Literature DB >> 33416120

Circular RNA CSNK1G1 promotes the progression of osteoarthritis by targeting the miR‑4428/FUT2 axis.

Jianwei Xiao1, Rongsheng Wang2, Weijian Zhou3, Xu Cai1, Zhizhong Ye1.   

Abstract

Osteoarthritis (OA) is a chronic disease that results in chronic arthralgia and functional disability of the affected joint. To date, there is no effective treatment available for this disease. Circular RNAs (circRNAs) are a type of intracellular stable RNA that can regulate the development and progression of OA. However, the function of circCSNK1G1 in OA has not yet been investigated. In the present study, it was found that circCSNK1G1 was upregulated in OA cartilage tissues. The upregulation of circCSNK1G1 was associated with extracellular matrix (ECM) degradation and chondrocyte apoptosis. Moreover, the expression of miR‑4428 was downregulated and that of fucosyltransferase 2 (FUT2) was upregulated in OA‑affected cartilage tissues. Dual‑luciferase reporter assay and RNA immunoprecipitation confirmed that miR‑4428 targeted FUT2 mRNA to inhibit FUT2 expression. circCSNK1G1 and FUT2 induced ECM degradation and chondrocyte apoptosis. The negative effects of circCSNK1G1 and FUT2 were reversed by miR‑4428. On the whole, the present study demonstrates that circCSNK1G1 promotes the development of OA by targeting the miR‑4428/FUT2 axis. Thus, the circCSNK1G1/miR‑4428/FUT2 axis may present a novel target for the treatment of OA in the clinical setting.

Entities:  

Keywords:  circular RNA CSNK1G1; miR-4428; osteoarthritis; chondrocyte; fucosyltransferase 2

Mesh:

Substances:

Year:  2020        PMID: 33416120      PMCID: PMC7723508          DOI: 10.3892/ijmm.2020.4772

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   5.314


Introduction

Osteoarthritis (OA) is a chronic disease characterized by joint cartilage damage, chronic arthralgia and functional disability; no effective treatment for this disease yet exists in the clinical setting. Patients with OA experience arthralgia, joint stiffness, periarticular tenderness, arthrocele and limitations in locomotor function. These symptoms reduce the quality of life of affected patients (1,2). Articular cartilage consists of chondrocytes and extracellular matrix (ECM). The ECM is formed from chondrocyte-secreted collagen and proteoglycans. In the process of OA, upregulated levels of matrix metalloproteinases (MMPs) in the cartilage degrade the ECM, and the induced inflammatory responses trigger the apoptosis of chondrocytes, which further decreases the ability of cartilage to secrete ECM components. However, accurate details of the molecular mechanisms of OA remain unknown. Thus, clarifying the mechanisms responsible for the development of OA and identifying key target genes invovled in this process are of utmost importance. Circular RNAs (circRNAs) are a group of non-coding RNAs of which the 3′ and 5′ ends are connected to form a circular shape by back-splicing (3,4). Due to their shape, circRNAs are resistant to RNase digestion and their expression is more stable in cells compared with linear mRNAs. circRNAs were previously regarded as a splicing by-product (5). Recently, however, circRNAs have been found to be abundant in almost all types of tissues. circRNAs are evolutionarily conserved, are tissue- and development-specific and have been proven to be expressed in OA (6-9). circRNAs function as miRNA sponges that can inhibit the role of miRNAs in restraining targeted expression (10). Previous studies have demonstrated that miRNAs, such as miR-142-5p (11), miR-1202 (12) and miR-140-3p (13) regulate the development of OA by targeting various genes and pathways. Thus, the circRNA/miRNA axis may regulate the progression of OA and may thus present a novel treatment target. Fucosyltransferase 2 (FUT2) is a Golgi stack membrane protein that transfers fucose to the terminal galactose on the glycan chains of cell surfaces (14,15). FUT2 can regulate the progression of a number of diseases, including primary sclerosing cholangitis and acute gastroenteritis (16). It can also regulate the development of oral squamous cell carcinoma (17). FUT2 has been found to be upregulated in OA-affected cartilage (18), which indicates that it may play a role in regulating the development of OA. The present study investigated the role of circCSNK1G1 in vitro and in vivo to clarify the potential mechanisms of circCSNK1G1 in the development of OA. The results of the present study may provide novel therapeutic targets for the treatment of OA.

Materials and methods

Patients and sample collection

A total of 10 patients diagnosed with OA and 10 patients diagnosed with knee joint trauma were included in the present study. OA-affected and normal cartilage tissues were collected from January, 2019 to April, 2020. Patients in the OA group had no obvious cause or history of OA. There were 10 patients in the OA group, including 7 males and 3 females. The age ranged from 67 to 82 years, with an average age of 70.15±7.17 years. The control group consisted of 10 cases, 8 males and 2 females. The average age was 69.22±20.07 years, ranging from 28 to 78 years. There was no statistically significant difference in age between the groups. All patients were fully informed of the experimental aims and procedures and provided written informed consent. The Ethics Committee of Shenzhen Futian Hospital for Rheumatic Disease approved the study.

