Literature DB >> 33326493

Activation of neuronal adenosine A1 receptors causes hypothermia through central and peripheral mechanisms.

Haley S Province1, Cuiying Xiao1, Allison S Mogul1, Ankita Sahoo2, Kenneth A Jacobson3, Ramón A Piñol1, Oksana Gavrilova2, Marc L Reitman1.   

Abstract

Extracellular adenosine, a danger signal, can cause hypothermia. We generated mice lacking neuronal adenosine A1 receptors (A1AR, encoded by the Adora1 gene) to examine the contribution of these receptors to hypothermia. Intracerebroventricular injection of the selective A1AR agonist (Cl-ENBA, 5'-chloro-5'-deoxy-N6-endo-norbornyladenosine) produced hypothermia, which was reduced in mice with deletion of A1AR in neurons. A non-brain penetrant A1AR agonist [SPA, N6-(p-sulfophenyl) adenosine] also caused hypothermia, in wild type but not mice lacking neuronal A1AR, suggesting that peripheral neuronal A1AR can also cause hypothermia. Mice expressing Cre recombinase from the Adora1 locus were generated to investigate the role of specific cell populations in body temperature regulation. Chemogenetic activation of Adora1-Cre-expressing cells in the preoptic area did not change body temperature. In contrast, activation of Adora1-Cre-expressing dorsomedial hypothalamus cells increased core body temperature, concordant with agonism at the endogenous inhibitory A1AR causing hypothermia. These results suggest that A1AR agonism causes hypothermia via two distinct mechanisms: brain neuronal A1AR and A1AR on neurons outside the blood-brain barrier. The variety of mechanisms that adenosine can use to induce hypothermia underscores the importance of hypothermia in the mouse response to major metabolic stress or injury.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33326493      PMCID: PMC7743955          DOI: 10.1371/journal.pone.0243986

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Extracellular adenosine, a product of excessive ATP breakdown such as from extreme metabolic demand or tissue injury, has been called a ‘retaliatory metabolite’ or danger signal [1]. Due to rapid (i.e., seconds) cellular uptake and metabolism, extracellular adenosine levels are typically low [2] and many of its effects occur locally. Adenosine elicits protective physiology to diminish metabolic demand, reduce injury, and orchestrate recovery from the instigating ‘extreme’ physiology [3]. The adenosine A1 receptor (A1AR) is one of the four adenosine G protein-coupled receptors and is primarily coupled to Gi/o [4]. Its structure has been solved [5]. A1AR is very widely expressed and agonism at this receptor has cardiovascular (bradycardia, protection from ischemia-reperfusion injury), nervous system (antinociception, anti-seizure, protection from ischemia injury, sleep), anti-inflammatory, antidiuretic, and tissue protective (lung, kidney) actions, among other effects [6]. Clinically, hypothermia is used to reduce injury after neonatal hypoxia or cardiopulmonary resuscitation [7]. The hypothermia is typically produced by physical cooling. However, a wide variety of pharmacologic agents can cause hypothermia (see [8]), including adenosine [9], and there is interest in using such agents clinically. This can be readily investigated using mice, as their small size makes them a sensitive, responsive model for exploring mammalian thermal physiology [10]. In the brain, the preoptic area (POA) plays a major integratory role in the control of body temperature [11]. For example, this region has neurons that can drive hypothermia/torpor [12], so this brain region is a prime candidate for pharmacologic actions. A number of lines of evidence indicate a role for A1AR in regulation of core body temperature (Tb), particularly hypothermia. Classic pharmacologic studies identified agonism at brain A1AR as able to cause hypothermia [13] and there is interest in using A1AR agonists for therapeutic hypothermia [14]. Selective agonist microinjections and other localization studies suggested a role in hypothermia for A1AR in multiple brain regions, including the POA [15-18]. However, we and others have determined that agonists selective for each of the four adenosine receptors can cause hypothermia [19-22]. Also, while a role for A1AR in torpor has been proposed [23, 24], neither A1AR nor any of the other ARs is required for torpor [21, 25]. Understanding the role of A1AR in temperature regulation is complicated by the very wide distribution of the A1AR throughout the brain [6, 26] and its presence in both neurons and glia [27]. The highest brain A1AR concentrations are in portions of the hippocampus, thalamus, and cerebral and cerebellar cortex. Interestingly, A1AR levels are much lower in the hypothalamus, including the POA [26]. Here we investigated where A1AR agonists might act to cause hypothermia.

Materials and methods

Mice

Mice at 3–12 months of age were housed at 21–22°C with a 12:12-h dark:light cycle (lights on at 0600) in a clean, conventional facility with paper bedding (7099-TEK-fresh, Envigo, Indianapolis, IN) and ad libitum access to water and chow (7022, 15% kcal fat, Envigo Inc, Madison, WI). Experiments were approved by the NIDDK Institutional Animal Care and Use Committee (protocol K016-DEOB-20). Mice were studied >7 days after any operation or prior treatment, and singly housed after telemeter implantation. Reuse of mice tends to reduce physical activity levels during drug testing, presumably due to acclimatization to handling. No specific effort was made to acclimatize mice in individual experiments. Mice were euthanized by exposure to carbon dioxide followed by cervical dislocation. Male C57BL/6J mice were purchased from Jackson Laboratories, Bar Harbor, ME (JAX; #000664). Ai6 mice carrying Cre-dependent fluorescent protein ZsGreen [28] were purchased from JAX (#007906). Male Adora1 mice on a C57BL/6J background were provided by Dr. Jurgen Schnermann, NIDDK [29] and genotyped as described [21]. Adora1 mice [30] were generously provided by Dr. Robert Greene, UTSW, and genotyped by PCR. Primers x692 (forward, 5'-CCACCATTATCTGGCTCCCAT) and x691 (reverse, 5'-GCTGAGTCACCACTGTCTTGT) produce 268-bp (wild-type allele) and 302-bp (flox allele) products. Primers x692 and x708 (reverse, 5'-GCTCCCCTGTCTGACTGAAG) produce a ~230-bp product from a deleted flox allele. Syn1-Cre mice expressing Cre in neurons [31] were purchased from JAX (#003966) and genotyped (~300 bp product) using primers x682 (forward, 5'-CTCAGCGCTGCCTCAGTCT) and x683 (reverse, 5'-GCATCGACCGGTAATGCA). Offspring (both sexes) of Adora1 x Adora1;Syn1-Cre/+ and Adora1 x Adora1;Syn1-Cre/+ matings were used for neuronal deletion experiments.

