| Literature DB >> 33329040 |
Alexandre Augusto Pereira Firmino1,2, Daniele Heloísa Pinheiro1, Clidia Eduarda Moreira-Pinto1,3, José Dijair Antonino1,4, Leonardo Lima Pepino Macedo1, Diogo Martins-de-Sa3, Fabrício Barbosa Monteiro Arraes1,5,6, Roberta Ramos Coelho1, Fernando Campos de Assis Fonseca1,3, Maria Cristina Mattar Silva1,6, Janice de Almeida Engler6,7, Marília Santos Silva1, Isabela Tristan Lourenço-Tessutti1, Walter Ribeiro Terra8, Maria Fátima Grossi-de-Sa1,6,9.
Abstract
The cotton boll weevil, Anthonomus grandis, is the most economically important pest of cotton in Brazil. Pest management programs focused on A. grandis are based mostly on the use of chemical insecticides, which may cause serious ecological impacts. Furthermore, A. grandis has developed resistance to some insecticides after their long-term use. Therefore, alternative control approaches that are more sustainable and have reduced environmental impacts are highly desirable to protect cotton crops from this destructive pest. RNA interference (RNAi) is a valuable reverse genetics tool for the investigation of gene function and has been explored for the development of strategies to control agricultural insect pests. This study aimed to evaluate the biological role of the Laccase2 (AgraLac2) gene in A. grandis and its potential as an RNAi target for the control of this insect pest. We found that AgraLac2 is expressed throughout the development of A. grandis with significantly higher expression in pupal and adult developmental stages. In addition, the immunolocalization of the AgraLac2 protein in third-instar larvae using specific antibodies revealed that AgraLac2 is distributed throughout the epithelial tissue, the cuticle and the tracheal system. We also verified that the knockdown of AgraLac2 in A. grandis resulted in an altered cuticle tanning process, molting defects and arrested development. Remarkably, insects injected with dsAgraLac2 exhibited defects in cuticle hardening and pigmentation. As a consequence, the development of dsAgraLac2-treated insects was compromised, and in cases of severe phenotypic defects, the insects subsequently died. On the contrary, insects subjected to control treatments did not show any visible phenotypic defects in cuticle formation and successfully molted to the pupal and adult stages. Taken together, our data indicate that AgraLac2 is involved in the cuticle tanning process in A. grandis and may be a promising target for the development of RNAi-based technologies.Entities:
Keywords: RNAi; Laccase2; cuticle tanning; gene silencing; insect pest control
Year: 2020 PMID: 33329040 PMCID: PMC7717984 DOI: 10.3389/fphys.2020.591569
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.566
Primers used for dsRNA synthesis and RT-qPCR analyses.
| Primer identification | Sequence 5′-3′ | Amplicon size (bp) |
| dsRNA_Ag_Lac2_Fwd | 332 | |
| CTCCGCTTCTATCTCAGT | ||
| dsRNA_Ag_Lac2_Rv | ||
| CAATGGTGTCTTTACCG | ||
| qPCR_Ag_Lac2_Fwd | GGTTGATGAAGTTCAACA | 192 |
| qPCR_Ag_Lac2_Rv | GCAATGGTGTCTTTACCG | |
| qPCR_Ag_β-tubulin_Fw | GGTTGCGACTGTTTACAAGG | 156 |
| qPCR_Ag_β-tubulin_Rv | GCACCACCGAGTAAGTGTTC | |
| qPCR_Ag_gapdh_Fwd | AGATCGTCGAGGGTCTGATG | 166 |
| qPCR_Ag_gapdh_Rv | AAGGCGGGAATGACTTTACC |
FIGURE 1Laccase 2 protein in four different insect orders. In order to characterize in silico the protein sequence of A. grandis Laccase2 (AgraLac2), phylogenetic analyses (A) and domain analyses (B,C) were performed with 127 different Lac2 protein sequences from four different insect orders (42 from dipterans, 19 from coleopterans, 45 from hymenopterans and 21 from lepidopterans). (A) Maximum likelihood analysis of the AgraLac2 protein with its putative orthologues. The AgraLac2 sequence is highlighted in red (red arrow). The black circles present in the clades of the phylogenetic tree represent the Bootstrap values. The black circles with the smallest diameter represent the bootstrap value equal to 70, while the black circles with the largest diameter represent the bootstrap value equal to 100. Bootstrap values between this range are represented by black circles with increasing diameter. Nannophya pigmaea (BBC20924.1) is the outgroup. (B) Schematic representation of Lac2 protein from the analyzed insects (including AgraLac2), where an N-terminal region with variable sequence (absent in AgraLac2, since this study identified only partial AgraLac2 sequence) and three multicooper oxidase domains are highlighted: Cu-oxidase (PF00394.22; blue box), Cu-oxidase 2 (PF07731.14; pink box), and Cu-oxidase 3 (PF07732.15; green box). (C) Consensus sequence of three multicooper oxidase domains characteristic of insect Lac2 proteins. The consensus sequence was obtained from 127 different Lac2 proteins selected for this study.