Animals and grouping

Adult female Sprague-Dawley rats (n=24; age, 10 weeks) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. The rats were randomly divided into 4 groups (i.e., the Control, OA, OA + Len-siNC and Len-si-circCSNK1G1) and kept in a cage with a 12/12 h day/night cycle and stable humidity and temperature. During the surgery, the rats were anesthetized by an intraperitoneal injection of 0.5% pentobarbital sodium (50 mg/kg, Sigma-Aldrich; Merck KGaA). Lentivirus (1×109 PFU, 20 µl) was injected into the knee joints of the recipient rats 1 week after surgery (20 µl per joint per rat 2 times a week for 4 weeks) (n=6 per group). Food and water were provided ad libitum. At 8 weeks after surgery, the rat orbital venous plexus was used for blood collection. The rats were then sacrificed by CO2 inhalation and the knee joints were harvested. For CO2 inhalation, no gas was used to pre-fill the euthanasia chamber. The animals were placed in the chamber and 100% CO2 was introduced. The filling rate was approximately 10-30% CO2 per minute of the volume of the euthanasia chamber. As carbon dioxide levels increase, the animals die slowly and painlessly. After 10 min, each animal was separately examined to confirm death. In the case that death could not be confirmed, the animals were also subjected to cervical dislocation. All animal procedures were performed between March and May, 2019 and were approved by the Ethics Committee of Shenzhen Futian Hospital for Rheumatic Disease.

Rat model of OA

The rat model of OA was established by medial collateral ligament transection and destabilization of the medial meniscus (DMM). Lentivirus expressing circC-SNK1G1 shRNA and the negative control were cloned into pLenti-EF1a-EGFP-F2A-Puro (Biovector Inc.). The lentivirus (1×109 PFU, 20 µl) was injected into the knee joints of the rats 1 week post-OA establishment surgery; this treatment was repeated twice a week for 4 weeks. At 2 months after the initial surgery, joint cartilage tissues were collected.

Hematoxylin and eosin (H&E) staining

The synovial membrane of the right knee joint and cartilage of the tibial plateau were obtained and fixed in 10% neutral formaldehyde solution. Decalcification in 10% EDTA was then carried out for 56 days. Conventional dehydration and paraffin embedding were then performed. Specimens were obtained by slicing into sections measuring of 4 µm in thickness and routinely dewaxed and washed with xylene. At room temperature, the slices were stained with hematoxylin for 5 min, then 0.5% eosin solution for 3 min (Beyotime Institute of Biotechnology, Inc.) and then washed with tap water. The slices were then dehydrated in alcohol (from a low to high concentration) and sealed with neutral resin. The morphology of the cartilage tissues was observed under a normal microscope (Nikon Corporation).

Cartilage staining (Safranin O method)

Specimens were subjected to 10% formalin fixation, decalcification and paraffin sectioning (4-µm-thick). At room temperature, the specimens were stained with fresh Weigert's stain solution for 3-5 min and differentiated with acid ethanol for 15 sec. Subsequently, the specimens were rinsed with distilled water for 10 min. At room temperature, the specimens were stained with solid green dye solution (Beijing Solarbio Science & Technology Co., Ltd.) for 5 min, and then washed with distilled water for 1 min. Safranin O stain was added to the specimens for 1-2 min and rinsed off with distilled water for 1 min. Specimens were dehydrated with 95% ethanol and anhydrous ethanol respectively. Finally, the specimens were made transparent with xylene and sealed with optical resin (Ni-E; Nikon Corporation).

TargetScan analysis

TargetScan is a software specifically designed to analyze miRNA target genes in mammals (http://www.targetscan.org/vert_72/). TargetScan supports both Gene Symbol and Emsembl ID formats. In the present study, FUT2 was entered into the he search box. The retrieval results provided multiple transcripts of FUT2 and the corresponding length of the 3′UTR region. By clicking on each transcript ID, the miRNA binding site on the transcript can be viewed.

Chondrocyte culture

C28/I2 (AC339995, human chondrocytes) cells were purchased from Ze Ye Biotechnology Co., Ltd. and maintained in Dulbecco's modified Eagle's medium (DMEM) with fetal bovine serum (FBS, 10%). The culture medium was replaced with fresh medium every second day of cell culture. Interleukin (IL)-1β (10 ng/ml, 24 h; ACROBiosystems) was used to induce chondrocyte apoptosis in vitro.

Proliferation assay

C28/I2 cells were cultured in a 96-well plate to detect their proliferative ability. Briefly, 1×104 cells were seeded into each well of the plate and cultured in DMEM with 10% FBS. CCK-8 reagent (100 µl) (MedChem Express) was then added to each well. Following incubation for 2 h in 37°C, the plate was transferred to an enzyme-linked immunosorbent assay (ELISA) plate reader (Thermo Fisher Scientific, Inc.) to detect the absorbance of the solution at 450 nm.

Flow cytometric assay

The percentage of apoptotic chondrocytes was detected by flow cytometry using an FITC-Annexin V apoptosis detection kit (Beyotime Institute of Biotechnology, Inc.). The cells were then collected and rinsed with PBS, and FITC-Annexin V (300 ng/ml, 4°C, 10 min) was applied to label apoptotic cells. Coupling solution was applied to wash the labeled cells. The cells were then incubated with propidium iodide for 5 min in 37°C. A LSRFortessa flow cytometer (BD Biosciences) was used to obtain the required data, and FlowJo software version 7.6.1. was applied to analyze the data.

