The development of a novel diagnostic PCR for Madurella mycetomatis using a comparative genome approach.

BACKGROUND: Eumycetoma is a neglected tropical disease most commonly caused by the fungus Madurella mycetomatis. Identification of eumycetoma causative agents can only be reliably performed by molecular identification, most commonly by species-specific PCR. The current M. mycetomatis specific PCR primers were recently discovered to cross-react with Madurella pseudomycetomatis. Here, we used a comparative genome approach to develop a new M. mycetomatis specific PCR for species identification.
METHODOLOGY: Predicted-protein coding sequences unique to M. mycetomatis were first identified in BLASTCLUST based on E-value, size and presence of orthologues. Primers were then developed for 16 unique sequences and evaluated against 60 M. mycetomatis isolates and other eumycetoma causing agents including the Madurella sibling species. Out of the 16, only one was found to be specific to M. mycetomatis.
CONCLUSION: We have discovered a predicted-protein coding sequence unique to M. mycetomatis and have developed a new species-specific PCR to be used as a novel diagnostic marker for M. mycetomatis.

Introduction

The neglected tropical disease mycetoma presents itself as a subcutaneous chronic granulomatous inflammatory disease and is characterized by tumorous lesions and grain formation [1,2]. This disease can be caused by more than 70 different micro-organisms and is categorized into actinomycetoma (caused by bacteria) and eumycetoma (caused by fungi). Treatment is dependent on the causative agent.

Diagnosis of mycetoma is often only made clinically in endemic areas due to the scarcity of facilities, expertise and financial capacity. Eumycetoma and actinomycetoma can be easily distinguished from each other by the texture and colour of the grains. However, species identification based on the texture and colour of the grain is not possible as many fungal species can produce similar-looking black-grains. Therefore, identification of causative agents is usually done by histopathological examination and culturing of grains. Unfortunately, that often leads to misidentifications [3]. Currently, molecular identification is the most reliable method to identify eumycetoma causative agents down to the species level and the most commonly used technique is amplifying the Internally Transcribed Spacer (ITS) region and sequencing [4]. However, many endemic areas lack the ability to perform DNA sequencing.

In 1999, a species-specific PCR primer based on the internal transcribed spacer (ITS) was developed for Madurella mycetomatis, the most common causative agent of mycetoma [5]. This PCR is currently used at the Mycetoma Reference Center in Khartoum, Sudan. It is performed on DNA obtained from cultured clinical material or directly from grains obtained from patients. Unfortunately, this M. mycetomatis specific PCR primer pair 26.1a and 28.3a was only recently discovered to cross-react with Madurella pseudomycetomatis [6]. Madurella pseudomycetomatis was not yet described at the time when the M. mycetomatis specific PCR was developed [7]. All four Madurella species (Madurella fahalii, Madurella tropicana, M. mycetomatis and M. pseudomycetomatis) are known to cause black grain eumycetoma and have different susceptibilities to antifungal agents. For instance, M. fahalii is not inhibited by itraconazole in vitro, which could have consequences for treatment strategy [8]. This makes identification of causative agents to the species level a must. Since all four Madurella species share a very conserved ITS region, this has made designing PCR primers specific for M. mycetomatis based on that region difficult [8,9]. To circumvent this difficulty, we took a comparative genome approach to design a new set of specific primers for the identification of M. mycetomatis by PCR.

Here, we report a new set of diagnostic DNA primers for M. mycetomatis identified from the genome of M. mycetomatis [10].

Materials and methods

Ethics statement

This study was approved by the Mycetoma Research Center, Khartoum, Sudan (IRB, No. 11/2018). Written informed consent was obtained from each adult patient, and assent was taken from minors (aged below 18 years) with written consent from their guardian.

