management of silicosis.