Literature DB >> 33344631

Cloning and Functional Determination of Ammonium Transporter PpeAMT3;4 in Peach.

Shuanghong You1,2, Yuqing Wang2,3, Yanju Li2,4, Yuhe Li2,3, Ping Tan1,2, Zheng Wu1,2, Wenjing Shi1,2, Zhizhong Song2,3.   

Abstract

Ammonium (NH4 +) plays key roles in plant growth, development, fruit quality, and yield. In plants, NH4 + uptake and transport are facilitated by NH4 + transporters (AMT). However, molecular mechanisms and physiological functions of type-II AMT (AMT2) transporters in fruit trees are still unclear, especially in peach. In this study, we cloned and characterized an AMT2 family gene from peach, PpeAMT3;4, and determined its function in yeast mutant. Expression analysis showed that PpeAMT3;4 was majorly expressed in peach roots and significantly decreased by NH4 + excess but had no response to NH4 + deficiency. Functional determination and 15nitrogen-labeled NH4 + uptake assay in yeast cells implied that PpeAMT3;4 was a typical high-affinity transporter, with a K m value of 86.3 μM, that can uptake external NH4 + in yeast cells. This study provides gene resources to uncover the biological function of AMT2 transporters and reveals molecular basis for NH4 + uptake and nitrogen (N) nutrition mechanisms in fruit trees.
Copyright © 2020 Shuanghong You et al.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33344631      PMCID: PMC7732375          DOI: 10.1155/2020/2147367

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Ammonium (NH4+) is the preferred form of nitrogen (N) source absorbed by both annual and perennial plant species, especially in N-deficient soils [1, 2]. However, with the increasing soil N input and atmospheric deposition, plants have to deal with NH4+ stress from sources below and above the ground [1-6]. Thus, an optimal amount of NH4+ should be effectively absorbed from the soil via plant roots, to sustain basic growth demands. Extensive studies in angiosperms [3-5] and in basal land plant liverwort [6] indicated that NH4+ acquisition and uptake were performed by NH4+ transporters (AMT) through the plasma membrane of root cells. The first plant AMT family gene was observed in Arabidopsis [7], and AtAMT1;1, AtAMT1;2, and AtAMT1;3 successfully restored the normal growth of the yeast mutant that is deficient in NH4+ uptake systems. Subsequent studies of AMT transporters have been identified in diverse plant species, including Lotus japonicus (L. japonicus) [8, 9], Lycopersicon esculentum (L. esculentum) [10-12], Populus trichocarpa (P. trichocarpa) [13], Oryza sativa (O. sativa) [14, 15], Triticum aestivum (T. aestivum) [16], Alternanthera philoxeroides (A. philoxeroides) [17], and so on, which have been characterized in Xenopus oocytes or yeast mutant. The AMT family transporters can be divided into two subfamilies: AMT1 and AMT2 [3-5]. In particular, the phosphorylation of amino acid residues of AMT proteins is a recognized means, by which NH4+ uptake activities were regulated [18, 19]. In Arabidopsis, the phosphorylation of the threonine (Thr) residue in the C-terminal tail region of AtAMT1.1 (Thr460), AtAMT1.2 (Thr472), and AtAMT1.3 (Thr464) led to the loss of NH4+ transport activity in response to increasing external NH4+ supplies [18-21], providing a novel regulatory mechanism that NH4+ transport can be rapidly shut-off under high NH4+ supply conditions. Functional studies of plant AMT members were mainly focused on the AMT1 family, especially of annual model plants. However, molecular mechanisms towards NH4+ uptake and transport in fruit trees are largely rare but were just observed in citrus [22] and pear [23, 24]. The biological and physiological functions of AMT2 members remain unknown. Favorably, the knowledge on NH4+ uptake and transport in model plants provides valuable insights into the investigation of their roles in fruit trees. As one of the most popular Rosaceae fruit crops, peach (Prunus persica) has its genome sequenced [25, 26]. In this study, we isolated and characterized a putative AMT2 family gene from peach (entitled as PpeAMT3;4) and determined that PpeAMT3;4 is a typical HATS-mediated AMT member responsible for NH4+ uptake in peach roots. Nonetheless, our findings provide a molecular basis of NH4+ uptake for fruit trees.