Fungal isolates, patient grains and DNA isolation

A total of 95 fungal isolates were used in this study; 60 M. mycetomatis, 4 M. tropicana, 3 M. fahalii, 3 M. pseudomycetomatis, 1 Aspergillus fumigatus, 1 Aspergillus terreus, 2 Chaetomium globosum, 4 Falciformispora senegalensis, 1 Fusarium solani, 3 Medicopsis romeroi, 2 Scedosporium apiospermum, 3 Thielavia terrestris, 3 Thielavia subthermophilia, 4 Trematospheria grisea and 1 Trichophyton rubrum. Most fungal isolates were obtained from both the Mycetoma Research Center in Sudan and the Westerdijk Fungal Biodiversity Institute in the Netherlands and maintained in Erasmus Medical Centre. All M. mycetomatis isolates originated from mycetoma patients. Isolates are maintained on Sabouraud Dextrose (SAB) agar at either 37°C or room temperature depending on the fungal species. Black grains were obtained from a total of 16 eumycetoma infected patients seen at the Mycetoma Research Center in Sudan. Nine patients were confirmed to be infected with M. mycetomatis, four with F. senegalensis, and three with F. tompkinsii. DNA from fungal isolates and grains were isolated as described earlier using the ZR Fungal/Bacterial DNA MicroPrep kit (Zymo Research, USA) [11]. All isolates were identified to the species level based on morphology, polymerase chain reaction (PCR)-based restriction fragment length polymorphisms, and sequencing of the ITS regions [5,12,13].

Identifying specific predicted protein-coding sequences to M. mycetomatis

Predicted protein-coding sequences (PPCS) of M. mycetomatis were obtained from the published genome sequence of M. mycetomatis isolate mm55, accession number LCTW00000000, BioProject PRJNA267680 [10]. To determine their specificity to M. mycetomatis, a bioinformatical comparison of these sequences to the genome of other organisms was performed using BLASTCLUST [14]. The specificity of these PPCS were determined based on presence of orthologues, E-value and fragment size. Orthologues were defined as sequences with greater than 85% amino acid similarity to the tested M. mycetomatis PPCS. M. mycetomatis PPCS with no orthologues present in the genomes of other organisms, E- value of 0.003 and higher and size between 400 bp and 1100 bp were considered to be specific to M. mycetomatis and were chosen for further analysis.

Primer design and PCR conditions

Forward and reverse PCR primers were designed according to the nucleotide sequence of the PPCS of interest. Primer sequences are depicted in Table 1. PCR reaction contained 0.6 units of Super Taq HC DNA polymerase (Sphaero Q), 0.1 nM/μl DNTP (Thermo Fisher Scientific) and 0.5 pmol/μl of each forward and reverse primer. PCR conditions were as follows: initial denaturation at 94°C for 10 min; 40 cycles of amplification with various annealing temperatures (95°C for 1 minute, 55–59°C for 1 minute, and 72°C for 1 minute); and a final extension step of 10 seconds at 72°C. The PCR reaction products were visualized in 2% agarose gel (Sphaero Q).

Table 1

The sixteen predicted protein sequences with their corresponding size, primer sequences and annealing temperatures.