Generation of Adora1-Cre mice

The Adora1-Cre mouse was made in a B6D2F1/J founder at the NHLBI Transgenic Core using CRISPR/Cas9 to insert a T2A peptide sequence and Cre recombinase at the Adora1 stop codon. The T2A sequence adds EGRGSLLTCGDVEENPG to the C terminus of A1AR and a proline to the N terminus of Cre. It is expected that the two proteins are translated in a 1:1 ratio [32] and that the added T2A sequence may reduce A1AR function [33, 34]. The founder was bred to C57BL/6J once. Presence of Adora1-Cre (553 bp) vs wild type (318 bp) alleles was determined by PCR using primers x617 (common forward, 5'-AAGTTCCGGGTCACCTTTCT), cre1 (Cre reverse, 5'-CCTGTTTTGCACGTTCACCG), and x630 (Adora1 reverse, 5'- ACTCCAAACCTCCTCCAGGT). While homozygous Adora1-Cre mice are fertile and appear grossly normal, only heterozygous Adora1-Cre mice were used in this study. The Adora1-Cre mouse is available from the corresponding author.

Compounds

Compounds (source; vehicle) were obtained as follows: Cl-ENBA [(±)-5'-chloro-5'-deoxy-N-endo-norbornyladenosine, Tocris 3576; 10% DMSO], SPA [N-(p-sulfophenyl)adenosine, Sigma S198; saline], CNO (clozapine-N-oxide, Sigma C0832; saline).

Quantitative PCR and RT-PCR

DNA and RNA were extracted (Allprep DNA/RNA micro Kit, Qiagen, Germantown, MD) from whole brain, excluding cerebellum and brain stem. RNA was reverse transcribed (Transcriptor High Fidelity cDNA Synthesis Kit, Roche, Indianapolis, IN). DNA and cDNA were quantified (QuantStudio 7 Flex Real-Time PCR System, Applied Biosystems, Waltham, MA) using SYBR green. Adora1 mRNA primers were x711 (forward, 5'-CATTGGGCCACAGACCTACT) and x713 (reverse, 5'-TGTACCGGAGAGGGATCTTG), normalized to 18S RNA using primers x530 (forward, 5'-AGTCCCTGCCCTTTGTACACA), and x531 (reverse, 5'-CGATCCGAGGGCCTCACTA).

Telemetric monitoring of body temperature and activity

Core body temperature (Tb) and physical activity were continuously measured by telemetry, using G2 E-Mitters implanted intraperitoneally, ER4000 energizer/receivers, and VitalView software (v 5.0 Starr Life Sciences, Oakmont, PA), with data collected each minute [35].

Surgical procedures

Mice were anesthetized with ketamine/xylazine (80/10 mg/kg, i.p.) and placed in a stereotaxic instrument (Digital Just for Mouse Stereotaxic Instrument, Stoelting). Ophthalmic ointment (Puralube, Dechra) was applied. Post-surgery mice received subcutaneous sterile saline injections to prevent dehydration and an analgesic (buprenorphine; 0.1 mg/kg, i.p.). G2 E-Mitters were implanted intraperitoneally as described [35].

Central infusions

Sterile guide cannulas (5.25 mm, 26 gauge; Plastics One, Roanoke, VA) were unilaterally implanted into the lateral ventricle (coordinates relative to bregma: -0.34 mm anterior, 1.0 mm lateral, 1.7 mm ventral) and fixed with dental cement (Parkell, Edgewood, NY). Compounds in 5 μl were infused (0.5 μl/min) through a 33-gauge cannula protruding 0.5 mm past the tip of the guide cannula using PE-50 tubing fitted to a 5 μl syringe (Hamilton, Reno, NV) on a dual syringe pump (KD Scientific, Holliston, MA).

Virus injections

All injections (200 nl) were done with pulled-glass pipettes (pulled 20–40 μm tip diameter; 0.275 ID, 1 mm OD, Wilmad Lab Glass) at a visually controlled rate of 50 nl per min with an air pressure system regulator (Grass Technologies, Model S48 Stimulator). The pipette was kept in place for 5 min after injection. The viruses AAV8-hSyn-DIO-hM3Dq-mCherry (gift from B. Roth; Addgene viral prep # 44361-AAV8 [36]) and AAV8-hSyn-DIO-hM4Di-mCherry (gift from B. Roth; Addgene viral prep # 44362-AAV8 [36]) were injected bilaterally into the preoptic area (POA, coordinates relative to bregma: 0.35 mm anterior, ±0.3 mm lateral, -5.25 mm ventral) or dorsomedial hypothalamus (DMH, coordinates relative to bregma: 1.85 mm posterior, ±0.25 mm lateral, -5.2 mm ventral) of Adora1-Cre mice. This batch of AAV8-hSyn-DIO-hM4Di-mCherry was functional in other experiments in our lab that were not part of this project. The hM4Di-mCherry is a fusion protein, so if mCherry is expressed, then hM4Di is also expressed.