2. Materials and Methods

2.1. Plant Material and Growth Condition

‘Feicheng' peach seedlings grown in the Key Laboratory of Molecular Module-Based Breeding of High Yield and Abiotic Resistant Plants in Universities of Shandong in Yantai, China, were used throughout this study. Germinated seedlings with similar growth status were transferred into 1/2 Murashige and Skoog (MS) liquid solution ([17, 27], containing approximately 1 mM NH4Cl), cultivated in a climate-controlled growth cabinet that was maintained under 28°C/23°C and 12/12 h light/dark, with 60% relative humidity. For the NH4+ deficiency treatments, NH4+ was omitted from the 1/2 MS medium. For the NH4+ excess treatments, germinated seedlings were grown in 1/2 MS solution containing 20 mM NH4Cl (pH 5.8). Seedlings were exposed to treatment for 72 h before quantitative real-time PCR (qRT-PCR) determination.

2.2. Cloning of PpeAMT3; 4 Gene in Peach

Protein sequences of poplar AMT genes [13] were used as query to BLAST the Phytozome Peach Genome Database (http://www.phytozome.net) to identify putative homologues in peach. Information of PpeAMT genes were listed in Supplemental Table 1. Coding sequence (CDS) of the PpeAMT3;4 gene was downloaded from the database, and the first 18 bp sequence from the ATG codon and the last 19 bp sequence from the TAA codon were chosen as the forward primer and reverse primer, respectively (Table 1). Total RNA of ‘Feicheng' peach seedling was extracted using MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian, China) and reverse transcribed into the 1st cDNA using PrimeScript™ RT reagent Kit (TaKaRa, Dalian, China). Normal gene amplification was carried out to obtain the CDS region of PpeAMT3;4 and then sequenced in Sanon Biotech (Shanghai, China).
Table 1

Primer sequences used in this work.

PurposePrimer (5′-3′)Amplicon (bp)
Amplication of PpeAMT3;4 CDSF: ATGATGCGAGGTTGGTGCR: TTAGACCACCTGAGTGGCA1065
Specific expression primers of PpeAMT3;4F: TGTCGGAGCTTTCAGCTTGTR: TGAAACCTGCCCATCCCATC224
Specific expression primers of UbiquitinF: AGGCTAAGATCCAAGACAAAGAR: CCACGAAGACGAAGCACTAAG145
Construction of pYES2-AMT3;4 plasmidF: GAGCGGTACCATGATGCGAGGTTGGTGCR: GCGAGCGGCCGCTTAGACCACCTGAGTGGC1065

2.3. Phylogenetic Analysis of PpeAMT Genes in Peach

Full-length amino acid sequences of PpeAMT transporters were aligned by ClustalX2.1 and imported into the Molecular Evolutionary Genetics Analysis (MEGA) package version 4.1. Phylogenetic analyses were conducted according to the description of Liang et al. [28]. Branch lengths indicate the corresponding phylogenetic distances. Sequence logos of AMT1 and AMT2 subfamilies were shown on the right, generated using WEBLOGO (http://weblogo.berkeley.edu/logo.cgi). The grand average of hydropathicity (GRAVY) and aliphatic index analyses of PpeAMT3;4 were calculated using the ProtParam tool (http://web.expasy.org/protparam/), as described by Liang et al. [28].

2.4. qRT-PCR Assays

Specific expression primers for PpeAMT3;4 and Ubiquitin (control gene) were designed using the NCBI/Primer-BLAST online server. Primer sequences were listed in Table 1. According to the description of Liang et al. [28], qRT-PCR analyses were carried out on 7500 Real-Time PCR System (Applied Biosystems, New York, USA), using SYBR Premix Ex Taq reaction kit (TaKaRa, Dalian, China). To calculate RT-qPCR efficiency and the starting template concentration for each sample, the linear regression of the log (fluorescence) per cycle number data was used according to the description of Gazzarrini et al. [29]. The relative expression levels were presented after normalization to the internal control Ubiquitin from three independent biological repeats.

2.5. Functional Determination of PpeAMT3;4 in Yeast Mutant 31019b

The recombinant plasmid pYES2-AMT3;4 was constructed by cloning the CDS region of the PpeAMT3;4 gene into the pYES2 expression vector [17], using the primer pairs (Table 1, Kpn I site was introduced and underlined in the forward primer, Not I site was introduced and underlined in the reverse primer). The yeast strain 31019b (MATa mepl△ mep2△::LEU2 mep3△::KanMX2 ura3, [7, 13, 17]) was transformed with pYES2 harboring the CDS of PpeAMT3;4. Yeast complementation tests were carried out as described in previous reports [7, 13, 17]. Yeast strain 31019b was transformed with pYES2 or pYES2-AMT3;4, respectively. The growth of yeast cells were determined in the yeast nitrogen base (YNB) liquid medium, supplemented with 0.02, 0.2, or 2 mM NH4+ as the sole N source (pH 5.8). Pictures were taken at the 3rd day after incubation at 30°C. The growth of transformed yeast cells in the YNB liquid medium was checked by determining absorbance at 600 nm [29].