Primer set	Sequence length (bp)	E value	Primers (5'-3')		Annealing temperature °C
1	972	740	F	ATGCCTGCCCGGTCAGTTCG	55
			R	CTAGTACATGCCCACAACCG
2	832	96	F	ATGCGCTTTCTCTCCCTTAC	55
			R	TCAGCACTCCCTGATCAACC
3	808	35	F	ATGCTGCTCGAAAGGGTGTC	55
			R	TCAACCCCGCCCCGTACCCG
4	639	0.006	F	ATGCACTTCTTCAACACTGT	55
			R	CTAGACGGAGACACCTAGGG
5	636	1.3	F	ATGAAGCTCACTGTCTCCCT	55
			R	TCAAAGAACAAAAGAGGCAG
6	621	1.9	F	ATGAAGTACTCTAGCACTCT	55
			R	TTAGGCCGCCTGGGTGGCCG
7	564	-	F	ATGAAGCTCATCTCCATCGT	55
			R	TCACAAGAGGTACACAACAG
8	561	0.28	F	ATGCAGCTCTCGATCGCCAA	55
			R	TTAAAGCAACATAGCCGCGT
9	677	2.1	F	ATGGATCGCCTCGTCAAACC	55
			R	CTAAGTCAACAGAACGACAG
10	639	2.5	F	ATGAGGTGGCTCGAGACGAC	55
			R	CTATGGTTGTCCACACCCAT
Mmy-FwMmy-Rv	474	20	F	TCTCCTGTCCTACGACATCTGTGG	59
			R	TTCCTCACCTCCCAGCCCTTT
12	1089	0.007	F	ATGGTGGAGCAGCTCTTGGT	55
			R	TCAAGGAATCGTTCTCGTAA
13	852	22	F	ATGCATCAACGACATCTTGC	55
			R	CTAGAATTCCTGACGAGAAA
14	504	42	F	ATGAAATTCACGGACTCTGG	55
			R	CTACATCAGCGGGCACTCCT
15	544	5.8	F	ATGACAATCACAATCACAAT	55
			R	AAGCTGGCCCCCGATCACAG
16	544	0.91	F	AGTAATCTAGTCACAATGGC	55
			R	TCAACCCGTGAAAATATTGC
*26.1A*28.3A	420	-	F	AATGAGTTGGGCTTTAACGG	58
			R	TCCCGGTAGTGTAGTGTCCCT
*26.1B*28.3B	360	-	F	GCAACACGCCCTGGGCGA	58
			R	TCCGCGGGGCGTCCGCCGGA

*M. mycetomatis specific primers designed in 1999 [5].

Results and discussion

Since we have demonstrated that the currently used M. mycetomatis specific PCR cross-reacted with M. pseudomycetomatis, there was a need to develop a new M. mycetomatis specific PCR for proper species identification. From the genome of M. mycetomatis, 350 predicted protein-coding sequences (PPCS) were randomly selected and analysed. We chose to analyse PPCS because these protein-coding sequences are likely to be more stable than non-coding sequences [15,16]. To ensure that they can be easily amplified through PCR, we preferentially chose PPCS with sizes between 400 and 1100 bp. From the initial 350 PPCS, the top 16 candidates that fitted our requirement based on specificity and size were chosen for PCR development.

PCR primers for the 16 candidates were then designed (Table 1). To ascertain that these primers would amplify their targets in all M. mycetomatis isolates, they were evaluated in 60 M. mycetomatis isolates from different geographical origins, genotypic backgrounds and phenotypic appearance. Out of the 16 primer sets tested, 13 were positive in all 60 M. mycetomatis isolates tested (Fig 1). Primer sets 4, 5 and 12 were present in 58, 4 and 59 isolates, respectively (Fig 1). To determine the specificity of the 13 positive primer sets to M. mycetomatis, they were tested against other fungal mycetoma causative agents and close relatives of M. mycetomatis. As seen in Table 2, only primer set 11 –later renamed as Mmy-Fw and Mmy-Rv—was found to be specific for M. mycetomatis. Primer set 2, 4, 8 and 9 were not able to discriminate between the different Madurella species while 5 and 7 could discriminate between the four Madurella species but cross-reacted with at least one other mycetoma causative agent. The amplicon generated by Mmy-Fw and Mmy-Rv appears to be a putative single-copy gene. To determine if these PCR primers were as sensitive as the currently used ones, we compared the two PCRs head-on. Mmy-Fw and Mmy-Rv were able to detect DNA concentrations as low as 5 pg. This is only slightly less sensitive compared to the currently used diagnostic PCR primer pair 26.1a and 28.3a that is able to detect DNA at 0.5 pg.

Fig 1

Presence of the 16 PCR amplicons in 60 M.

mycetomatis isolates tested. Most PCR reactions resulted in amplification in all isolates tested except PCR 4, 5 and 12.

Table 2

Presence or absence of PCR amplicons of the sixteen primer sets and PCR primers developed in 1999 [5] in the other eumycetoma causing agents and close relatives of M. mycetomatis.

No amplicons were observed in all species tested here using Mmy-Fw and Mmy-Rv. Only PCR with bands of the same sizes to M. mycetomatis is considered specific to M. mycetomatis.