Western blot analysis

The expression of cleaved caspase-3, cleaved caspase-9, Bax and Bcl-2 in the cultured chondrocytes was detected by western blot analysis. The cultured C28/I2 cells were harvested and lysed with RIPA buffer (Beyotime Institute of Biotechnology, Inc.). The protein concentration of the samples was then determined using a BCA kit (Beyotime Institute of Biotechnology, Inc.). The proteins were then separated by 10% SDS-PAGE and transferred to a PVDF membrane. The membrane was blocked with 5% non-fat milk, and the proteins were probed with the necessary primary antibodies [cleaved caspase-3 (ab2302, 1:1,000; AbcamA), cleaved caspase-9 (ab2324, 1:1,000; Abcam), Bax (ab3191, 1:1,000; Abcam), Bcl-2 (ab117115, 1:2,000; Abcam)] and a secondary antibody [goat anti-rabbit IgG-HRP (ab97051, 1:1,000; Abcam)]. The membranes were then subjected to luminescence with an ECL kit (P0018FS; Beyotime Institute of Biotechnology, Inc.) and exposure with the Chemiluminescent gel imaging system (Tanon-5200; Tanon Science & Technology Co., Ltd.). Images were collected for analysis.

RT-qPCR

The expression of circCSNK1G1, miR-4428, MMP-13, collagen II, aggrecan, FUT2 and cytochrome c (Cyt-c) in human and rat cartilage and cultured chondrocytes was detected by RT-qPCR as previously described (19). Briefly, tissues and cells were harvested and lysed with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA concentrations were then determined using a NanoDrop 2000 instrument. cDNA for circCSNK1G1, MMP-13, collagen II, aggrecan, FUT2 and Cyt-c was synthesized with PrimeScript RT Master Mix (Takara Bio, Inc.), and cDNA for miRNA was synthesized with a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). RT-qPCR was conducted using the miScript SYBR®-Green PCR kit (Thermo Fisher Scientific, Inc.). All detections were conducted at least 3 times, and the primers used are listed in Table I. The PCR thermal cycling parameters were as follows: PCR thermal cycling parameters: 95°C for 5 min, followed by the 3-step reaction: Denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and 45 cycles. The results were analyzed using the 2−ΔΔCq method (19).
Table I

Primer sequences used for RT-qPCR.

GenesSense (5′-3′)Antisense (5′-3′)
circCSNK1G1GCCATCACAACAGCAGCCTAGGTCAAACAAGTCCTCCAAG
miR-4428CAAGGAGACGGGAACATGGAGAACATGTCTGCGTATCTC
MMP-13CCTTGATGCCATTACCAGTCTCCAAACAGCTCCGCATCAACCTGC
AggrecanACTCTGGGTTTTCGTGACTCTACACTCAGCGAGTTGTCATGG
FUT2CTACCACCTGAACGACTGGATGAGGGTGAACTCCTGGAGGATCT
Cyt-cAAGGGAGGCAAGCACAAGACTGCTCCATCAGTGTATCCTCTCCC
Collagen IICCTGGCAAAGATGGTGAGACAGCCTGGTTTTCCACCTTCACCTG
U6AGTAAGCCCTTGCTGTCAGTGCCTGGGTCTGATAATGCTGGG
GAPDHAATGGACAACTGGTCGTGGACCCCTCCAGGGGATCTGTTTG

Cyt-c, cytochrome c; MMP-13, matrix metalloproteinase 13; FUT2, fucosyltransferase 2.

Enzyme-linked immunosorbent assay

The expression of IL-6, tumor necrosis factor (TNF)-α and lactate dehydrogenase (LDH) in rat serum was detected by ELISA using respective kits (R&D Systems, Inc.) in accordance with the manufacturer's instructions.

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining

Apoptotic cells in rat cartilage were labeled using a TUNEL assay kit (Beyotime Institute of Biotechnology, Inc.) according to the manufacturer's instructions. TUNEL-positive cell numbers were calculated manually with the help of a microscope (Nikon). Apoptotic cell numbers were counted from 10 random fields per slide.

Cell transfection

si-circCSNK1G1 (GCA ATC AAA CTG GAA CCA A), miR-4428 mimics, miR-NC, siNC (TTA CAT GGC AAC CTA CCT T), AMO-4428 and siFUT2 (CCT GTA ATG CTC GCA CTT T) were designed and synthesized by GenPharma. Lipofectamine 2000 (Life Technologies) was used for transfection, and the transfection procedure was according to the instructions of Lipofectamine 2000. The concentrations used for transfection were as follows: siNC (50 nM), si-circCSNK1G1 (50 nM), siFUT2 (50 nM), miR-4428 mimics (45 nM), miR-NC (45 nM), AMO-4428 (40 nM). The culture medium was replaced with normal culture medium after 48 h, and culture was continued for a further 2 days.