Chemogenetics experimental procedure

hM3Dq and hM4Di were activated by CNO (1 mg/kg, i.p.) or saline vehicle. After completion of all experiments, mice were anesthetized (chloral hydrate, 500 mg/kg, i.p.), perfused transcardially with 0.9% saline followed by 10% neutral buffered formalin, the brain was removed, and reporter expression was visualized by immunohistochemistry [33]. Mice without hM3Dq or hM4Di expression in the target area on at least one side were excluded from analysis.

Experimental design and statistical analysis

Drug treatments were typically administered in crossover design using randomized treatment order. Hypothermia was assessed as the mean Tb from 0 to 60 minutes after dosing. Hyperthermia was assessed from 60 to 120 minutes after dosing to exclude the handling-induced Tb increase. Physical activity was assessed as the mean from 10 to 60 (hypothermia experiments to avoid the first 10 min after handling) or 60 to 120 (hyperthermia experiments) minutes after dosing. In crossover experiments, paired t-tests were used to compare the within mouse effect of drug vs vehicle. Unpaired t-tests were used to compare the within mouse drug vs vehicle effect between genotypes. Statistical significance was defined as 2-tailed P <0.05. Data are presented as mean ±SEM. No statistical methods were used to pre-determine sample size. Data, keyed to each figure, are available in the S1 Data.

Image capture and processing

Images were captured using an Olympus BX61 motorized microscope with Olympus BX-UCB hardware (VS120 slide scanner) and processed (including contrast adjustments) using OlyVIA software (Olympus).

Results

No effect on baseline body temperature from neuronal loss of A1AR

To distinguish between adenosine action on glia [27] and neurons, we produced mice carrying both floxed Adora1 and Syn1-Cre to selectively ablate A1AR function in neurons. The effect of neuronal deletion was studied in pooled Adora1;Syn1-Cre and Adora1;Syn1-Cre mice (hereafter referred to collectively as Adora1;Syn1-Cre, where del indicates a germline-deleted allele). In whole brain, Syn1-Cre produced 45% deletion per flox allele (Fig 1A). Concomitantly, Syn1-Cre reduced Adora1 mRNA levels by 35% per flox allele (Fig 1B). Since Syn1-Cre is selectively expressed in differentiated neurons [31], these data are consistent with neuronal deletion of Adora1, with the remaining expression likely derived from non-Syn1-Cre-expressing (non-neuronal) cells.
Fig 1

Levels of Adora1 DNA and RNA in mouse brain.

(A) Adora1 DNA levels in brains from control (black, n = 3 del/flox and n = 3 flox/flox) and Syn1-Cre (red, n = 6 del/flox;Syn1-Cre) mice. The % intact is the % of the signal for two intact alleles, calculated assuming a level of 0% per deleted (del) allele and 50% per wild type or undeleted flox allele. The intact level of 27.6 ± 1.7% (different from 50% at P < 0.0001 by 1 sample t-test) in the del/flox;Syn1-Cre mice indicates 45% deletion of the flox alleles. (B) Adora1 RNA was measured in the same samples, assuming expression of 0% per del allele and 50% per wild type or undeleted flox allele. The RNA level of 32.6 ± 2.8% (different from 50% at P < 0.0001 by 1 sample t-test) in the del/flox;Syn1-Cre mice indicates 35% reduction per flox allele compared to wild type levels. DNA and RNA were extracted from one-half of the brain without cerebellum and brain stem and assayed as detailed in Methods. Data are mean ± SEM.

Levels of Adora1 DNA and RNA in mouse brain.

(A) Adora1 DNA levels in brains from control (black, n = 3 del/flox and n = 3 flox/flox) and Syn1-Cre (red, n = 6 del/flox;Syn1-Cre) mice. The % intact is the % of the signal for two intact alleles, calculated assuming a level of 0% per deleted (del) allele and 50% per wild type or undeleted flox allele. The intact level of 27.6 ± 1.7% (different from 50% at P < 0.0001 by 1 sample t-test) in the del/flox;Syn1-Cre mice indicates 45% deletion of the flox alleles. (B) Adora1 RNA was measured in the same samples, assuming expression of 0% per del allele and 50% per wild type or undeleted flox allele. The RNA level of 32.6 ± 2.8% (different from 50% at P < 0.0001 by 1 sample t-test) in the del/flox;Syn1-Cre mice indicates 35% reduction per flox allele compared to wild type levels. DNA and RNA were extracted from one-half of the brain without cerebellum and brain stem and assayed as detailed in Methods. Data are mean ± SEM. At baseline, there was no difference between control and Adora1;Syn1-Cre littermate mice, matched for sex, in body temperature (Tb) during light or dark phase, or in Tb variability (as Tb span, the difference between the 95th and 5th Tb percentiles). There was also no effect of neuronal deletion on the level of physical activity or its diurnal rhythm (Table 1).
Table 1

Deletion of neuronal A1AR has no effect on baseline body temperature or physical activity.

SexAdora1fl FemaleAdora1fl;Syn1-Cre FemalePAdora1fl MaleAdora1fl;Syn1-Cre MaleP
N4578
Tb, light phase (°C)36.17 ±0.0736.40 ±0.160.2735.67 ±0.1635.76 ±0.120.64
Tb, dark phase (°C)37.37 ±0.1737.39 ±0.160.9436.77 ±0.1336.93 ±0.050.25
ΔTb, dark-light (°C)1.21 ±0.100.99 ±0.250.501.10 ±0.101.17 ±0.110.64
Tb span (°C)2.58 ±0.152.09 ±0.450.382.28 ±0.082.49 ±0.140.23
Activity, light phase (counts)6.8 ±0.58.1 ±0.60.185.4 ±0.36.4 ±0.40.09
Activity, dark phase (counts)19.6 ±1.125.0 ±3.50.2314.5 ±1.015.5 ±1.10.51

Data collected from 5-month old mice over a continuous 96-hour interval. Tb span is the 95th minus the 5th percentiles. Data are mean ± SEM. P values are from unpaired t-tests comparing genotype within sex.