2.6. 15N Uptake Kinetics Assay

15N labeled NH4+ uptake assays were carried out according to the description of Guo et al. [17]. Yeast cells transformed with pYES2-MT3;4 or pYES2 were grown in the YNB liquid medium, supplemented with 15N labeled NH4Cl for 10 min. NH4+ content was determined by Flash-2000 Delta VADVADTAGE Mass Spectrometer (Thermo Fisher, Waltham, Massachusetts, USA). Michaelis-Menten kinetic constants (K and Vmax) were calculated as described by Guo et al. [17].

2.7. Statistical Analysis

All data were statistically analyzed using independent samples' t-test in SPSS 13.0 software (SPSS Chicago, Ilinois, USA). Details are described in figure legends. Asterisks indicate statistical differences between plants under control and stress treatment (∗P < 0.05, ∗∗P < 0.01).

3. Results

3.1. Characteristics and Phylogenetic Tree Construction of PpeAMT Transporters in Peach

By BLAST searching of the Phytozome Peach Genome Database, 14 putative PpeAMT genes were screened and identified [27]. Pr7otein domain verification analyses showed that all PpeAMT transporters contain the NH4+ transporter transmembrane domain (PF00909). Information of these PpeAMT genes, including gene ID, gene location, CDS (coding sequence) length, and peptide length, are listed in Supplemental Table 1. Notably, the amino acid sequences of PpeAMT proteins shared an overall identity of 51.09% (Figure 1). To confirm the evolutionary relationships of PpeAMT proteins, a maximum likelihood (ML) phylogenetic tree was generated based on the alignment of the amino acid sequences of PpeAMT proteins. All peach AMT transporters were classified into 2 major subgroups: AMT1 and AMT2 (Figure 2), each with 5 and 9 members, respectively. The AMT2 subgroup in peach was further divided into three subclades, including PpeAMT2 (1 member), PpeAMT3 (5 members), and PpeAMT4 (3 members) (Figure 2).
Figure 1

Amino acid sequence alignment of PpeAMT proteins in peach. Multiple sequence alignment of PpeAMT proteins were carried out via ClustalX2.1 software.

Figure 2

Phylogenetic tree of PpeAMT proteins in peach. A maximum likelihood (ML) tree was constructed by multiple alignment of PpeAMT proteins using ClustalX2.1 and MEGA7.0 software. The tree was based on 1000 bootstrap replicates neighbor-joining method. The PpeAMT family members were divided into two subgroups (AMT1 and AMT2, marked in blue).

3.2. Cloning and Expression Analysis of PpeAMT3;4

As a member of the AMT2 subgroup in peach, the nucleotide sequence of PpeAMT3;4 CDS was amplified from ‘Feicheng' peach seedlings, using the specific primer pairs and the 1st cDNA template. According to the sequencing results, PpeAMT3;4 possessed a coding sequence of 1065 bp, encoding a polypeptide of 355 amino acids with the deduced molecular weight of 39.09 kDa. Instability index assay implicated that PpeAMT3;4 was stable and alkalescent, with the theoretical PI value of 8.55. Moreover, both the GRAVY and aliphatic index analysis indicated that PpeAMT3;4 was a hydrophilic protein.

3.3. Expression Profiles of PpeAMT3;4

We further performed reverse-transcribed PCR to determine the expression profiles of PpeAMT3;4 in different tissues of 7-year-old ‘Feicheng' trees. Results showed that PpeAMT3;4 was majorly expressed in roots, followed by leaves, and hardly observed in stems, flowers, and fruits (Figure 3).
Figure 3

Expression profiles of PpeAMT3;4 in peach. Reverse-transcribed PCR analysis was carried out using different cDNA templates from tissues of 7-year-old ‘Feicheng' peach trees.

To investigate the role of PpeAMT3;4 in maintaining NH4+ homeostasis in peach, we analyzed the expression profiles of PpeAMT3;4 via the qRT-PCR analysis. Results showed that the expression of PpeAMT3;4 was significantly decreased by NH4+ excess in roots of ‘Feicheng' seedlings but had no response to NH4+ deficiency (Figure 4).
Figure 4

qRT-PCR analysis of PpeAMT3;4 in roots of 1-month-old ‘Feicheng' seedlings under different NH4+ supplies. The relative expression level of PpeAMT3;4 was presented after normalization to the internal control. Data are the means of values obtained from three independent biological repeats ± SE.