Primer set	1	2	3	4	5	6	7	8	9	10	Mmy-FwMmy-Rv	12	13	14	15	16	*26.1A28.3A	*26.1B28.3B
Madurella tropicana (4)	A	A	C	A	C	A	C	A	A	A	C	A	C	B	B	C	C	A
Madurella fahalii (3)	C	A	C	A	C	C	C	A	A	A	C	C	C	B	B	B	C	A
Madurella pseudomycetomatis (3)	A	A	A	A	C	B	C	A	A	B	C	B	B	C	B	A	B	A
Aspergillus fumigatus (1)	-	-	-	-	-	-	C	-	-	-	C	-	-	-	-	-	-	-
Aspergillus terreus (1)	-	-	-	-	-	-	C	-	-	-	C	-	-	-	-	-	-	-
Chaetomium globosum (2)	-	-	-	-	-	-	B	-	-	-	C	-	-	-	-	-	-	-
Falciformispora senegalensis (4)	B	B	B	B	B	B	C	B	B	B	C	C	B	B	C	B	C	C
Fusarium solani (1)	C	C	B	C	B	B	C	B	B	A	C	C	B	B	B	B	C	C
Medicopsis romeroi (3)	-	-	-	-	-	-	A	-	-	-	C	-	-	-	-	-	C	C
Scedosporium apiospermum (2)	-	-	-	-	-	-	-	-	-	-	C	-	-	-	-	-	C	-
Thielavia subthermophilia (3)	B	C	B	C	C	B	C	B	B	B	C	B	B	B	B	C	C	C
Thielavia terrestris (3)	B	B	B	C	C	B	C	B	B	B	C	B	B	B	B	C	C	C
Trematosphaeria grisea (4)	-	-	-	-	-	-	C	-	-	-	C	-	-	-	-	-	C	C
Trichophyton rubrum (1)	-	-	-	-	-	-	C	-	-	-	C	-	-	-	-	-	C	C

A: PCR band of the same size; B: PCR band of another size; C: no PCR band.

*M. mycetomatis specific primers designed in 1999 [5].

Primers Mmy-Fw and Mmy-Rv were also tested on DNA extracted from grains obtained from eumycetoma patients. As shown in Fig 2, amplicons were only observed when DNA from M. mycetomatis grains were present. The primers did not cross-react to DNA obtained from F. senegalensis or F. tompkinsii grains (Fig 2). Our findings show that these primers are sufficiently sensitive to be used in diagnosis directly from clinical specimens.

Fig 2

The specificity of Mmy-Fw and Mmy-Rv on DNA isolated from eumycetoma grains.

Lane 1, 100 bp DNA ladder; Lane 2, negative control; Lane 3, 4, 6, 8, 11 and 12, Madurella mycetomatis DNA extracted from grains; Lane 5 and 7, Falciformispora senegalensis DNA extracted from grains; Lane 9 and 10, Falciformispora tompkinsii DNA extracted from grains; Lane 13, Madurella mycetomatis DNA from isolate as a positive control. Presence of amplicons on lane 3, 4, 5, 6, 8, 11 and 12 and none on the other lanes confirms the specificity of Mmy-Fw and Mmy-Rv towards M. mycetomatis.

One of the advantages of using this comparative genome approach is that primer designs are less constrained since the targeted genes are unique. With this method, we were able to design primers that can distinguish between M. mycetomatis and M. pseudomycetomatis. Other studies have also succeeded in designing specific primers for their organism of choice using this approach [17-19]. In a study by Withers et al, a similar genome comparison method was performed on Pseudoperonospora cubensis and Pseudoperonospora humuli [19]. The comparison was first performed in silico and subsequently in vitro. Using this approach, they were able to identify and determine a large number of specific markers for their organism of interest while reducing the number of diagnostic candidates to validate with PCR [19]. However, a similar in silico approach could not be performed in our study because at the time of data analysis and the preparation of this manuscript, only the genome of one M. mycetomatis isolate and none of M. fahalii, M. tropicana and M. pseudomycetomatis was sequenced.

