Literature DB >> 33335579

MicroRNA-451a prevents cutaneous squamous cell carcinoma progression via the 3-phosphoinositide-dependent protein kinase-1-mediated PI3K/AKT signaling pathway.

Jixing Fu1, Jianhua Zhao1, Huamin Zhang1, Xiaoli Fan1, Wenjun Geng1, Shaohua Qiao1.   

Abstract

The role of microRNAs (miRNAs/miRs) in governing the progression of cutaneous squamous cell carcinoma (cSCC) has been the focus of recent studies. However, the functional role of miR-451a in cSCC growth remains poorly understood. Therefore, the present study aimed to determine the expression levels of miR-451a in cSCC cell lines and the involvement of miR-451a in cSCC progression. The results revealed that the expression levels of miR-451a were downregulated in cSCC tissues and cell lines, and that this subsequently upregulated 3-phosphoinositide-dependent protein kinase-1 (PDPK1) expression levels. PDPK1 was validated as a direct target of miR-451a in cSCC using bioinformatics software Starbase, dual-luciferase reporter gene assays and western blotting. Additionally, CCK-8, EdU and Transwell assays, as well as flow cytometry and Hoechst 3325 staining, were performed to assess the malignant aggressiveness of cSCC cells. Overexpression of miR-451a was demonstrated to impair the proliferation, migration, invasion and epithelial-mesenchymal transition (EMT), and promoted apoptosis in cSCC cells by interacting with PDPK1, possibly by direct targeting. Furthermore, the western blotting results indicated that miR-451a overexpression may block the PI3K/AKT signaling pathway by interacting with PDPK1. In conclusion, the findings of the present study suggested that miR-451a may prevent the proliferation, migration, invasion and EMT of cSCC cells through the PDPK1-mediated PI3K/AKT signaling pathway, which may offer potential therapeutic targets for the treatment of cSCC. Copyright: © Fu et al.

Entities:  

Keywords:  3-phosphoinositide-dependent protein kinase-1; PI3K/AKT signaling pathway; cutaneous squamous cell carcinoma; invasion; microRNA-451a; migration

Year:  2020        PMID: 33335579      PMCID: PMC7739855          DOI: 10.3892/etm.2020.9548

Source DB:  PubMed          Journal:  Exp Ther Med        ISSN: 1792-0981            Impact factor:   2.447


Introduction

Skin cancer or cutaneous carcinoma is a major worldwide public health burden which is highly prevalent and demonstrates an ever-increasing incidence with ~108,420 new cases and 11,480 death in the United States in 2020 (1,2). The majority of diagnosed skin cancer cases are non-melanomatous, consisting of basal cell carcinoma and cutaneous cell carcinoma (cSCC), which originate from keratinized epithelial cells (3). Common risk factors for most non-melanomatous cancers include ultraviolet light exposure, radiation exposure, immunosuppression and genetic factors (4). The most effective treatment for the majority of lesions is surgery; however, other interventions, including radiation, topical immunomodulators and novel systemic drugs are also applied (5). The incidence rates of cSCC are much higher in populations with fairer skin compared with individuals with darker skin and notably higher, still, in regions with high ambient ultraviolet radiation levels (6). For instance, incidence rates have ranged from 60 per 100,000 people annually in Canada (latitude, 54˚N; 2006) to 290 per 100,000 people annually in the United States (latitude, 31-37˚N; 1991); these rates were higher compared with those in Norway (annually, 20 per 100.000 men and 15 per 100,000 women; 2008-11) (7-9). cSCC is characterized by neoplastic squamous epithelial cells invading into the dermis, which may present as nodules, squamous islands or cystic structures (10). The past decade has seen significant advancements in the development of diagnostic and prognostic biomarkers, which may help elucidate the mechanisms that promote tumor initiation, progression and metastasis (11). MicroRNAs (miRNAs/miRs) are a group of non-coding RNAs of ≤25 nucleotides in length (12). miRNAs modulate gene expression post-transcriptionally and numerous miRNAs, including miR-34a, miR-181a and miR-148a, have been revealed to function as tumor suppressors in patients with cSCC (13). A previous study revealed that miR-451a expression levels were markedly downregulated in human basal cell carcinoma tissues and mouse models (14), indicating its potential role in skin cancer. The present study predicted that 3-phosphoinositide-dependent protein kinase-1 (PDPK1) may be a target gene of miR-451a, which was discovered by performing a dual-luciferase reporter gene assay. PDPK1 was previously illustrated to serve a pivotal role in the proliferation of angiosarcoma cells, indicating its potential use as a target against angiosarcoma, an aggressive malignancy of endothelial cells (15). In non-small cell lung cancer, miR-503 upregulation was revealed to downregulate PDPK1 expression levels, thus blocking the PI3K/AKT signaling pathway (16). The present study determined the expression profiles of miR-451a and PDPK1 in cSCC tissues using bioinformatics analysis and cSCC cell behavioral examination. The association between miR-451a and PDPK1 was also investigated using bioinformatics analysis and a dual-luciferase reporter gene assay. A431 and SCC-12 cell lines overexpressing miR-451a were generated to determine the regulatory role of miR-451a in the cSCC malignant phenotype and the PI3K/AKT signaling pathway.