Dual-luciferase reporter assay

The mRNA 3′UTR of FUT2 was amplified and sub-cloned into the pMIR-GLO reporter plasmid (Promega Corporation), and the resulting plasmids were named FUT2-WT and FUT2-MUT. Chondrocytes were cultured in a 96-well plate and co-transfected with miR-4428 mimics/NC and FUT2-WT/FUT2-MUT using Lipofectamine 2000 (Life Technologies; Thermo Fisher Scientific, Inc.). After 48 h, luciferase activity was detected using a dual-luciferase reporter assay system (Promega Corporation). The 20 µl cell lysate was added to the luminescent plate. Background values were read with a GloMax bioluminescence detector (Promega Corporation) and 100 µl LARII solution (Promega Corporation) were added to each sample. After reading, add 100 µl Stop&GloR Reagent (Promega Corporation) was added to each sample. Normalization was carried out according to Δ activity multiple=(F/R) sample (/F/R) for comparison (F, Firefly luciferase; R, Renilla luciferase).

Statistical analysis

The data are presented as the means ± SD. GraphPad Prism 6.0 (GraphPad Software, Inc.) was applied for statistical analysis. Differences between 2 groups were analyzed using a Student's t-test, and differences between 2 groups were calculated using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. Pearson's correlation coefficient was used for correlation analysis. A P-value <0.05 was considered to indicate a statistically significant difference.

Results

circCSNK1G1 is upregulated in OA-affected cartilage tissues

To clarify the role of circRNAs in OA, circCSNK1G1 expression was detected in the cartilage tissues of patients with OA. circCSNK1G1 expression was evidently upregulated in OA-affected cartilage compared with normal cartilage tissue (P<0.05; Fig. 1A). These results indicate that circCSNK1G1 may play a regulatory role in the progression of OA. In addition, the expression of circCSNK1G1 was markedly increased in the cartilage tissues of rats with OA compared with the tissue from the control group (P<0.05; Fig. 1B). These results indicate that the upregulation of circCSNK1G1 in OA-affected tissues may play a role in the pathophysiological processes of OA. However, the exact details of this regulatory mechanism require further investigation.
Figure 1

circCSNK1G1 is upregulated in OA-affected cartilage. (A) Expression of circCSNK1G1 in cartilage tissue from patients with OA and normal human cartilage. (B) Expression of circCSNK1G1 in rat cartilage. Data are shown as the means ± SD (n=4, Student's t-test, **P<0.01, ***P<0.001). OA, osteoarthritis.

circCSNK1G1 knockdown inhibits inflammation in OA

Lentivirus was applied by an intra-articular injection to knock down the expression of circCSNK1G1 and observe the mechanisms of circCSNK1G1 in OA-affected cartilage. The expression of circCSNK1G1 was first verified. circC-SNK1G1 was found to be upregulated in the rat models of OA compared with the control group. However, the application of lentivirus effectively decreased the expression of circCSNK1G1 (Fig. 2A). The expression of IL-6, TNF-α and LDH in serum was then evaluated. The levels of IL-6, TNF-α and LDH were evidently increased in the OA and Len-siNC groups compared with those in the control group (Fig. 2B-D). In addition, the expression of IL-6, TNF-α and LDH in articular cartilage was evaluated by RT-qPCR, and the levels of IL-6, TNF-α and LDH were evidently increased in the OA and Len-siNC groups compared with those in the control group (Fig. 2E-G). However, the levels of IL-6, TNF-α and LDH were decreased by treatment with Len-si-circCSNK1G1 compared with those in the OA and Len-siNC groups, although the levels remained higher than those in the control group.
Figure 2

circCSNK1G1 knockdown inhibits inflammation in OA. (A) circCSNK1G1 expression detected by RT-qPCR. (B-D) IL-6, TNF-α and LDH expres-sion in rat serum detected by ELISA. (E-G) IL-6, TNF-α and LDH expression in rat articular cartilage detected by RT-qPCR assay. (H) Cleaved caspase-3 and cleaved-caspase-9 expression in rat cartilage were detected by western blot analysis. (I) TUNEL staining of rat cartilage. (J) Evaluation of cartilage morphology by hematoxylin and eosin staining. (K) Morphological changes in articular cartilage evaluated by saffron solid green staining. Data are shown as the means ± SD (n=4, ANOVA followed by Tukey's multiple comparison test, *P<0.05, **P<0.01, ***P<0.001). OA, osteoarthritis; IL-6, interleukin-6; TNF-α, tumor necrosis factor-α; LDH, lactate dehydrogenase.