In conclusion, since cross-reactivity occurs with the current M. mycetomatis specific PCR primer pair 26.1a and 28.3a, we have used a comparative genome approach to identify and designed new M. mycetomatis species-specific PCR primers. Since new fungi causing eumycetoma are still being discovered, proper identification of its causative agents can help to fully understand the epidemiology and global burden of this disease. Thus, there is clearly a need for a specific PCR marker to identify its causative agents. We recommend reference centers such as the WHO collaborative Mycetoma Reference Center in Khartoum, Sudan and yet to be established reference laboratories in other endemic countries to use the new PCR primers Mmy-Fw and Mmy-Rv to identify M. mycetomatis to the species level. Furthermore, this comparative genome approach may also be used to design markers for other eumycetoma agents and also other fungi that share conserve ITS region within its genus.

4 Aug 2020

Dear Mr. Lim,

Thank you very much for submitting your manuscript "The development of a novel diagnostic PCR for Madurella mycetomatis using a comparative genome approach" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Husain Poonawala

Guest Editor

PLOS Neglected Tropical Diseases

Todd Reynolds

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: The fungal isolates tested . It isn't clear how these were all speciated prior to testing. Was this carried out by molecular techniques ( please state how ) - This information should be included in the paper.

It is a pity that some mycetoma agents have not been used for comparison eg Scedosporium apiospermum as other non-pigmented fungi have been included. Was this an oversight ?

In the discussion the authors refer to the in silica assay. Can you expand on this ?

Reviewer #2: (No Response)

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Yes but see above 3rd comment

Reviewer #2: (No Response)

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Yes these are fine. My second point is relevant to limitations - albeit a minor one

Reviewer #2: (No Response)

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: It would be helpful if the authors would say where they see the place of reference centres for mycetoma diagnosis. How many are there and do we need more ?

Reviewer #2: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: See above

Reviewer #2: The manuscript by Lim et al describes the development of a novel PCR assay for the specific detection/identification of cases of eumycetoma caused by Madurella mycetomatis, based on a genome-wide comparative approach.

A series of potential gene targets for PCR were identified in putative coding regions throughout the M. mycetomatis genome, PCR primers were designed and tested against a panel of 60 M. mycetomatis isolates plus a range of sibling species in Madurella, other agents of eumycetoma, and a variety of less related filamentous fungi.

One primer pair was selected due to its high specificity, and was shown to be slightly less sensitive that the previously described spscific PCR (which has since been shown to cross-react with another Madurella species.

A major question that should be addressed is whether this novel PCR is sufficiently sensitive to be used in diagnosis directly from clinical specimens eg fungal grains, or whether it will only be useful when working with pure cultures. I would encourage the authors to address this in the current manuscript as it would substantially strengthen the study.

The English usage is a little poor in places, and grammatical issue should be addressed on lines 35 (were not was); 50 (disappointing? is not clear); 54 (cause not causes); 57 (delete "a"); 57 (suggest: that we recommend"); sentence starting line 78 (developed is repeated)108 (using substituting?);127 (PCR reactions contained); 129 (were as follows); 132 (was this final stage really 10 seconds?); Table 2 (Madurella tropicana and spelling of Trematosphaeria); 154 Primer sets 4, 5 and 12 only amplified ...); 189 (delete "a")

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Roderick J Hay

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plosntds/s/submission-guidelines#loc-materials-and-methods

12 Oct 2020

Submitted filename: PLOSNTD Letter to reviewer .docx

Click here for additional data file.

17 Oct 2020

Dear Mr. Lim,

We are pleased to inform you that your manuscript 'The development of a novel diagnostic PCR for Madurella mycetomatis using a comparative genome approach' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Husain Poonawala

Guest Editor

PLOS Neglected Tropical Diseases

Todd Reynolds

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

24 Nov 2020

Dear Mr. Lim,

We are delighted to inform you that your manuscript, "The development of a novel diagnostic PCR for Madurella mycetomatis using a comparative genome approach," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases