| Literature DB >> 33344663 |
Abhaya Gupta1, Neetu Singh2, Anil Kumar2, Umesh Pratap Verma1, Ajay Kumar Verma3, Hari Shyam2, Nand Lal1, Surya Kant3, Ankur Kumari1.
Abstract
The study aimed to investigate differential expression of targeted inflammatory-immune responsive genes [LTA, LTB, TNFSF4, TNFSF11/RANKL, TNFSF13, TNFSF13B, TNFRSF11B/ Osteoprotegerin; OPG and GFPT1/GFA ] in gingival tissues of bronchiectasis patients having chronic periodontitis in North central Indian population. Gingival tissues were collected from 30 systemically healthy chronic periodontitis patients (CP), 30 bronchiectasis patients with chronic periodontitis (B+CP), 3 systemically healthy with healthy gingiva (healthy control; HC) and 3 bronchiectasis with healthy gingiva (bronchiectasis control; BC). Statistical analysis revealed 7 genes to be significantly upregulated on comparing CP with B+CP i.e LTA (P<0.0001) in B+CP while LTB (P<0.0001), TNFSF4 (P=0.0003), TNFSF11 (P<0.0001), TNFSF13 (P=0.0003), TNFSF13B (P<0.0001) and TNFRSF11B (P=0.0004) in CP group. LTA (Lymphotoxin A) gene could be a potential genetic marker in bronchiectasis patients with chronic periodontitis.Entities:
Keywords: Bronchiectasis; Chronic periodontitis; Expression; Lymphotoxin A gene; Tumor necrosis factor superfamily
Year: 2020 PMID: 33344663 PMCID: PMC7731971 DOI: 10.22099/mbrc.2020.37397.1508
Source DB: PubMed Journal: Mol Biol Res Commun ISSN: 2322-181X
Primer details of immune-inflammatory genes used in study
|
|
|
|
|
|---|---|---|---|
|
| 5' TCCCAAGGGTGTGTGGCACCAC 3' | 249 | 99 |
Note: Forward Primer; F, Reverse Primer; R
Demographics of participants
|
|
|
|
|
|
|---|---|---|---|---|
| Age (years)a | 55±15.39 | 35.8±11.6 | 41±23.64 | 41±14.3 |
| Gender (Male/Female) | 2/1 | 15/15 | 3/0 | 15/15 |
| Radiographic type (Cylindrical/Cystic/Mixed) | N/A | N/A | 0/3/0 | 5/15/8 |
| % Lung side affected (Right/Left/Both lungs) | N/A | N/A | 66.6/0/33.3 | 20/20/60 |
| PPD (mm)a | 1.00 | 6.01±0.74b, c | 2.06±0.90 | 5.21±1.01d |
| CAL (mm) a | 1.33±0.57 | 6.69±0.83e,f | 2.46±1.10 | 6.21±0.60g |
a Mean±SD; PPD: bP=0.0109 in CP vs HC, cP=0.0026 in CP vs B+CP, dP=0.0422 in B+CP vs BC; CAL: eP=0.004 in CP vs HC, fP=0.02 in CP vs B+CP, gP=0.03 in B+CP vs BC.
Relative gingival tissue expression (fold change) of markers in various groups as determined by RT-PCR
|
|
|
|
|
|
|
|
|
|
| |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| 1.02±0.20 | 1.9±1.02 | 0.106 | 1.02±0.22 | 2.23±1.14 | 0.076 | 0.96±0.49 | 2.76±1.42 | <0.0001 | |||||
|
| 1.01±0.18 | 3.06±1.18 | 0.019 | 1.04±0.33 | 0.78±0.42 | 0.332 | 3.06±1.19 | 0.79±0.42 | <0.0001 | |||||
|
| 1.26±0.83 | 1.22±1.10 | 0.684 | 1.07±0.13 | 0.66±0.54 | 0.048 | 1.79±1.16 | 0.70±0.57 | 0.0003 | |||||
|
| 1.23±0.89 | 16.40±18.9 | 0.199 | 4.29±6.06 | 1.68±4.94 | 0.332 | 16.40±18.9 | 1.68±4.94 | <0.0001 | |||||
|
| 1.06±0.39 | 20.19±19.1 | 0.011 | 1.01±0.08 | 5.87±7.74 | 0.150 | 20.20±19.1 | 5.87±7.75 | 0.0003 | |||||
|
| 1.12±0.57 | 25.94±29.9 | 0.125 | 0.12±0.15 | 0.19±0.34 | 0.712 | 25.90±29.9 | 0.19±0.34 | <0.0001 | |||||
|
| ||||||||||||||
|
| 1.08±0.36 | 0.71±0.64 | 0.158 | 1.1±0.76 | 0.25±0.29 | 0.016 | 0.71±0.65 | 0.25±0.29 | 0.0004 | |||||
|
| ||||||||||||||
|
| 1.13±0.58 | 0.87±0.87 | 0.332 | 1.06±0.37 | 1.21±1.81 | 0.239 | 0.87±0.87 | 1.21±1.81 | 0.794 | |||||
a Mean±SD, Mann-Whitney U test