Materials and methods

Bioinformatics analysis

The cSCC-associated dataset GSE57768, which was comprised of 30 cSCC tissues and 18 normal skin tissues (17), was downloaded from the Gene Expression Omnibus (GEO) database (ncbi.nlm.nih.gov/geo). The differentially expressed genes (DEG) between control and cancerous samples were identified using the limma package of R software (version no. 3.6.2; master.bioconductor.org/packages/release/bioc/html/limma.html). The cut-off values for DEG selection were P<0.05 and |Log FoldChange|>1, which were used to plot a heatmap of DEGs using the heatmap package (version no. 1.0.12) of R software (cran.r-project.org/web/packages/pheatmap/index.html). The target mRNAs of miR-451a were subsequently predicted using the StarBase version 2.0 website (http://starbase.sysu.edu.cn). Signaling pathway enrichment analysis was conducted with the target mRNAs identified by Starbase using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (kegg.jp) through The Database for Annotation, Visualization and Integrated Discovery (version no. 6.8; david.ncifcrf.gov) (18,19).

Cell lines and culture

The human keratinocyte cell line HaCaT (cat. no. GDC106) and cSCC cells, A431, HSC-5, SCC-12 and SCL-1, were all purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2. Subsequently, A431 and SCC-12 cells in the logarithmic growth phase were seeded into 6-well plates (2x105 cells/well) and transfected with 100 nmol miR-451a mimics or mimic controls (synthesized by Shanghai GenePharma Co., Ltd.) using Lipofectamine® 2000 reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Following 48 h of transfection at 37˚C, miR-451a expression levels were subsequently analyzed using reverse transcription-quantitative PCR (RT-qPCR) to determine the transfection efficiency. The sequences for the miR-451a mimics and mimic controls are presented in Table I.
Table I

Sequence information for miR-451a mimic and mimic control.

NameSequence (5'-3')
miR-451a mimicAAACCGUUACCAUUACUGAGUU
mimic controlAUCUGCCGGUGGUAACUGACUA

miR, microRNA.

RT-qPCR

Total RNA was extracted from HaCaT, A431, HSC-5, SCC-12 and SCL-1 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Total RNA was reverse transcribed into cDNA using a PrimeScript™ RT reagent kit according to the manufacturer's protocol with a gDNA Eraser (Takara Bio, Inc.) at 70˚C for 5 min, ice-bathed for 3 min, at 37˚C for 60 min and at 95˚C for 10 min. qPCR was subsequently performed using a SYBR Green PCR Master mix (Invitrogen; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: Pre-denaturation at 95˚C for 5 min; denaturation at 94˚C for 45 sec; annealing at 56˚C for 45 sec and extension at 72˚C for 45 sec for a total of 35 cycles. The primer sequences used for qPCR are provided in Table II. GAPDH and U6 were used as the internal loading controls. Fold changes in the relative expression of the targets were calculated using the 2-ΔΔCq method (20).
Table II

Primer sequences used for reverse transcription-quantitative PCR.

