| Literature DB >> 33343352 |
Shenghu Zhu1, Linshu Guan2, Xuemei Tan2, Guoquan Li1, Changjie Sun2, Meng Gao2, Bao Zhang1, Lina Xu2,3.
Abstract
Aromatic vinegar with abundant bioactive components can be used as a food additive to assist the treatment of various diseases. However, its effect onEntities:
Keywords: aromatic vinegar; inflammation; lipid metabolism; non-alcoholic fatty liver disease; silent information regulator of transcription 1
Year: 2020 PMID: 33343352 PMCID: PMC7747854 DOI: 10.3389/fphar.2020.585582
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
The primer sequences used for real-time PCR assay.
| Genes | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| Rats GAPDH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGACGCCAGTA |
| IL-1β | CCCTGAACTCAACTGTGAAATAGCA | CCCAAGTCAAGGGCTTGGAA |
| IL-6 | ATTGTATGAACAGCGATGATGCAC | CCAGGTAGAAACGGAACTCCAGA |
| TNF-α | TCAGTTCCATGGCCCAGAC | GTTGTCTTTGAGATCCATGCCATT |
| Human GAPDH | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
| IL-1β | CTGAGCACCTTCTTTCCCTTCA | TGGACCAGACATCACCAAGCT |
| IL-6 | TGGCTGAAAAAGATGGATGCT | TCTGCACAGCTCTGGCTTGT |
| TNF-α | TGTAGCCCATGTTGTAGCAAACC | GAGGACCTGGGAGTAGATGAGGTA |
TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6.
FIGURE 1Protective effects of aromatic vinegar on palmitic acid (PA)-induced damage in HepG2 cells. (A) Cytotoxicity of aromatic vinegar (Vin) on HepG2 cells; (B) Effects of PA on cell viability; (C) Effects of aromatic vinegar attenuated on PA-induced cell damage; (D) Effects of aromatic vinegar on Oil Red O staining in HepG2 cells (×400 magnification; Scale bar = 50 µm). Values are expressed as the mean ± SD (n = 5). *p < 0.05, **p < 0.01 compared with model groups.
FIGURE 2Effects of aromatic vinegar on biochemical indexes of rats. (A,B) Effect of aromatic vinegar on body weight (C) Effects of aromatic vinegar on the ratio of liver to body weight (%); (D–I) Effects of aromatic vinegar on the levels of alanine transaminase (ALT), aspartate transaminase (AST), TG, total cholesterol (TC), and free fatty acid (FFA) in serum and malondialdehyde (MDA) in liver tissue. Values are expressed as the mean ± SD (n = 8). *p < 0.05, **p < 0.01 compared with model groups.
FIGURE 3Effects of aromatic vinegar against non-alcoholic fatty liver disease in rats based on staining. (A) Effects of aromatic vinegar on HE staining images of liver tissues in rats (×200 magnification); (B) Effects of aromatic vinegar on Oil Red O staining images of liver tissues in rats (×200 magnification). Scale bar = 100 µm. Values are expressed as the mean ± SD. *p < 0.05, **p < 0.01 compared with model groups.
FIGURE 4Aromatic vinegar activates the silent information regulator of transcription 1 pathway in vitro and in vivo. (A) Effects of aromatic vinegar on the expression levels of SIRT1, farnesoid X receptor (FXR) and high mobility group box 1 (HMGB1) in vitro; (B) Effects of aromatic vinegar on the expression levels of SIRT1, FXR and HMGB1 in vivo; (C) Effects of aromatic vinegar on SIRT1, FXR and HMGB1 levels based on immunofluorescence staining in vivo (×200 magnification). Scale bar = 100 µm. Values are expressed as the mean ± SD (n = 3). *p < 0.05, **p < 0.01 compared with model groups.
FIGURE 5Effect of aromatic vinegar on the levels of some proteins related to lipid metabolism. (A) Effects of aromatic vinegar on the protein levels of fatty acid synthase (FASN), acetyl-CoA carboxylase-1 (ACC1), sterol regulatory element binding transcription factor 1 (SREBP1) and stearoyl-CoA desaturase-1 (SCD) in vitro; (B) Effects of aromatic vinegar on the protein levels of FASN, ACC1, SREBP1 and SCD in vivo. Values are expressed as the mean ± SD (n = 3). *p < 0.05, **p < 0.01 compared with model groups.
FIGURE 6Effect of aromatic vinegar on the levels of some proteins related to inflammation and inflammatory mediators. (A) Effects of aromatic vinegar on the protein levels of toll-likereceptor-4 (TLR4), nuclear transcription factor-κB (NF-κB) and tumor necrosis factor receptor-associated factor-6 (TRAF6) in vitro; (B) Effects of aromatic vinegar on the protein levels of TLR4, NF-κB and TRAF6 in vivo; (C) Effects of aromatic vinegar on the mRNA levels of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) in vitro; (D) Effects of aromatic vinegar on the mRNA levels of TNF-α, IL-1β and IL-6 in vivo. Values are expressed as the mean ± SD (n = 3). *p < 0.05, **p < 0.01 compared with model groups.
FIGURE 7Effffect of aromatic vinegar on silent information regulator of transcription 1 (SIRT1)/FXR and SIRT1/high mobility group box 1 (HMGB1) pathway in HepG2 cells transfected with SIRT1 siRNA. (A) The protein levels of SIRT1, FXR and HMGB1; (B) The mRNA levels of interleukin-1β (IL-1β), interleukin-6 (IL-6) and TNF-α; (C) Oil Red O staining (×400 magnification; Scale bar = 50 µm). Values are expressed as the mean ± SD (n = 3). *p < 0.05, **p < 0.01 compared with model group transfected with negtive control siRNA (NC + Model); #p < 0.05, #p < 0.01 compared with model group transfected with SIRT1 siRNA (siSirt1 + Model).
FIGURE 8Schematic diagram of the anti-lipid metabolism and anti-inflammatory effect of Hengshun aromatic vinegar.