FIGURE 2Expression profile of AgraLac2 across the developmental stages of A. grandis. Relative transcript levels of the AgraLac2 gene in eggs, larvae (1st – 3rd instar), pupae, male adults and female adults evaluated by RT-qPCR. The data were normalized using gapdh and β-tub as reference genes. Values shown are the means and standard errors (±SE) of three biological replicates each with three technical replicates. Data were analyzed by one-way ANOVA followed by a post hoc multiple comparisons test (Tukey’s HSD test). Treatment groups with different letters are significantly different (P < 0.05).
FIGURE 3Localization of the AgraLac2 protein in third-instar larvae of A. grandis. (A) Section of larval tissues stained in 0.05% toluidine showing the cuticle and epidermis. (B) Immunostaining showing the localization of AgraLac2 protein. For immunostaining assays, the third-instar larvae were fixed and embedded in methacrylate resin. Thin sections were probed with primary rabbit anti-AgraLac2 polyclonal antibody and AP-conjugated anti-rabbit IgG secondary antibody and detected colorimetrically. (C) Negative control for immunostaining was performed through incubation with the pre-immune serum of rabbit immunized with AgraLac2 peptides. Scale bar = 10 μm. (D,D’) Immunolocalization of the AgraLac2 protein. For fluorescent immunolocalization assays, sections of larval tissues were incubated with primary rabbit anti-AgraLac2 polyclonal antibody. The anti-AgraLac2 antibody was detected with an Alexa Fluor 488-conjugated anti-rabbit IgG secondary antibody (green). (E) Negative control for immunolocalization, which was performed through incubation with PIPES buffer and BSA. (F,F’,G) Nuclei were stained with DAPI (blue). (D’,F’) Amplified images of white boxes shown in D and F. Scale bar = 100 μm. Asterisks indicate the larval cuticle. White arrows indicate the monolayer of epidermal cells below the larval cuticle. Red arrows indicate the tracheal system.
FIGURE 4Relative transcript levels of AgraLac2 after dsRNA exposure. Relative transcript levels of AgraLac2 in A. grandis larvae at day 2 (A) and at day 20 (B), and in A. grandis pupae/adults at day 14 (C) after water (mock) or dsAgraLac2 injection were evaluated by RT-qPCR. The expression data were normalized using gapdh and β-tub as reference genes. Values shown are the means and standard errors (±SE) of two-three biological replicates each with three technical replicates. Data were analyzed by Student’s t-test. Significant differences are indicated with asterisks (P < 0.05); ns, not significant.
FIGURE 5Effect of AgraLac2 knockdown on A. grandis mortality and morphological phenotypes. Percent mortality at days 20 and 30 (A) and normal/abnormal phenotypes at day 20 (B) of the insects treated with dsAgraLac2 or mock. Values shown are the means and standard errors (±SE) of three biological replicates. Data were analyzed by Student’s t-test. Significant differences are indicated with asterisks (*P < 0.05; ***P < 0.001).
FIGURE 6Morphological phenotype of A. grandis larvae induced by the injection of dsRNA targeting the AgraLac2 gene. Third-instar larvae of A. grandis were injected with 500 ng of dsAgraLac2 or water (mock), and the phenotypic effects were observed at 20 days after injection. A normal phenotype was observed in larvae from the control treatment (A,A’,A”) and an abnormal phenotype was observed in larvae treated with dsAgraLac2 (B,B’,B”). Representative images of insects were captured with a SZ61TR stereomicroscope (Olympus).
FIGURE 7Morphological phenotype of A. grandis adults induced by the injection of dsRNA targeting the AgraLac2 gene. Third-instar larvae of A. grandis were injected with 500 ng of dsAgraLac2, dsGFP or water (mock), and the phenotypic effects were observed at 20 days after injection. Dorsal, ventral and latero-ventral views of A. grandis subjected to the mock (A), dsGFP (B) or dsAgraLac2 (C) treatment at 20 days after injection. Insects from the control treatments (A, B) displayed a normal phenotype with a rigid and brownish cuticle while insects treated with dsAgraLac2 exhibited abnormal phenotype with a soft cuticle lacking pigmentation (C). Representative pictures of insects were captured with an M205 FA fluorescence stereomicroscope (Leica) with FusionOpticsTM. Scale bar = 2 mm.