Data collected from 5-month old mice over a continuous 96-hour interval. Tb span is the 95th minus the 5th percentiles. Data are mean ± SEM. P values are from unpaired t-tests comparing genotype within sex.

A1AR agonist-induced hypothermia is mediated by both peripheral and central neurons

Cl-ENBA is a selective A1AR agonist. Peripherally-dosed Cl-ENBA (3 mg/kg, i.p.) caused robust hypothermia in Adora1 controls (-4.93 ± 0.17°C vs vehicle at 0 to 60 minutes) and Adora1;Syn1-Cre (-3.50 ± 0.53°C vs vehicle) mice (Fig 2A–2C). The hypothermia in Adora1;Syn1-Cre mice was attenuated compared to controls (P = 0.02). Since Cl-ENBA at high doses can also cause hypothermia via activation of mast cell A3AR [21], we tested a lower Cl-ENBA dose (1 mg/kg; -3.33 ± 0.50°C in controls vs. -1.83 ± 0.55°C in Adora1;Syn1-Cre mice; P = 0.06) (Fig 2D–2F). The similar level of partial loss of Cl-ENBA-induced hypothermia at the two doses suggests that i.p. Cl-ENBA is causing hypothermia partially through neuronal A1AR.
Fig 2

Neuronal A1AR partially mediate Cl-ENBA induced hypothermia.

(A-C) Core body temperature (Tb) and physical activity response to Cl-ENBA (3 mg/kg, i.p.) or vehicle in Adora1 (n = 10) and Adora1;Syn1-Cre (n = 11) mice. (D-F) Tb and physical activity response to Cl-ENBA (1 mg/kg, i.p.) or vehicle in Adora1(n = 8) and Adora1;Syn1-Cre (n = 9) mice. Data are mean ± SEM (SEM is omitted for visual clarity in A and D). P values calculated by paired t-test comparing drug vs vehicle within mouse.

Neuronal A1AR partially mediate Cl-ENBA induced hypothermia.

(A-C) Core body temperature (Tb) and physical activity response to Cl-ENBA (3 mg/kg, i.p.) or vehicle in Adora1 (n = 10) and Adora1;Syn1-Cre (n = 11) mice. (D-F) Tb and physical activity response to Cl-ENBA (1 mg/kg, i.p.) or vehicle in Adora1(n = 8) and Adora1;Syn1-Cre (n = 9) mice. Data are mean ± SEM (SEM is omitted for visual clarity in A and D). P values calculated by paired t-test comparing drug vs vehicle within mouse. SPA is a non-brain penetrant selective A1AR agonist [37]. Peripherally dosed SPA (1 mg/kg, i.p.) caused hypothermia in wild-type mice that was lost in Adora1 mice (Fig 3A–3C). In Adora1;Syn1-Cre mice, SPA-induced hypothermia was greatly diminished and not statistically different from vehicle treatment (Fig 3D–3F). These results suggest that hypothermia can be elicited via A1AR expressed by neurons that are outside the blood-brain barrier.
Fig 3

SPA-induced hypothermia is lost in global Adora1 and attenuated in Adora1;Syn1-Cre mice.

(A-C) Tb and physical activity response to SPA (1 mg/kg, i.p.) in control (n = 6) and Adora1 (n = 4) mice. (D-F) Tb and physical activity response to SPA (1 mg/kg, i.p.) in Adora1 (control, n = 9) and Adora1;Syn1-Cre (Syn1-Cre, n = 7) mice. Data are mean ± SEM (SEM is omitted for visual clarity in A and D). P values were calculated by paired t-test comparing drug vs vehicle within mouse.

SPA-induced hypothermia is lost in global Adora1 and attenuated in Adora1;Syn1-Cre mice.

(A-C) Tb and physical activity response to SPA (1 mg/kg, i.p.) in control (n = 6) and Adora1 (n = 4) mice. (D-F) Tb and physical activity response to SPA (1 mg/kg, i.p.) in Adora1 (control, n = 9) and Adora1;Syn1-Cre (Syn1-Cre, n = 7) mice. Data are mean ± SEM (SEM is omitted for visual clarity in A and D). P values were calculated by paired t-test comparing drug vs vehicle within mouse. We next tested the ability of a low i.c.v. dose of A1AR agonist to produce hypothermia. Central administration of Cl-ENBA (3.06 μg/mouse; ~0.1 mg/kg) caused hypothermia in control but not Adora1;Syn1-Cre mice (-2.30 ± 0.43°C vs -0.23 ± 0.17°C; P = 0.001) (Fig 4A–4C). This demonstrates that A1AR agonists can cause hypothermia by acting directly on brain neurons.
Fig 4

Central administration of Cl-ENBA does not cause hypothermia in Adora1;Syn1-Cre mice.

(A-C) Tb and physical activity response to Cl-ENBA (3.06 μg/mouse, i.c.v.) or vehicle in Adora1 (control, n = 6) and Adora1;Syn1-Cre (Syn1-Cre, n = 6) mice. Data are mean ± SEM (SEM is omitted for visual clarity in A). P values were calculated by paired t-test comparing drug vs vehicle within mouse.

Central administration of Cl-ENBA does not cause hypothermia in Adora1;Syn1-Cre mice.

(A-C) Tb and physical activity response to Cl-ENBA (3.06 μg/mouse, i.c.v.) or vehicle in Adora1 (control, n = 6) and Adora1;Syn1-Cre (Syn1-Cre, n = 6) mice. Data are mean ± SEM (SEM is omitted for visual clarity in A). P values were calculated by paired t-test comparing drug vs vehicle within mouse.

Activation of Adora1-Cre-expressing neurons in the dorsomedial hypothalamus increased body temperature

Since A1AR is widely distributed in the brain, we wished to probe specific regions for their potential role in driving A1AR agonist-induced hypothermia. Adora1-Cre mice were produced by targeted insertion of a Cre recombinase gene into the endogenous Adora1 locus, preserving the coding region (Methods, Fig 5A). The mice were bred with reporter mice expressing GFP in a Cre-dependent manner. The resulting GFP expression was widespread and particularly high in the cortex, hippocampus, and thalamus (Fig 5B). This GFP reporter expression pattern matches that reported for A1AR ligand binding activity [26].
Fig 5

Expression pattern of Adora1-Cre in mouse brain.

(A) Schematic representation of the Adora1-Cre allele, showing the Adora1coding region in black, T2A peptide in gray, and Cre recombinase in orange. Primers for PCR-based genotyping are also indicated. Not to scale. (B) Representative brain sections showing Cre-dependent GFP expression in Adora1-Cre;Ai6 mouse brain. Scale bar is 1 mm. Inset scale bar is 200 μm. MnPO, median preoptic nucleus; MPA, medial preoptic area; VMPO, ventromedial preoptic area; DHA, dorsal hypothalamic area; dDMH, dorsal part of dorsomedial hypothalamus; vDMH, ventral part of dorsomedial hypothalamus; VMH, ventromedial hypothalamus.

Expression pattern of Adora1-Cre in mouse brain.

(A) Schematic representation of the Adora1-Cre allele, showing the Adora1coding region in black, T2A peptide in gray, and Cre recombinase in orange. Primers for PCR-based genotyping are also indicated. Not to scale. (B) Representative brain sections showing Cre-dependent GFP expression in Adora1-Cre;Ai6 mouse brain. Scale bar is 1 mm. Inset scale bar is 200 μm. MnPO, median preoptic nucleus; MPA, medial preoptic area; VMPO, ventromedial preoptic area; DHA, dorsal hypothalamic area; dDMH, dorsal part of dorsomedial hypothalamus; vDMH, ventral part of dorsomedial hypothalamus; VMH, ventromedial hypothalamus. The preoptic area (POA) is a region of the brain with major control over Tb; other areas also contribute [38]. Local injection of A1AR agonist has been shown to produce hypothermia in hypothalamic sites, including POA and dorsomedial hypothalamus (DMH) [16], so we focused on these regions. A1AR is coupled to Gi/o, therefore we used chemogenetics to selectively target Adora1-Cre neurons with viral expression of a Gi-coupled designer receptor exclusively activated by designer drug (DREADD), hM4Di, to mimic the endogenous inhibitory A1AR signaling. Mice with virally-delivered hM4Di in the POA were treated with DREADD agonist, clozapine-N-oxide (CNO), or vehicle. No effect of CNO on Tb was observed (Fig 6A–6C). All mice had at least unilateral virus expression in the medial preoptic area, and some mice had virus expression also in the medial septal nuclei and/or diagonal band of Broca. Thus, agonism of an inhibitory DREADD in POAAdora1 neurons did not cause hypothermia.
Fig 6

Chemogenetic inhibition of POAAdora1 neurons has no effect on Tb.

(A) Example of hM4Di-mCherry expression in Adora1-Cre mouse injected with AAV8-hSyn-DIO-hM4Di-mCherry in the POA. Scale bar is 500 μm. (B) Tb response to CNO (1 mg/kg, i.p.) vs. vehicle in Adora1-Cre mice with hM4Di-mCherry in POA (n = 7). (C) Mean Tb at 0 to 60 minutes after dosing. Data are mean ± SEM (SEM is omitted for visual clarity in B). P value was calculated by paired t-test comparing drug vs vehicle within mouse. Aca, anterior commissure; MnPO, median preoptic area; MPA, medial preoptic area; VMPO, ventromedial preoptic area.

Chemogenetic inhibition of POAAdora1 neurons has no effect on Tb.

(A) Example of hM4Di-mCherry expression in Adora1-Cre mouse injected with AAV8-hSyn-DIO-hM4Di-mCherry in the POA. Scale bar is 500 μm. (B) Tb response to CNO (1 mg/kg, i.p.) vs. vehicle in Adora1-Cre mice with hM4Di-mCherry in POA (n = 7). (C) Mean Tb at 0 to 60 minutes after dosing. Data are mean ± SEM (SEM is omitted for visual clarity in B). P value was calculated by paired t-test comparing drug vs vehicle within mouse. Aca, anterior commissure; MnPO, median preoptic area; MPA, medial preoptic area; VMPO, ventromedial preoptic area. We next tested activation of an excitatory Gq-coupled DREADD, hM3Dq, in Adora1-Cre-expressing cells. As endogenous A1AR signaling is inhibitory, an increase in Tb due to chemogenetic activation of stimulatory Gq would be a concordant observation. Activation of POAAdora1 neurons with CNO had no effect on Tb (Fig 7A–7C). All mice had unilateral or bilateral virus expression in the medial preoptic area, with virus expression in varying extent throughout the anterior hypothalamus. In contrast, activation of DMHAdora1 neurons expressing hM3Dq with CNO increased Tb (Fig 7D–7F). All mice had unilateral or bilateral virus expression restricted to the DMH/dorsal hypothalamic area. Thus, the DMH is a potential candidate region for neurons driving A1AR agonist-induced hypothermia.
Fig 7

Chemogenetic activation of DMHAdora1, but not POAAdora1 neurons increases Tb.