GenePrimer sequence (5'-3')
miR-451aF: GAGGGGAGCAGAGTTCAAGT
 R: TGGGAGGCAGCAATAGACAA
PDPK1F: CTGGACGACTTTGTTCTGGGG
 R: GCTCAGGAGCGTATGAAGTGG
U6F: CTCGCTTCGGCAGCACA
 R: AACGCTTCACGAATTTGCGT
GAPDHF: GCACCGTCAAGGCTGAGAAC
 R: GGATCTCGCTCCTGGAAGATG

miR, microRNA; PDPK1, 3-phosphoinositide-dependent protein kinase-1; F, forward; R, reverse.

Cell Counting Kit-8 (CCK-8) assay

The proliferative ability of cSCC cells was evaluated using a CCK-8 assay (Roche Diagnostics). At 48 h post-transfection, A431 and SCC-12 were seeded into 96-well plates (5x103 cells/well) at 37˚C. At the baseline, 24, 48 and 72 h post-incubation, 50 µl CCK-8 reagent was added to determine the optical density values at 490 nm with a Multiskan Sky microplate reader.

5-ethynyl-2'-deoxyuridine (EdU) staining

Additionally, the proliferative ability of cSCC cells was analyzed using EdU staining, as previously described (21). Briefly, stably transfected A451 and SCC-12 cells (5x103 cells/well) were seeded into 96-well petri dishes for a 24-h culture and fixed with 100 µl 4% paraformaldehyde for 30 min at room temperature. Then, RPMI-1640 medium (100 µl) containing 20 µM EdU (Beijing Solarbio Science & Technology Co., Ltd.) was added into each well, after which cells were cultured at 37˚C for 2 h. The EdU positive cells were stained red. Nuclei were subsequently counterstained with 4',6-diamidino-2-phenylindole at 37˚C for 30 min. The number of EdU positive cells was observed in five different visual fields using a fluorescence microscope (magnification, x200; Olympus Corporation). The EdU positive cell index (EdU positive cells/total cells) was measured using ImageJ (version no. 1.52; National Institutes of Health).

Flow cytometric analysis of apoptosis

Apoptotic cSCC cells were analyzed following miR-451a transfection using an Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis detection kit (Best-Bio, Ltd.) and flow cytometry as previously reported (22). Briefly, cells were resuspended in 200 µl binding buffer and dual-stained in the dark for 15 min at room temperature using PI and Annexin V-FITC (both, 100 µl). Late apoptotic cells (positive for PI and Annexin V-FITC) were analyzed using a BD Accuri™ C6 Plus flow cytometer and CellQuest software (version no; 6.1; both from BD Biosciences).

Hoechst 33258 staining

cSCC cells in the logarithmic growth phase were subjected to Hoechst 33258 staining. Briefly, following transfection, 5x103 cSCC cells were seeded into six-well plates and incubated overnight at 37˚C. Following permeabilization with 50 µl cold 4% formaldehyde for 30 min at room temperature, the cells were incubated for ≥20 min at room temperature with 20 µg/ml Hoechst. The cells were visualized using a Leica confocal laser-scanning microscope (TCS SP8; Leica Microsystems GmbH) at 365 nm in five different visual fields. The apoptotic cell rate (%) was calculated using the following formula: (Number of apoptotic cells per field/total number of cells per field) x100.

ELISAs

The concentrations of Bax (cat. no. ab199080), Bcl-2 (cat. no. ab202411), E-cadherin (cat. no. ab197751) and N-cadherin (cat. no. ab254512) were determined in A431 and SCC-12 cell lysates using ELISA kits (all from Abcam), according to the manufacturers' protocols.