Chondrocyte apoptosis was evaluated by detecting the expression of cleaved caspase-3 and cleaved caspase-9, and the number of TUNEL-positive cells in cartilage tissues from rats with OA to examine the role of Len-si-circCSNK1G1 in OA. The expression of cleaved caspase-3 and cleaved caspase-9 was increased in the OA group compared with the control and Len-siRNA groups. The application of Len-si-circCSNK1G1 markedly decreased the expression of cleaved caspase-3 and cleaved caspase-9 compared with the OA and Len-siNC groups (Fig. 2H). In addition, the TUNEL-positive cell numbers were higher in the OA and Len-siNC groups compared with the control group. The application of Len-si-circCSNK1G1 decreased the TUNEL-positive cell numbers compared with the OA and Len-siNC groups (Fig. 2I). H&E staining was then used to evaluate the integrity of cartilage tissue. In the control group, the surface layer of the cartilage tissue was smooth and flat, the chondrocytes were arranged in an orderly manner, the hierarchical structure was clear, the staining distribution was uniform, the tidal line was complete and no obvious cell clustering could be found. By contrast, in the OA model group, the articular cartilage surface was thinner, local fissure defects were noted, the chondrocytes exhibited a disordered arrangement and the hierarchical structure could not easily be recognized. In the circCSNK1G1 knockdown group, the cartilage surface was slightly roughened, but no obvious cracks were observed. In addition, the chondrocytes were arranged regularly (Fig. 2J). Morphological changes in articular cartilage were also evaluated by saffron solid green staining. In the model group, cartilage degeneration was reduced from compensatory hyperplasia to chondrocytes and stroma; in addition, the cartilage was thin and exhibited signs of exfoliation. The saffron Red O solid green staining in the pericellular matrix became lighter. The knockdown of circCSNK1G1 protected the chondrocytes from these changes (Fig. 2K). On the whole, these results indicate that blocking circCSNK1G1 expression with Len-si-circCSNK1G1 reduces the expression of inflammatory factors and chondrocyte apoptosis.

circCSNK1G1 promotes chondrocyte apoptosis by sponging miR-4428

Possible interacting miRNAs were predicted by the StarBase (http://starbase.sysu.edu.cn/) database to clarify the mechanisms of circCSNK1G1 in OA. The potential binding sites of miR-4428 on circCSNK1G1 are illustrated in Fig. 3A. The expression of circCSNK1G1 was knocked down by transfection with si-circCSNK1G1 (Fig. S1). The changes in miR-4428 expression in the rat model OA following circCSNK1G1 knockdown by lentivirus were also analyzed (Fig. 3B). The expression of miR-4428 was upregulated following circCSNK1G1 knockdown in the rat joint tissues. The expression of miR-4428 was also detected following transfection with si-circCSNK1G1 in the cultured chondrocytes and it was found to be evidently increased in the si-circCSNK1G1 group compared with the IL-1β and siNC groups (Fig. 3C). In addition, the expression of circCSNK1G1 and miR-4428 was detected in the cartilage tissues of patients with OA, and a negative correlation between miR-4428 and circCSNK1G1 expression was observed by Pearson's correlation analysis (Fig. 3D). These results indicate that miR-4428 can be inhibited by circCSNK1G1 in OA.
Figure 3

circCSNK1G1 promotes chondrocyte apoptosis by sponging miR-4428. (A) Predicted binding sites of miR-4428 in circCSNK1G1. (B) Detection of the expression of miR-4428 in the rat osteoarthritis (OA) model by RT-qPCR (n=4, ANOVA followed by Tukey's multiple comparison test, **P<0.01). (C) Expression of miR-4428 in cultured chondrocytes detected by RT-qPCR (n=4, ANOVA followed by Tukey's multiple comparison test, **P<0.01). (D) Correlation analysis between miR-4428 and circCSNK1G1 expression in cartilage tissue from patients with OA (n=10, r=−0.6621, P<0.05). (E) Proliferation assays of cultured chondrocytes. (F and G) Percentage of apoptotic cells detected by flow cytometry. (H-L) Expression of Bax, Bcl-2, Cyt-c, MMP-13, collagen II and aggrecan in cultured chondrocytes was detected by western blot analysis or RT-qPCR (ANOVA followed by Tukey's multiple comparison test, *P<0.05, **P<0.01, ***P<0.001). Cyt-c, cytochrome c; MMP-13, matrix metalloproteinase 13.

To demonstrate the role of miR-4428 in OA, AMO-4428 was transfected into cultured chondrocytes to suppress miR-4428 expression (Fig. S2). IL-1β evidently decreased chondrocyte cell viability compared with the control group; by contrast, transfection with si-circCSNK1G1 evidently increased cell viability compared with the IL-1β group. However, the promoting effect of si-circCSNK1G1 on cell viability was suppressed by transfection with AMO-4428 (Fig. 3E). The percentage of apoptotic cells was also detected by flow cytometry. IL-1β increased the percentage of apoptotic cells, whereas si-circCSNK1G1 decreased this percentage. However, transfection with AMO-4428 attenuated the protective effects of si-circCSNK1G1 compared with the si-circCSNK1G1 group (Fig. 3F and G). In addition, the expression of several apoptosis-related proteins (e.g., Bax and Bcl-2) was detected by western blot analysis, and the mRNA levels of MMP-13, Cyt-c, collagen II and aggrecan were detected by RT-qPCR. The expression of Bax and Cyt-c was upregulated, whereas the expression of Bcl-2 was downregulated in the si-circCSNK1G1 + AMO-4428 group compared with the si-circCSNK1G1 group. The expression of MMP-13 was upregulated, and the expression of collagen II and aggrecan was downregulated in the si-circCSNK1G1 + AMO-4428 group compared with the si-circCSNK1G1 group (Fig. 3H-L). These results indicate that circCSNK1G1 promotes chondro-cyte apoptosis by sponging miR-4428.