A-C tests activation of the POA. (A) Example of hM3Dq-mCherry expression in Adora1-Cre mouse injected with AAV8-hSyn-DIO-hM3Dq-mCherry in the POA. (B) Tb response to CNO (1 mg/kg, i.p.) vs. vehicle in Adora1-Cre mice with hM3Dq-mCherry in POA (n = 11). (C) Mean Tb at 60 to 120 minutes after dosing with CNO (1 mg/kg, i.p.) vs. vehicle. D-F tests activation of the DMH. (D) Example of hM3Dq-mCherry expression in Adora1-Cre mouse injected with AAV8-hSyn-DIO-hM3Dq-mCherry in the DMH. (E) Tb response to CNO (1 mg/kg, i.p.) vs. vehicle in Adora1-Cre mice with hM3Dq-mCherry in DMH (n = 8). (F) Mean Tb at 60 to 120 minutes after dosing with CNO (1 mg/kg, i.p.) vs. vehicle (n = 8). Data are mean ± SEM (SEM is omitted for visual clarity in B and E). P values were calculated by paired t-test comparing drug vs vehicle within mouse. Scale bar is 500 μm. aca, anterior commissure; dDMH, dorsomedial hypothalamus, dorsal part; DHA, dorsal hypothalamic area; MnPO, median preoptic area; MPA, medial preoptic area; vDMH, dorsomedial hypothalamus, ventral part; VMPO, ventromedial preoptic area; VLPO, ventrolateral preoptic area.

Chemogenetic activation of DMHAdora1, but not POAAdora1 neurons increases Tb.

A-C tests activation of the POA. (A) Example of hM3Dq-mCherry expression in Adora1-Cre mouse injected with AAV8-hSyn-DIO-hM3Dq-mCherry in the POA. (B) Tb response to CNO (1 mg/kg, i.p.) vs. vehicle in Adora1-Cre mice with hM3Dq-mCherry in POA (n = 11). (C) Mean Tb at 60 to 120 minutes after dosing with CNO (1 mg/kg, i.p.) vs. vehicle. D-F tests activation of the DMH. (D) Example of hM3Dq-mCherry expression in Adora1-Cre mouse injected with AAV8-hSyn-DIO-hM3Dq-mCherry in the DMH. (E) Tb response to CNO (1 mg/kg, i.p.) vs. vehicle in Adora1-Cre mice with hM3Dq-mCherry in DMH (n = 8). (F) Mean Tb at 60 to 120 minutes after dosing with CNO (1 mg/kg, i.p.) vs. vehicle (n = 8). Data are mean ± SEM (SEM is omitted for visual clarity in B and E). P values were calculated by paired t-test comparing drug vs vehicle within mouse. Scale bar is 500 μm. aca, anterior commissure; dDMH, dorsomedial hypothalamus, dorsal part; DHA, dorsal hypothalamic area; MnPO, median preoptic area; MPA, medial preoptic area; vDMH, dorsomedial hypothalamus, ventral part; VMPO, ventromedial preoptic area; VLPO, ventrolateral preoptic area.

Discussion

The brain controls Tb. Thus, we had anticipated identifying an A1AR-expressing neuron population, possibly in the POA, as the driver of A1AR agonist-induced hypothermia. However, our results suggest that A1AR agonism can cause hypothermia acting at neuronal A1AR both inside and outside the brain, demonstrating that adenosine can cause hypothermia via more than one A1AR neuronal mechanism.

Central mechanisms of A1AR hypothermia

While A1AR is found in microglia, oligodendrocytes, astrocytes, and neurons [39], the loss-of-function experiments demonstrate that neurons (Syn1-Cre-positive cells) are required for hypothermia caused by central administration of an A1AR agonist. Activation of different defined populations of POA neurons can increase or decrease Tb [12, 40–44]. In addition, local A1AR agonist administration to this region causes hypothermia [16]. Thus, we had expected that chemogenetic inhibition or activation of POAAdora1 neurons would affect Tb, but this was not observed. The effect on Tb from stimulation of POAAdora1 neurons may be more variable than in controls, suggesting that there may be multiple POAAdora1 neuron populations with differing effects on Tb. Chemogenetic activation of Adora1-Cre-expressing neurons of the DMH, another known thermoregulatory center, uniformly increased Tb, consistent with reports that disinhibition and activation of DMH neurons increase Tb [33, 40, 45]. One interpretation of our results is that DMHAdora1 neurons are driving A1AR agonist-induced hypothermia, as activation of these neurons (opposing the inhibitory signaling from endogenous A1AR activation) increased Tb. Another interpretation is that the chemogenetically manipulated neurons have a role in thermoregulation, but this is not directly related to pharmacologic A1AR agonist-induced hypothermia. Our results do not rule out the possibility of a single, specific nucleus mediating central A1AR hypothermia. However, with widespread expression throughout the brain, we hypothesize that expression of A1AR may not identify a discrete neuronal population that drives hypothermia. Rather, adenosine acting on A1AR may be a general mechanism to reduce local neuronal activity, with the effect on Tb depending on the particular neuronal subpopulation’s direct or indirect contributions to thermoregulation.