Transwell assays

The invasion and migration of A431 and SCC-12 cells following miR-451a mimic transfection were analyzed using Transwell assays, as described previously (23). Briefly, for the invasion analysis, 3x104 cells/well were added to 200 µl FBS-free RPMI-1640 medium and plated into the upper chamber of Transwell plates precoated with Matrigel at 4˚C until the Matrigel was solidified (80 µl; 1:4; Sigma-Aldrich; Merck KGaA). A total volume of 500 µl RPMI-1640 medium supplemented with 10% FBS was plated into the lower chamber. Following incubation at 37˚C for 48 h, the cells were fixed with 2.5% glutaraldehyde at room temperature for 30 min and stained with 0.1% crystal violet at room temperature for 30 min. The number of cells was counted in five different randomly selected fields of view using a light microscope (magnification, x200). The migration assay was performed in a similar manner, except for the following modifications: The Transwell plates were not precoated in Matrigel and the cells were only incubated for 24 h at 37˚C.

Dual-luciferase reporter gene assay

The PDPK1 wild-type (WT) and mutant (MT) 3'untranslated region (UTR) binding sequences were synthesized by Shanghai GenePharma Co., Ltd. and inserted into pMIR-REPORTTM plasmids (Thermo Fisher Scientific, Inc.). 293T cells (1x104 cells/well) were incubated overnight and transfected with 50 nmol PDPK1-WT/MT and miR-451a mimics or mimic controls using Lipofectamine® 2000 (Invitrogen Thermo Fisher Scientific, Inc.) for 48 h. The relative luciferase activity was determined using a Dual-Luciferase Reporter assay system (Promega Corporation) as previously described (24). Renilla luciferase activity was used for normalization of the firefly luciferase activity.

Western blotting

Western blotting analysis was performed to analyze the phosphorylation status of PI3K/AKT signaling pathway-associated proteins in transfected A431 and SCC-12 cells. The experimental protocol was performed according to a previously described study (21). Briefly, total protein was extracted from the cells using an SDS lysis buffer (cat. no. P0013G; Beyotime Institute of Biotechnology) on ice for 30 min. The concentration of total protein was measured using a BCA protein assay kit (Pierce; Thermo Fisher Scientific, Inc.). Total protein (50 µg/lane) was subjected to 10% SDS-PAGE and transferred onto PVDF membranes. Membranes were blocked with 10% non-fat milk at 25˚C for ≥1 h. The membranes were incubated with the following primary antibodies: Anti-PDPK1 (1:2,000; cat. no. ab52893; Abcam), anti-PI3K (1:5,000; cat. no. ab151549; Abcam), anti-phosphorylated (p)-PI3KY607 (1:5,000; cat. no. ab182651; Abcam), anti-AKT1 (1:5,000; cat. no. ab235958; Abcam), anti-pAKT1S473 (1:5,000; cat. no. ab81283; Abcam) and anti-β-actin (1:10,000; cat. no. ab8226; Abcam) for 1 h at room temperature. Following the primary antibody incubation, the membranes were incubated with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:10,000; cat. no. ab7090; Abcam) for 2 h at room temperature. Signals were detected using ECL reagents (cat. no. SW2030; Beijing Solarbio Science & Technology Co., Ltd.). Densitometry was analyzed using Image-Pro Plus software (version no. 6.0; Media Cybernetics, Inc.).

Statistical analysis

Statistical analysis was performed using SPSS 21.0 software (IBM Corp.). All data and results were calculated from ≥3 replicate measurements and are presented as the mean ± SD. The Kolmogorov-Smirnov method was used to analyze whether the data were normally distributed. Multigroup comparisons were performed using a one-way or two-way (factorial) ANOVA with a Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-451a is poorly expressed in cSCC