3.4. Functional Determination of PpeAMT1;1 in Yeast Mutant

We further carried out functional determination of PpeAMT3;4 via complementation of the yeast mutant 31019b [6, 13, 17, 30]. Results showed that yeast cells harboring pYES2 or pYES2-PpeAMT3;4 grew well, with similar growth status, on the YNB medium that contains 2 mM Arg as the sole N source (Figure 5). Yeast cells harboring pYES2 could not grow well on the YNB medium containing 0.02, 0.2, or 2 mM NH4Cl under pH 5.8, while yeast cells harboring pYES2-PpeAMT3;4 grew normally on the YNB medium supplemented under 0.2 and 2 mM NH4Cl (Figure 5). These findings imply that PpeAMT3;4 is involved in NH4+ in yeast, which may be responsible for NH4+ uptake in peach roots.
Figure 5

Functional determination of PpeAMT3;4-mediated NH4+ uptake in yeast. Yeast cells grown on the YNB medium supplemented with 2 mM Arg as the sole N source was used as the positive control. Yeast strains 31019 b transformed with pYES2 or pYES2-AMT3;4 were grown in the YNB medium, supplemented with different concentrations of NH4Cl. Final diluted concentrations are indicated by 1, 10−1, 10−2, and 10−3.

3.5. 15N Uptake Kinetics Assay of ApAMT3;4 in Yeast Cells

To verify the proposition that PpeAMT3;4 really functions as an active NH4+ transporter, we determined its NH4+ uptake activity and the exact amount of 15N-labeled NH4+ uptake in yeast cells via the 15N isotope labeling method. Yeast cells were grown in the NYB liquid medium labeled with 15N-labeled NH4Cl, ranging from 0.02 mM to 2 mM. Affinity constant analysis showed that PpeAMT3;4 exhibited a K value of 86.3 μM and a Imax value of 3.69 μmol min−1 μg−1, respectively (Figure 6). These findings indicate that PpeAMT3;4 was primarily involved in HATS-mediated NH4+ uptake in peach roots.
Figure 6

15N-labeled NH4+ uptake analysis of PpeAMT3;4 in yeast. Yeast cells transformed with pYES2 or pYES2-AMT3;4 were grown in the YNB liquid medium supplemented with different concentrations of 15N-labeled NH4Cl. Values are presented as mean ± SE, n = 3. Error bars within the plot symbols were not visible.

4. Discussion

NH4+ is the preferred form of N transport for lower energetic cost in assimilation [3–5, 29], while excess NH4+ is toxic to plant growth and development [30, 31]. In higher plants, high-affinity AMT1 subgroup genes encode NH4+ transporters with a K value of micromolar grade involved in the HATS for NH4+ uptake [12]. However, the molecular mechanism towards the AMT2 subgroup genes is largely rare. In this present study, we initially isolated and determined a high-affinity AMT2 subgroup transporter gene in peach, which helps to investigate the biological role of AMT2 family transporters in fruit trees. Transcript levels of AMT1 genes are closely related to the N nutrition status of the plant, and NH4+ starvation mainly induced the expression levels of most AMT1 genes, may it be a clue of ‘starvation response' for plants to grow under suboptimal N-source conditions [3, 16, 22]. However, PpeAMT3;4 was mainly expressed in roots and was nonresponsive to NH4+ starvation in peach roots in this study but reduced significantly by excessive NH4+ stress (Figures 3 and 4). These findings implies that PpeAMT3;4 may be an active NH4+ transporter at normal NH4+ supplies, even at extremely low NH4+ conditions, which is an indispensable AMT2 transporter responsible for NH4+ uptake in peach roots. If the NH4+ supply reached an excessive state, PpeAMT3;4 began to stop its NH4+ uptake and transport capacity that are sufficient enough for internal N metabolism and usage. Heterologous expression studies using NH4+ uptake defective yeast mutant or Xenopus oocytes indicate that AMT1 family genes encode high-affinity transporters [3, 4, 15], which play key roles in high-affinity NH4+ uptake from soils via the roots. While molecular mechanisms or biological functions of AMT2 subgroup members are extremely rare, in this present study, PpeAMT3;4 could utilize the external NH4+ in yeast cells (Figure 5), and 15N labeled NH4+ uptake kinetics analysis exhibited a K value of 86.3 μM (Figure 6). Nonetheless, PpeAMT3;4 is a functional AMT2 transporter responsible for NH4+ uptake in peach roots, especially under normal and low external NH4+ conditions.