Peripheral mechanisms of A1AR hypothermia

Our results indicate A1AR agonist-induced hypothermia can be caused by neuronal A1AR outside the central nervous system. The hypothermic effect of the non-brain penetrant, peripherally-restricted A1AR agonist SPA was lost in Adora1;Syn1-Cre mice, indicating that peripheral A1AR agonist-induced hypothermia is mediated by cells expressing synapsin-1 (i.e. peripheral nerves). A1AR is found throughout the peripheral nervous system (PNS): in motor and sensory nerve terminals of rats, as well as sympathetic and parasympathetic nerves [46-49]. Like central A1AR, PNS A1AR play a role in regulating numerous physiological processes (nociception, vascular tone, etc.) by providing an inhibitory tone on neurotransmission. Therefore, the effect of PNS A1AR agonism on Tb depends on the function of the peripheral neuron being inhibited. A1AR is present in many non-neuronal cells (smooth muscle, epithelial, immune cells) and tissues (heart, adipose tissue, pancreas, kidney) that have a very wide variety of functions (reviewed in [1]). Agonism of non-neural A1AR can produce physiologic effects such as hypotension that could secondarily decrease Tb. The lack of significant hypothermia produced by the peripheral A1AR agonist SPA in Adora1;Syn1-Cre mice suggests that while non-neuronal cells may contribute, neuronal A1AR are required for hypothermia by this mechanism. Further research will be needed to identify the specific neuronal populations involved.

Adenosine as a physiologic and general danger signal

Adenosine can act at each of the four adenosine receptors to cause hypothermia. Activation of A3AR on peripheral mast cells causes hypothermia via histamine release, followed by activation of H1 receptors [22, 50, 51]. Agonism at peripheral A2AAR or central A2BAR both cause hypothermia [20, 52]. However, the specific cells that elicit hypothermia when directly activated by A2AAR and A2BAR agonists have not been identified. Including A1AR on central and on peripheral neurons, there are five identified paths by which adenosine agonism elicits hypothermia. When hypothermia is studied in sufficient detail, it is accompanied by hypometabolism, decreased physical activity, and hypotension. While hypometabolism is likely required to achieve hypothermia, different driving physiology (eg., hypotension vs torpor) can produce hypothermia. Adenosine is a ubiquitous molecule that acts locally to signal metabolic stress or injury. The distinct mechanism(s) by which activation of each AR causes hypothermia suggests that adenosine signaling is harnessed to minimize damage, regardless if the signaling occurs centrally or peripherally. Hypothermia can be due to direct adenosine agonism on thermoregulatory neurons, or a secondary effect of other adenosine-driven physiology. Taken with previous studies, these results demonstrate that at least five distinct mechanisms of hypothermia mediated by adenosine receptors exist. The redundancy in AR signaling highlights the importance of hypothermia as a component of protective response mechanisms. (XLSX) Click here for additional data file. 28 Oct 2020 PONE-D-20-31332 Activation of neuronal adenosine A1 receptors causes hypothermia through central and peripheral mechanisms PLOS ONE Dear Dr. Reitman, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, I feel that this submission has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, I wouwld invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please see the attached comments from review below. In particular, I would like you to improve the introduction for clarity and to address the concerns about the missing positive control for the experiment shown in Figure 6. Please submit your revised manuscript by Dec 12 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Edward E Schmidt Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. To comply with PLOS ONE submissions requirements, please provide methods of sacrifice in the Methods section of your manuscript. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Major points: This article explores the relationship between an adenosine receptor (A1AR), regions of the brain and hypothermia. Overall, the article would be much stronger and would benefit from more in-depth explanation on what the target of the study is. The last line of the introduction (line 75) indicates that the study will be looking at where A1AR agonist will act to cause hypothermia, and this is assuming the authors mean where in the brain, but there is not enough introduction about what is known currently about A1AR/hypothermia/brain localization in the intro. Where is A1AR localized in the brain? What regions are believed to control hypothermia and which have not been explored? As the authors noted, other studies have also “suggested a role in hypothermia for A1AR in the preoptic area and other brain regions”, so what is unique about this study? Intro - It should be clarified that the Adora1 locust encodes the protein of interest, A1AR. Figure 1 – Significance of the data should be noted with p values Line 239 – “Since A1AR are widely” change are to “is” Figure 3, a new abbreviation (A1KO) is used, but this is not discussed in the rest of the paper or defined. Authors should add definition or use Adora-/- or Adorafl as in the rest of the paper. Line 229 – consider rephrasing “A1AR agonist-induced hypothermia is also caused by acting on brain neurons.” It is unclear in the currently written form Figure 5 – This figure would benefit from labeling of different brain regions, as in the other figures, especially the noted cortex, hippocampus, and thalamus Figure 6 – A positive control demonstrating that the AAV8-hSyn-DIO-hM4Di-mCherry does cause hypothermia in other areas of the brain would be beneficial. Alternatively, some evidence that the hM4Di inhibitor is actually being expressed in addition to the mCherry would be beneficial. It is impossible to know if the hM4Di didn’t cause hypothermia in the POA or if the hM4Di segment is inactive. Also, some explanation of the uneven distribution of mCherry in Figure 6A would be beneficial. Is the VMPO special for some reason that it has a lot of AAV8-hSyn-DIO-hM4Di-mCherry present? Figure 7 – Comparison of Fig7B and 7E would be easier with a clear title or label of the variable that is changed (testing activation in the POA vs DMH). Lines 276 and 279 – the wording “at least unilateral” should be changed to just “unilateral”, there’s nothing more than unilateral. Line 280 – The authors should clarify that while they induced hyperthermia, it is not necessarily given that the same region and neuron subpopulation would control hypothermia. Figure 7B – Fix “CNO” in legend ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 25 Nov 2020 please see uploaded file Submitted filename: PONE response to reviews v4.docx Click here for additional data file. 30 Nov 2020 PONE-D-20-31332R1 Activation of neuronal adenosine A1 receptors causes hypothermia through central and peripheral mechanisms PLOS ONE Dear Dr. Reitman, Thank you for submitting your manuscript to PLOS ONE. After careful review of your resubmission, I am satisfied with your responses to the review, but I see that you have not included a statement in the text about public availability of the mouse models used in this study. I presume that the null and floxed alleles of Adora1 that you used can be obtained by contacting Drs. Schnermann and Greene, respectively, via the information given on the manuscripts you have cited for these models. Can you please revise the manuscript, however, to instruct readers how they can obtain the ADAR1Cre mouse line that you developed in this study?  Thank you! Please submit your revised manuscript by Jan 14 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s) my request. You should upload this letter as a separate file labeled 'Response to Reviewers' Editor's request. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, I recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols I look forward to receiving your revised manuscript. Kind regards, Edward E Schmidt Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 30 Nov 2020 From the Editor: “I see that you have not included a statement in the text about public availability of the mouse models used in this study. I presume that the null and floxed alleles of Adora1 that you used can be obtained by contacting Drs. Schnermann and Greene, respectively, via the information given on the manuscripts you have cited for these models. Can you please revise the manuscript, however, to instruct readers how they can obtain the ADAR1Cre mouse line that you developed in this study?” Indeed, the null and floxed alleles of Adora1 can be obtained by contacting Drs. Schnermann and Greene, respectively. We have added a sentence (line 104) “The Adora1-Cre mouse is available from the corresponding author.” With acceptance of the manuscript, we will deposit the mouse in a repository. Submitted filename: response to editor 2020.11.30.docx Click here for additional data file. 2 Dec 2020 Activation of neuronal adenosine A1 receptors causes hypothermia through central and peripheral mechanisms PONE-D-20-31332R2 Dear Dr. Reitman, Thank you for your rapid revision in response to my request.  I am pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Edward E Schmidt Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 7 Dec 2020 PONE-D-20-31332R2 Activation of neuronal adenosine A1 receptors causes hypothermia through central and peripheral mechanisms Dear Dr. Reitman: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Edward E Schmidt Academic Editor PLOS ONE
  52 in total