Following the analysis of the GSE57768 dataset, 20 DEGs were selected and plotted in a heat map (Fig. 1A). The results revealed that compared with the normal skin tissues, the expression levels of miR-451a were downregulated in cSCC tissues (Fig. 1B). A previous study indicated that miR-451a may serve as a tumor suppressor in cutaneous basal cell carcinoma (14). Therefore, the current study determined the expression levels of miR-451a in human keratinocyte and cSCC cells; the expression levels of miR-451a were discovered to be significantly downregulated in cSCC cells compared with the HaCaT cells (Fig. 1C).
Figure 1

miR-451a expression levels are significantly downregulated in cSCC tissues and cell lines. (A) Heatmap representing the differentially expressed miRs in the GSE57768 dataset obtained from the GEO database. (B) miR-451a expression levels in normal skin and cSCC tissues in the GSE57768 dataset obtained from the GEO database. **P<0.01. (C) miR-451a expression levels in HaCaT, A431, HSC-5, SCC-12 and SCL-1 cells were determined using RT-qPCR. *P<0.05 vs. HaCaT cells. (D) miR-451a expression levels in A431 and SCC-12 cells transfected with the miR-451a mimic or mimic control were determined by RT-qPCR. *P<0.05. The data are presented as the mean ± SD. One-way ANOVA and Tukey's multiple comparison test were used to determine statistical significances. miR, microRNA; cSCC, cutaneous squamous cell carcinoma; GEO, gene expression omnibus; RT-qPCR, reverse transcription-quantitative PCR.

miR-451a mimics or mimic controls were subsequently transfected into A431 and SCC-12 cells to verify the effect of miR-451a on cSCC cells. These cell lines were chosen for further experiments due to their relatively low miR-451a expression. RT-qPCR analysis revealed that miR-451a expression levels were significantly upregulated in cSCC cells following transfection with miR-451a mimics compared with mimic controls, indicating that the transfection was successful (Fig. 1D).

miR-451a overexpression suppresses cSCC cell viability

The CCK-8 assay revealed that the proliferation of miR-451a mimic-transfected A431 and SCC-12 cells was significantly inhibited compared with their respective mimic control-treated cells (Fig. 2A). Additionally, the results of the EdU staining assay illustrated that the transfection with miR-451a mimics significantly decreased the proliferation of A431 and SCC-12 cells compared with mimic control-transfected cells (Fig. 2B).
Figure 2

miR-451a overexpression inhibits cutaneous squamous cell carcinoma cell proliferation. (A) Cell proliferation rate in A431 and SCC-12 cells transfected with the miR-451a mimic or mimic control was determined using CCK-8 assays. (B) Cell proliferation in A431 and SCC-12 cells transfected with miR-451 mimics or mimic controls was analyzed using EdU staining. Scale bar, 50 µm. The data are presented as the mean ± SD. One-way ANOVA and Tukey's multiple comparison tests were used to determine statistical significances. *P<0.05. miR, microRNA; EdU, 5-ethynyl-2'-deoxyuridine.

miR-451a overexpression promotes cSCC cell apoptosis

The levels of apoptosis in A431 and SCC-12 cells labeled with PI/Annexin V were detected via flow cytometry. The results revealed that the transfection with miR-451a mimics significantly increased the levels of apoptosis in both cell lines compared with transfection with mimic controls (Fig. 3A), which was further validated by the results of Hoechst 33258 staining (Fig. 3B). The concentrations of various apoptosis-associated proteins, including Bax and Bcl-2, in A431 and SCC-12 cell lysates were subsequently analyzed using ELISAs. The results demonstrated that the transfection with the miR-451a mimic significantly increased the concentration of Bax, while decreasing that of Bcl-2, compared with the mimic control-transfected cells in both cell lines (Fig. 3C).
Figure 3

miR-451a promotes cSCC cell apoptosis. (A) Apoptotic A431 and SCC-12 cells transfected with miR-451a mimics or mimic controls were determined by flow cytometric analysis. (B) Hoechst 33258 staining of A431 and SCC-12 cells transfected with the miR-451a mimic or mimic control. Scale bar, 50 µm. (C) Bax and Bcl-2 concentrations in A431 and SCC-12 cells transfected with the miR-451a mimic or mimic control were analyzed using ELISAs. The data are presented as the mean ± SD. One-way ANOVA and Tukey's multiple comparison tests were used to determine statistical significances. *P<0.05. miR, microRNA; cSCC, cutaneous squamous cell carcinoma; PI, propidium iodide.