5. Conclusions

In this study, we isolated and characterized PpeAMT3;4, an AMT2 family gene from peach, and determined its function in yeast mutant. The PpeAMT3;4 gene was majorly expressed in peach roots, whose expression was decreased under NH4+ excess but had no response to NH4+ deficiency. Functional determination and 15N-labeled NH4+ uptake kinetics assay in yeast cells indicate that ApAMT3;4 was a typical high-affinity transporter, with a K value of 86.3 μM and a Imax value of 3.69 μmol min−1 μg−1, which can uptake external NH4+ in yeast cells. Nonetheless, PpeAMT3;4 might be a NH4+ transporter involved in NH4+ uptake in peach roots. This study not only provides a technological system to uncover the biological function of AMT2 transporters in fruit trees but also reveals molecular basis for NH4+ uptake and N nutrition mechanisms.
  24 in total

1.  Constitutive expression of a novel-type ammonium transporter OsAMT2 in rice plants.

Authors:  Arata Suenaga; Kanami Moriya; Yutaka Sonoda; Akira Ikeda; Nicolaus Von Wirén; Toshihiko Hayakawa; Junji Yamaguchi; Tomoyuki Yamaya
Journal:  Plant Cell Physiol       Date:  2003-02       Impact factor: 4.927

2.  Ammonium transport and CitAMT1 expression are regulated by N in Citrus plants.

Authors:  Gemma Camañes; Miguel Cerezo; Eduardo Primo-Millo; Alain Gojon; Pilar García-Agustín
Journal:  Planta       Date:  2008-11-21       Impact factor: 4.116

3.  Preferential expression of an ammonium transporter and of two putative nitrate transporters in root hairs of tomato.

Authors:  F R Lauter; O Ninnemann; M Bucher; J W Riesmeier; W B Frommer
Journal:  Proc Natl Acad Sci U S A       Date:  1996-07-23       Impact factor: 11.205

4.  Uniport of NH4+ by the root hair plasma membrane ammonium transporter LeAMT1;1.

Authors:  Uwe Ludewig; Nico von Wirén; Wolf B Frommer
Journal:  J Biol Chem       Date:  2002-01-30       Impact factor: 5.157

5.  Functional characterization of an ammonium transporter gene from Lotus japonicus.

Authors:  F Salvemini; A Marini; A Riccio; E J Patriarca; M Chiurazzi
Journal:  Gene       Date:  2001-05-30       Impact factor: 3.688

6.  MpAMT1;2 from Marchantia polymorpha is a High-Affinity, Plasma Membrane Ammonium Transporter.

Authors:  Hanqing Guo; Nu Wang; Tami R McDonald; Anke Reinders; John M Ward
Journal:  Plant Cell Physiol       Date:  2018-05-01       Impact factor: 4.927

7.  Characterization of three functional high-affinity ammonium transporters in Lotus japonicus with differential transcriptional regulation and spatial expression.

Authors:  Enrica D'Apuzzo; Alessandra Rogato; Ulrike Simon-Rosin; Hicham El Alaoui; Ani Barbulova; Marco Betti; Maria Dimou; Panagiotis Katinakis; Antonio Marquez; Anne-Marie Marini; Michael K Udvardi; Maurizio Chiurazzi
Journal:  Plant Physiol       Date:  2004-04-09       Impact factor: 8.340

8.  Distinct expression and function of three ammonium transporter genes (OsAMT1;1-1;3) in rice.

Authors:  Yutaka Sonoda; Akira Ikeda; Satomi Saiki; Nicolaus von Wirén; Tomoyuki Yamaya; Junji Yamaguchi
Journal:  Plant Cell Physiol       Date:  2003-07       Impact factor: 4.927

9.  Allosteric regulation of transport activity by heterotrimerization of Arabidopsis ammonium transporter complexes in vivo.

Authors:  Lixing Yuan; Riliang Gu; Yuanhu Xuan; Erika Smith-Valle; Dominique Loqué; Wolf B Frommer; Nicolaus von Wirén
Journal:  Plant Cell       Date:  2013-03-05       Impact factor: 11.277

10.  Evolution of Electrogenic Ammonium Transporters (AMTs).

Authors:  Tami R McDonald; John M Ward
Journal:  Front Plant Sci       Date:  2016-03-31       Impact factor: 5.753

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.