Review 1.  International Union of Basic and Clinical Pharmacology. LXXXI. Nomenclature and classification of adenosine receptors--an update.

Authors:  Bertil B Fredholm; Adriaan P IJzerman; Kenneth A Jacobson; Joel Linden; Christa E Müller
Journal:  Pharmacol Rev       Date:  2011-02-08       Impact factor: 25.468

2.  Biphasic effect of melanocortin agonists on metabolic rate and body temperature.

Authors:  Beth Lute; William Jou; Dalya M Lateef; Margalit Goldgof; Cuiying Xiao; Ramón A Piñol; Alexxai V Kravitz; Nicole R Miller; Yuning George Huang; Clemence Girardet; Andrew A Butler; Oksana Gavrilova; Marc L Reitman
Journal:  Cell Metab       Date:  2014-06-26       Impact factor: 27.287

3.  Profound hypothermia after adenosine kinase inhibition in A1AR-deficient mice suggests a receptor-independent effect of intracellular adenosine.

Authors:  Christoph Eisner; SooMi Kim; Alexandra Grill; Yan Qin; Marion Hoerl; Josephine Briggs; Hayo Castrop; Manfred Thiel; Jurgen Schnermann
Journal:  Pflugers Arch       Date:  2016-12-14       Impact factor: 3.657

4.  Hyperalgesia, anxiety, and decreased hypoxic neuroprotection in mice lacking the adenosine A1 receptor.

Authors:  B Johansson; L Halldner; T V Dunwiddie; S A Masino; W Poelchen; L Giménez-Llort; R M Escorihuela; A Fernández-Teruel; Z Wiesenfeld-Hallin; X J Xu; A Hårdemark; C Betsholtz; E Herlenius; B B Fredholm
Journal:  Proc Natl Acad Sci U S A       Date:  2001-07-24       Impact factor: 11.205

5.  Central activation of the A1 adenosine receptor (A1AR) induces a hypothermic, torpor-like state in the rat.

Authors:  Domenico Tupone; Christopher J Madden; Shaun F Morrison
Journal:  J Neurosci       Date:  2013-09-04       Impact factor: 6.167

6.  Disruption of the A(3) adenosine receptor gene in mice and its effect on stimulated inflammatory cells.

Authors:  C A Salvatore; S L Tilley; A M Latour; D S Fletcher; B H Koller; M A Jacobson
Journal:  J Biol Chem       Date:  2000-02-11       Impact factor: 5.157

7.  Seasonal decrease in thermogenesis and increase in vasoconstriction explain seasonal response to N6 -cyclohexyladenosine-induced hibernation in the Arctic ground squirrel (Urocitellus parryii).

Authors:  Carla Frare; Mackenzie E Jenkins; Kelsey M McClure; Kelly L Drew
Journal:  J Neurochem       Date:  2019-08-29       Impact factor: 5.372

8.  Central adenosine receptor signaling is necessary for daily torpor in mice.

Authors:  Benjamin W Iliff; Steven J Swoap
Journal:  Am J Physiol Regul Integr Comp Physiol       Date:  2012-07-11       Impact factor: 3.619

9.  Impaired function of prejunctional adenosine A1 receptors expressed by perivascular sympathetic nerves in DOCA-salt hypertensive rats.

Authors:  Sutheera Sangsiri; Hua Dong; Gregory M Swain; James J Galligan; Hui Xu
Journal:  J Pharmacol Exp Ther       Date:  2013-02-08       Impact factor: 4.030

10.  Brs3 neurons in the mouse dorsomedial hypothalamus regulate body temperature, energy expenditure, and heart rate, but not food intake.

Authors:  Ramón A Piñol; Sebastian H Zahler; Chia Li; Atreyi Saha; Brandon K Tan; Vojtěch Škop; Oksana Gavrilova; Cuiying Xiao; Michael J Krashes; Marc L Reitman
Journal:  Nat Neurosci       Date:  2018-10-22       Impact factor: 24.884

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.