miR-451a overexpression inhibits cSCC cell epithelial-mesenchymal transition (EMT), migration and invasion

EMT is a common malignant biological process of tumor cells (25). Therefore, the current study determined whether miR-451a and the EMT process were associated in cSCC cells. The concentrations of the specific epithelial marker, E-cadherin and mesenchymal marker, N-cadherin, in the cell lysates of A431 and SCC-12 cells were analyzed via ELISAs. The results revealed that the overexpression of miR-451a significantly inhibited the EMT process in A431 and SCC-12 cells by enhancing E-cadherin expression and lowering N-cadherin expression (Fig. 4A). A431 and SCC-12 cell invasion and migration were subsequently analyzed using Transwell assays. The results demonstrated that the overexpression of miR-451a significantly inhibited the invasion and migration of both cell lines compared with the mimic control-transfected cells (Fig. 4B and C).
Figure 4

miR-451a suppresses cSCC cell epithelial-mesenchymal transition, migration and invasion. (A) E-cadherin and N-cadherin protein concentrations in A431 and SCC-12 cells transfected with miR-451a mimics or mimic controls were analyzed using ELISAs. (B) Migratory ability of A431 and SCC-12 cells transfected with miR-451a mimics or mimic controls was determined using Transwell assays. Scale bar, 50 µm. (C) Invasive ability of A431 and SCC-12 cells transfected with miR-451a mimics or mimic controls was analyzed using Transwell Matrigel assays. Scale bar, 50 µm. One-way ANOVA and Tukey's multiple comparison tests were used to determine statistical significances. *P<0.05. miR, microRNA; cSCC, cutaneous squamous cell carcinoma.

miR-451a blocks the PI3K/AKT signaling pathway by targeting PDPK1 in cSCC cells

The possible target genes of miR-451a were predicted using StarBase to determine the downstream signaling pathways of miR-451a in cSCC, which were further analyzed using KEGG signaling pathway enrichment analysis. The results revealed that the ‘PI3K-Akt signaling pathway’ was enriched (data not shown; Fig. 5A), which has been reported to be associated with the malignant behavior of cSCC cells (26,27). Moreover, the PDPK1 gene was located upstream of the PI3K/AKT signaling pathway (Fig. S1). The Starbase prediction illustrated that miR-451a shared a complementary binding site with the 3'UTR sequence of PDPK1 (Fig. 5B). Subsequently, the data were verified by performing a dual-luciferase reporter gene assay, which revealed that luciferase activity was significantly decreased in 293T cells transfected with miR-451a mimics and PDPK1-WT; however, there was no significant difference in cells transfected with miR-451a mimics and PDPK1-MT or mimic control and PDPK1-WT (Fig. 5C). RT-qPCR and western blotting were subsequently performed to analyze the mRNA and protein expression levels of PDPK1 in A431 and SCC-12 cells. The results revealed that miR-451a mimics significantly downregulated the mRNA and protein expression levels of PDPK1 in both cell lines compared with the mimic control group (Fig. 5D and E). The extent of PI3K/AKT signaling pathway phosphorylation was subsequently determined using western blotting. The miR-451a mimic was discovered to significantly reduce PI3K/AKT signaling pathway phosphorylation compared with the mimic control group in both cell lines (Fig. 5F), which may suggest the inhibition of the malignant biological behavior of cSCC cells.
Figure 5