miR-4428 protects chondrocytes in OA

miR-4428 expression was evidently decreased in the OA group compared with that in the control group (Fig. 4A). In cultured chondrocytes, IL-1β treatment induced a decrease in miR-4428 expression. Moreover, miR-4428 expression was upregulated by transfection with miR-4428 mimic and was downregulated by transfection with AMO-4428 (Figs. 4B, S2 and S3). Cell viability was also evidently repressed in the IL-1β group compared with that in the control group. Transfection with miR-4428 mimic evidently promoted cell viability compared with the IL-1β group. The promoting effect of miR-4428 mimics was inhibited by transfection with AMO-4428 (Fig. 4C). Flow cytometry also demonstrated that the percentage of apoptotic cells was increased in the IL-1β group. However, transfection with miR-4428 mimics evidently inhibited this effect. The inhibitory effect of miR-4428 mimics on apoptosis was attenuated by AMO-4428 (Fig. 4D and E). Furthermore, the expression of MMP-13, Bax and Cyt-c was increased in the IL-1β and miR-4428 mimics + AMO-4428 groups compared with that in the control and miR-4428 mimics groups. The expression of MMP-13, Bax and Cyt-c was decreased in the miR-4428 mimics group compared with that in the IL-1β and miR-4428 mimics + AMO-4428 groups. The expression of collagen II, aggrecan and Bcl-2 was decreased in the IL-1β and miR-4428 mimics + AMO-4428 groups compared with that in the control and miR-4428 mimics groups. Finally, the expression of collagen II, aggrecan and Bcl-2 was increased in the miR-4428 mimics group compared with that in the IL-1β and miR-4428 mimics + AMO-4428 groups (Fig. 4F-J). These results indicate that miR-4428 can protect chondrocytes from damage induced by OA.
Figure 4

miR-4428 protects chondrocytes in OA. (A) miR-4428 expression in rat cartilage detected by RT-qPCR. (B) Expression of miR-4428 in cultured chondrocytes detected by RT-qPCR. (C) Proliferation assays of cultured chondrocytes. (D and E) Percentage of apoptotic cells detected by flow cytometry. (F-J) Expression of Bax, Bcl-2, Cyt-c, MMP-13, collagen II and aggrecan in cultured chondrocytes was detected by western blot analysis or RT-qPCR (n=4, ANOVA followed by Tukey's multiple comparison test, *P<0.05, **P<0.01, ***P<0.001). OA, osteoarthritis; Cyt-c, cytochrome c; MMP-13, matrix metalloproteinase 13.

miR-4428 targets FUT2 in OA

The potential target gene was predicted with TargetScan (http://www.targetscan.org/vert_72/). FUT2 was predicted to be a target gene of miR-4428. The binding site between miR-4428 and FUT mRNA is shown in Fig. 5A. The changes in FUT2 expression following circCSNK1G1 knockdown in the rat model of OA were analyzed and it was found that the expression of FUT2 decreased following circCSNK1G1 knockdown (Fig. 5B). The luciferase activity evidently decreased in the miR-4428 + WT group compared with that in the other 3 groups (Fig. 5C). The expression of FUT2 in the AMO-4428 group was evidently increased compared with that in the control group. Transfection with miR-4428 mimics markedly decreased FUT2 expression (Fig. 5D). The expression of miR-4428 and FUT2 was detected, and a negative correlation between miR-4428 and FUT2 was observed (Fig. 5E).
Figure 5

miR-4428 targets FUT2 in OA. (A) Predicted binding sites of miR-4428 and FUT2 mRNA. (B) FUT2 expression following circCSNK1G1 knock-down in the rat model of OA. (C) Detection of luciferase activity to confirm the association between miR-4428 and FUT2. (D) Expression of FUT2 in cultured chondrocytes. *P<0.05, **P<0.01. (E) Correlation analysis between miR-4428 and FUT2 mRNA expression in patients with OA (n=10, r=−0.7597). OA, osteoarthritis; FUT2, fucosyltransferase 2.

miR-4428 inhibits chondrocyte apoptosis by targeting FUT2

The expression of FUT2 was evidently promoted by IL-1β in cultured chondrocytes compared with the control group. The application of miR-4428 mimics inhibited FUT2 expression promoted by IL-1β (Fig. 6A). Subsequently, FUT2 siRNA was used to knock down FUT2 expression in cultured chondrocytes. Compared with the control and siNC groups, the expression of FUT2 was evidently decreased in the siFUT2 group (Fig. 6B). The present study then deter-mined whether FUT2 knockdown can protect chondrocytes from the effects of IL-1β. Cell viability inhibited by IL-1β was promoted by FUT2 siRNA (Fig. 6C, P<0.01); the increased percentage of apoptotic cells induced by IL-1β was also decreased by FUT2 siRNA (Fig. 6D-E). In addition, the expression of Bax, Cyt-c and MMP-13 was evidently inhibited by FUT2 siRNA compared with the IL-1β group. Moreover, the expression of Bcl-2 was evidently increased following transfection with FUT2 siRNA compared with that in the IL-1β group (Fig. 6F-J). These results indicate that FUT2 is a critical gene involved in the development of OA targeted by miR-4428.
Figure 6

miR-4428 inhibits chondrocyte apoptosis by targeting FUT2. (A) Expression of FUT2 in cultured chondrocytes. (B) Expression of FUT2 following FUT2 siRNA knockdown. (C) Proliferation assays of cultured chondrocytes. (D and E) Percentage of apoptotic cells detected by flow cytometry assay. (F-J) Expression of Bax, Bcl-2, Cyt-c, MMP-13, collagen II and aggrecan in cultured chondrocytes was detected by western blot analysis or RT-qPCR *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). OA, osteoarthritis; Cyt-c, cytochrome c; MMP-13, matrix metalloproteinase 13.

