| Literature DB >> 33384940 |
Francis Edet1, Stella Olubodun2, Sylvester Uansoje1, Solomon Rotimi3, George Eriyamremu1.
Abstract
Pinkwater Biosolve (BioSolve®) is one bioremediating chemical which has been widely used for cleanup of crude oil spill in Nigeria. It is a water-based formulation of nonionic surfactants and other specialty chemicals. The level of toxicity resulting from environmental exposure to this chemical has not been well understood. The level of expression of proinflammatory cytokines and histological changes in Gallus domesticus embryo were investigated. The embryo were pretreated with different doses of BioSolve, soil water from remediated soil sample, 10% soluble crude oil portion and a combination of the BioSolve with the soluble crude portion all constituted in normal saline solution. Reverse transcriptase PCR technique was used to assess the expression of hepatic proinflammatory cytokines. Histological examination was also carried out on liver fragments. The results showed that the pretreatment caused lesion on hepatocytes of all tested chick embryos except in the group administered with normal saline solution when compared with the normal control. The chick embryo exposed to 0.5 mg/kg BioSolve, 5% decanted soil water (v/v) obtained from crude oil remediated (using BioSolve) soil, and 10% (v/v) decanted crude oil remediated (using BioSolve) soil water all showed significant expression (at p < 0.05) of IFNγ, TGFβ1, IL-1β, IL-2 and TNF. The group treated with 10% soluble portion of crude oil showed significant changes in their expression pattern when compared with the control; TNF was up regulated, while IL-1β, IFNγ and TGFβ1 were down regulated. Only TNF was upregulated at p < 0.05 indicating the chances of soluble portion of crude oil causing cancer. IFNγ, TGFβ1, IL-1β and IL-2 were all down regulated significantly at p < 0.05 due to exposure to a combination of 10% soluble crude and 0.036 mg/kg BioSolve. The combination of 10% soluble crude and 0.36 mg/kg BioSolve caused lethal effect to the developing chick embryo.Entities:
Keywords: BioSolve; Chick embryo; Cleanup; Gene expression; Pro-inflammatory cytokines; Soil water
Year: 2020 PMID: 33384940 PMCID: PMC7772439 DOI: 10.1016/j.toxrep.2020.04.009
Source DB: PubMed Journal: Toxicol Rep ISSN: 2214-7500
Gene Specific Primer sequences.
| CTGCCTGCAGAAGAAGCCT | |
| TTGTAGCCCTTGATGCCCAG | |
| TGGAGCATCTCTATCATCAGAAAAA | |
| CCGGTGTGATTTAGACCCGTA | |
| CTGGCCAAGCTCCCGATGAA | |
| GAGCTGAGCAGGTATGAGTGG | |
| TGTACCAGGGTTACGGCAAT | |
| AACCCCCAAAAAGGGAACCAT | |
| CCGCCCAGTTCAGATGAGTT | |
| CCACACGACAGCCAAGTCAA | |
| AATCAAGATCATTGCCCCACC | |
| ATCCTGAGTCAAGCGCCAAA | |
| TTGACGTGCAGCAGGAACACT | |
| CGCTTAGCACCACCCTTCAG |
F = FORWARD; R = REVERSE.
Fig. 1Expression of proinflammatory cytokines with respect to the control group (NS = Normal Saline; Bs = BioSolve; 10% Sw = 10% remediated Soil water; 5% Bs = 5% remediated soil water; Sol C = Soluble crude portion).
IFN γ = interferon gamma; TGFβ1= Transforming growth factor beta 1; IL-1β= Interkeukin 1 beta; IL-2 = Interleukin 2; TNF = Tumour necrosis factor.
Fig. 2Photomicrographs of liver from day old chicks given the following treatments:
A. Normal control- no administration of samples to the egg.
B. Normal saline– administered 0.1 ml dose per egg.
C. 0.036mg/kg BioSolve in normal saline.
D. 0.36mg/kg BioSolve in normal saline.
E. 10% (v/v) decanted crude oil remediated (using BioSolve) soil water in normal saline.
F. 5% (v/v) decanted crude oil remediated (using BioSolve) soil water in normal saline.
G. 10% soluble crude oil portion in normal saline.
H. Equal volumes of 10% soluble crude oil portion +0.036 mg/kg BioSolve –both constituted in normal saline.