miR-451a downregulates the PI3K/AKT signaling pathway via targeting PDPK1. (A) Target mRNAs of miR-451a were predicted using StarBase and Kyoto Encyclopedia of Genes and Genomes signaling pathway enrichment analysis was conducted using The Database for Annotation, Visualization and Integrated Discovery software. The bubble plot represents the top 10 enriched pathways. (B) Identified complementary binding site between miR-451a and PDPK1 mRNA was predicted using StarBase. (C) Relative luciferase activity of PDPK1 MT or WT following the transfection of miR-451a mimics or mimic controls was analyzed using dual luciferase reporter assays. PDPK1 (D) mRNA and (E) protein expression levels in A431 and SCC-12 cells following the transfection of the miR-451a mimic or mimic control were determined using reverse transcription-quantitative PCR or western blotting, respectively. (F) Extent of PI3K/AKT signaling pathway phosphorylation in A431 and SCC-12 cells following the transfection of miR-451a mimic or mimic control was analyzed using western blotting. The data are presented as the mean ± SD. One-way ANOVA and Tukey's multiple comparison tests were used to determine statistical significances. *P<0.05. miR, microRNA; PDPK1, 3-phosphoinositide-dependent protein kinase-1; MT, mutant; WT, wild-type; p-, phosphorylated.

Discussion

Perineural invasion is a risk factor for cSCC, with an incidence rate ranging from 2.5-14% (28). miRNAs are considered to be vital genetic modulators of different biological processes, including cell proliferation, invasion and apoptosis (22). Since miR-451a was identified to be involved in cell proliferation and migration (29,30), it was predicted that the downregulation of miR-451a may contribute to cSCC pathogenesis. The current study determined that compared with HaCaT cells, the expression levels of miR-451a in cSCC cells were significantly downregulated. Consistent with these results, the analysis of miRNA expression profiles using the NanoString platform by Latchana et al (31) revealed a downregulation of miR-451a expression levels in patients with metastatic melanoma following resection. Additionally, the upregulation of miR-451a expression levels in melanoma cells were reported to markedly decrease cell migration and invasion (32). The EMT process may explain the invasiveness and aggressiveness of cSCC, which metastasizes by depleting the epithelial marker E-cadherin and acquiring the mesenchymal marker N-cadherin, amongst others (33). In the present study, the overexpression of miR-451a significantly repressed cSCC cell proliferation, invasion, migration and EMT, while promoting apoptosis, indicating that miR-451a may be a crucial negative modulator of cSCC cell growth by serving as a tumor suppressor. Similar to these findings, a previous study determined that miR-451a expression levels were downregulated in osteosarcoma, while the restoration of miR-451a expression suppressed the viability and invasion of osteosarcoma cell lines by binding to tripartite motif-containing (34). EMT is a crucial biological event for the invasion and migration of epithelial-derived tumor cells and represents a crucial step in the malignant progression of tumors (35). Furthermore, miR-451a overexpression was demonstrated to decrease cell proliferation and EMT processes, and induce papillary thyroid cancer cell apoptosis (36). During early diabetic kidney injury, microvesicle-delivered miR-451a promoted the proliferation and viability of HK2 cells, while the injection of miR-451a upregulated the expression levels of E-cadherin (37). Similar findings were observed in the current study, whereby the transfection with the miR-451a mimic increased the levels of E-cadherin and decreased those of N-cadherin in the two cSCC cell lines. Consequently, further investigations of the mechanisms underlying the miR-451a-induced downregulation of cSCC cell growth are required to further determine cSCC development. The relative luciferase activity of 293T cells containing the PDPK1-WT 3'UTR with complementary miR-451a binding sites was significantly decreased upon co-transfection with miR-451a mimics, which was determined using dual-luciferase reporter gene assays. These results indicated that miR-451a may interact with the PDPK1 3'UTR and inhibit its expression. PDPK1 was first discovered in 1997 as the kinase responsible for AKT phosphorylation (38). PDPK1 is a transducer of the PI3K signaling pathway and has been identified to induce a plethora of downstream effectors, representing a crucial hub for synchronizing signals from extracellular cues towards the cytoskeletal machinery (39). Furthermore, PDPK1 was previously demonstrated to enhance cell proliferation, migration, invasion, tumor growth and metastasis, and to interact with the Notch1 intracellular domain, thus repressing its ubiquitin-modulated degradation (40). Although the present study did not provide experimental results regarding the involvement of PDPK1 in the malignant phenotype of cSCC cells due to the funding limitations, the association between miR-451a and the PI3K/AKT signaling pathway was validated. The inhibition of the heat shock protein 90/PI3K signaling pathway has been previously associated with reduced melanoma growth (41). Furthermore, the treatment with himachalol significantly promoted skin carcinogenesis cell apoptosis and cell cycle arrest in skin carcinogenesis cells through inhibiting the PI3K/AKT signaling pathway (42). Additionally, Riquelme et al (43) identified a decrease in gastric cancer cell migration and invasion following miR-451a mimic transfection, which was achieved by the regulation of the PI3K/AKT/mTOR axis. Furthermore, it was reported that the upregulation of miR-451a expression levels impaired the proliferation and migration of papillary thyroid carcinoma cells, downregulated the expression levels of its target gene, AKT1 and attenuated AKT/mTOR signaling pathway activation (44). The results of the present study determined that miR-451a blocked the induction of the PI3K/AKT signaling pathway by reducing the extent of PI3K and AKT phosphorylation. In conclusion, the results of the present study indicated that miR-451a may bind to PDPK1 and subsequently downregulate the activity of the PI3K/AKT signaling pathway. The overexpression of miR-451a significantly reduced cSCC cell proliferation, migration, invasion and EMT, while promoting apoptosis. However, further studies analyzing the association between PDPK1 and the PI3K/AKT signaling pathway in cSCC are required. The results of the current study provided insight into the molecular mechanism by which miR-451a may impair the cSCC malignant phenotype.
  7 in total