Discussion

OA is a chronic degenerative articular disease characterized by chronic arthralgia, stiffness, declining locomotor ability, and eventually, disability (20). Accurate details of the pathophysiological mechanisms of the disease remain unknown. A previous study indicated that degenerated articular cartilage is the initial change in the development of OA (21). Subsequently, the complex molecular mechanisms of OA have been observed, including the formation of osteophytes, the remodeling of subchondral bone, the abnormal remodeling of cartilage, changes in the synovium, bone marrow lesion, chondrocyte apoptosis and ECM degradation (22-26). Non-coding RNAs, including miRNAs and circRNAs, were recently confirmed to play a regulatory role in the onset and progression of OA. miRNAs are a group of short non-coding RNAs measuring ~22 nucleotides in length (27). Several miRNAs have been proven to regulate various signaling pathways, apoptosis and chondrocyte functions in OA (28). Some miRNAs are differentially expressed during the onset and development of OA (29-31). A total of 42 circRNAs have also been found to be differentially expressed in OA (32). These circRNAs regulate chondrocyte apoptosis by sponging targeted miRNAs. In the present study, the ceRNA mechanism of the circCSNK1G1/miR-4428/FUT2 that may exist in arthritis was first constructed by referencing and applying the TargetScan (http://www.targetscan.org/vert_72/) and Starbase (http://starbase.sysu.edu.cn/index.php) websites. Furthermore, the role of circCSNK1G1 in aggravating inflammation at the chondrocyte level we confirmed through relevant experiments. Therefore, the function and regulatory mechanisms of circCSNK1G1 were further invesigated in arthritis. The aim of the present study was to examine the regulatory role of the circCSNK1G1/miR-4428/FUT2 axis in arthritis and to determine the cellular/molecular mechanisms of this axis. Studies have demonstrated that some circRNAs are involved in the progression of arthritis. circRNA-CDR1as has been shown to be upregulated in OA tissue and targets miR-641 to increase MMP-13 and IL-6 expression (33). circ_0136474 has been shown to sponge miR-127-5p to upregulate MMP-13 expression and inhibit chondrocyte proliferation (34). circRNAs, such as hsa_circRNA_0020014 and hsa_circ_0032131, can serve as diagnostic biomarkers and treatment targets for OA (35-37). The present study provided some novel findings. First, circCSNK1G1 expression negatively correlated with miR-4428 expression; specifically, the former was upregulated, whereas the latter was downregulated in OA. Second, the role of circCSNK1G1 in OA was confirmed and it was found that the overexpression of circCSNK1G1 promoted the progression of OA. circCSNK1G1 was upregulated in OA-affected cartilage and induced chondrocyte apoptosis and EMC degradation by sponging the target of miR-4428. miR-4428 conferred protective effects against OA by inhibiting FUT2 expression. FUT2 has been shown to trigger airway inflammation via C3a production and dendritic cell accumulation (38); it has also been shown to promote breast cancer development by regulating cell proliferation, adhesion and migration (39). FUT2 is upregulated in OA-affected tissues, and miR-17-5p targets FUT2 to regulate the Wnt/β-catenin pathway and inhibit OA development (18,40,41). In the present study, FUT2 and circCSNK1G1 were similarly upregulated in OA-affected cartilage. The inhibition of FUT2 expression resulted in beneficial effects against OA development. As a target gene of miR-4428, FUT2 may mediate the role of the circCSNK1G1/miR-4428 axis in promoting OA. However, the pathways downstream of FUT2 were not detected in the present study. Chondrocytes are the only cells that make up articular cartilage. The balance between chondrocyte apoptosis and proliferation plays a pivotal role in maintaining chondrocyte cell numbers in cartilage. Apoptosis refers to the programmed death of cells triggered by caspases (42). There is evidence to indicate that apoptosis plays a pivotal role in the onset and development of OA (43). The H19/miR-675/COL2A1 axis is activated and induces apoptosis in OA (44). The lncRNA-CIR/miR-27/MMP13 axis regulates chondrocyte apoptosis in OA (45). The DLL1/PI3K/AKT (46), MyD88/NF-kB/p38MAPK (47) and BCL-2/MAPK/JNK (48) pathways have also been reported to regulate chondrocyte apoptosis in OA. Thus, the chondrocyte cell number is the foundation of ECM formation and degradation (49). The present study revealed new aspects of the cellular function and pathophysiological role of circCSNK1G1 and miR-4428, both of which may be considered potential molecular targets for the treatment of OA. Despite its numerous benefits, the present study also includes some shortcomings. For example, whether other miRNAs are sponged by circC-SNK1G1 in OA remains unknown. Thus, future studies are required to focus on clarifying the underlying pathways of circCSNK1G1. In conclusion, the present study, to the best of our knowledge, is the first to report the role of the circC-SNK1G1/miR-4428/FUT2 axis in OA development via the regulation of chondrocyte apoptosis and ECM degradation. The results reveal that the circCSNK1G1/miR-4428/FUT2 axis may present a novel therapeutic target for the treatment of OA.
  49 in total

Review 1.  MicroRNAs: genomics, biogenesis, mechanism, and function.