1.  MiR-10b-3p alleviates cerebral ischemia/reperfusion injury by targeting Krüppel-like factor 5 (KLF5).

Authors:  Ke Sun; Jiangang Zhang; Qingcheng Yang; Jinzhao Zhu; Xiangdong Zhang; Kun Wu; Zhenhua Li; Weizheng Xie; Xue Luo
Journal:  Pflugers Arch       Date:  2022-01-06       Impact factor: 3.657

Review 2.  A tEMTing target? Clinical and experimental evidence for epithelial-mesenchymal transition in the progression of cutaneous squamous cell carcinoma (a scoping systematic review).

Authors:  Benjamin Genenger; Jay R Perry; Bruce Ashford; Marie Ranson
Journal:  Discov Oncol       Date:  2022-06-06

Review 3.  Oh, the Mutations You'll Acquire! A Systematic Overview of Cutaneous Squamous Cell Carcinoma.

Authors:  Stephenie Droll; Xiaomin Bao
Journal:  Cell Physiol Biochem       Date:  2021-09-22

Review 4.  Non-coding RNAs in skin cancers:Biological roles and molecular mechanisms.

Authors:  Fei Liu; Shenglong Li
Journal:  Front Pharmacol       Date:  2022-08-10       Impact factor: 5.988

5.  LncRNA NEAT1 Targets miR-342-3p/CUL4B to Inhibit the Proliferation of Cutaneous Squamous Cell Carcinoma Cells.

Authors:  Zhenhua Gong; Yi Zhang; Yasu Jiang; Peng Chen; Jianfeng Ji
Journal:  J Oncol       Date:  2022-07-22       Impact factor: 4.501

Review 6.  Role of PI3K/AKT pathway in squamous cell carcinoma with an especial focus on head and neck cancers.

Authors:  Soudeh Ghafouri-Fard; Ali Noie Alamdari; Yashar Noee Alamdari; Atefe Abak; Bashdar Mahmud Hussen; Mohammad Taheri; Elena Jamali
Journal:  Cancer Cell Int       Date:  2022-08-13       Impact factor: 6.429

7.  Lack of Conserved miRNA Deregulation in HPV-Induced Squamous Cell Carcinomas.

Authors:  Jaroslav Nunvar; Lucie Pagacova; Zuzana Vojtechova; Nayara Trevisan Doimo de Azevedo; Jana Smahelova; Martina Salakova; Ruth Tachezy
Journal:  Biomolecules       Date:  2021-05-20
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.