Authors:  David P Bartel
Journal:  Cell       Date:  2004-01-23       Impact factor: 41.582

Review 2.  The assessment of early osteoarthritis.

Authors:  T C B Pollard; S E Gwilym; A J Carr
Journal:  J Bone Joint Surg Br       Date:  2008-04

Review 3.  Glycobiology.

Authors:  T W Rademacher; R B Parekh; R A Dwek
Journal:  Annu Rev Biochem       Date:  1988       Impact factor: 23.643

4.  Lnc-RNA BLACAT1 regulates differentiation of bone marrow stromal stem cells by targeting miR-142-5p in osteoarthritis.

Authors:  Y Ji; Q-Y Fang; S-N Wang; Z-W Zhang; Z-J Hou; J-N Li; S-Q Fu
Journal:  Eur Rev Med Pharmacol Sci       Date:  2020-03       Impact factor: 3.507

5.  Regulation of H19 and its encoded microRNA-675 in osteoarthritis and under anabolic and catabolic in vitro conditions.

Authors:  Eric Steck; Stephane Boeuf; Jessica Gabler; Nadine Werth; Philipp Schnatzer; Solvig Diederichs; Wiltrud Richter
Journal:  J Mol Med (Berl)       Date:  2012-04-21       Impact factor: 4.599

6.  Circular RNAs are a large class of animal RNAs with regulatory potency.

Authors:  Sebastian Memczak; Marvin Jens; Antigoni Elefsinioti; Francesca Torti; Janna Krueger; Agnieszka Rybak; Luisa Maier; Sebastian D Mackowiak; Lea H Gregersen; Mathias Munschauer; Alexander Loewer; Ulrike Ziebold; Markus Landthaler; Christine Kocks; Ferdinand le Noble; Nikolaus Rajewsky
Journal:  Nature       Date:  2013-02-27       Impact factor: 49.962

7.  A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223.

Authors:  Kun Wang; Bo Long; Fang Liu; Jian-Xun Wang; Cui-Yun Liu; Bing Zhao; Lu-Yu Zhou; Teng Sun; Man Wang; Tao Yu; Ying Gong; Jia Liu; Yan-Han Dong; Na Li; Pei-Feng Li
Journal:  Eur Heart J       Date:  2016-01-21       Impact factor: 29.983

8.  Preliminary Exploration of hsa_circ_0032131 Levels in Peripheral Blood as a Potential Diagnostic Biomarker of Osteoarthritis.

Authors:  Ying Wang; Cuiyan Wu; Yimin Yang; Zhiwei Ren; Mikko J Lammi; Xiong Guo
Journal:  Genet Test Mol Biomarkers       Date:  2019-09-17

Review 9.  Articular cartilage and changes in arthritis. An introduction: cell biology of osteoarthritis.

Authors:  L J Sandell; T Aigner
Journal:  Arthritis Res       Date:  2001-01-22

10.  Circular RNA-CDR1as acts as the sponge of microRNA-641 to promote osteoarthritis progression.

Authors:  Wei Zhang; Chi Zhang; Chengfang Hu; Congfeng Luo; Biao Zhong; Xiaowei Yu
Journal:  J Inflamm (Lond)       Date:  2020-02-18       Impact factor: 4.981

View more
  4 in total

1.  YY1 and eIF4A3 are mediators of the cell proliferation, migration and invasion in cholangiocarcinoma promoted by circ-ZNF609 by targeting miR-432-5p to regulate LRRC1.

Authors:  Canghai Guan; Lang Liu; Yuqiao Zhao; Xianhe Zhang; Guanglin Liu; Haicun Wang; Xin Gao; Xiangyu Zhong; Xingming Jiang
Journal:  Aging (Albany NY)       Date:  2021-12-13       Impact factor: 5.682

Review 2.  Studies on the Role of circRNAs in Osteoarthritis.

Authors:  Wei Wu; Jun Zou
Journal:  Biomed Res Int       Date:  2021-09-04       Impact factor: 3.411

3.  Circular RNA hsa_circ_0005567 overexpression promotes M2 type macrophage polarization through miR-492/SOCS2 axis to inhibit osteoarthritis progression.

Authors:  Jinling Zhang; Fangyue Cheng; Genxiang Rong; Zhi Tang; Binjie Gui
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

4.  Circular RNA RHOT1 Regulates miR-142-5p/CCND1 to Participate in Chondrocyte Autophagy and Proliferation in Osteoarthritis.

Authors:  Gu Man; Haiwen Yang; Kai Shen; Donghong Zhang; Julin Zhang; Hao Wu; Hongyu Zhang; Jinhuan Wang
Journal:  J Immunol Res       Date:  2022-03-08       Impact factor: 4.818

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.