| Literature DB >> 33324202 |
Bing Pang1, Qing Ni1, Sha Di1, Li-Juan Du1, Ya-Li Qin2, Qing-Wei Li1, Min Li3, Xiao-Lin Tong1.
Abstract
Aim: Diabetic retinopathy (DR) is a serious complication ofEntities:
Keywords: diabetic retinopathy; luo tong formula; microrna-200b; prevention; vascular endothelial growth factor/pigment epithelium-derived factor ratio
Year: 2020 PMID: 33324202 PMCID: PMC7723456 DOI: 10.3389/fphar.2020.551766
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primers sequences used for real-time PCR.
| Genes | Forward primer | Reverse primer | Size (bp) |
|---|---|---|---|
| ZO-1 | TCGGAGCTCGGGCATTATTC | CAGGGCACCATACCAACCAT | 310 |
| Occludin | CAACGGCAAAGTGAATGGCA | CTTTCCCCTTCGTGGGAGTC | 182 |
| β-Actin | CACCCGCGAGTACAACCTTC | CCCATACCCACCATCACACC | 207 |
Primers sequences used for real-time PCR.
| Genes | Primer sequence |
|---|---|
| Rno-miR-200b | Forward primer: CATCTTACTGGGCAGCATTGG |
| U6-forward | CTCGCTTCGGCAGCACATATACT |
| U6-rerverse | ACGCTTCACGAATTTGCGTGTC |
Composition of LTF.
| Species | Herbal name | Place of origin | Part of use | Dosage (g) |
|---|---|---|---|---|
|
| Astragali radix | Neimenggu | Root | 45 |
|
| Salviae miltiorrhizae radix et rhizoma | Henan | Root and rhizoma | 30 |
|
| Notoginseng radix et rhizoma | Yunnan | Root | 9 |
|
| Hirudo | Shandong | Dry body | 6 |
|
| Rhei radix et rhizoma | Gansu | Root and rhizoma | 3 |
FIGURE 1HPLC chromatogram of LTF. (A) Chromatogram at λmax = 210 nm. LTF is shown on top, while the reference standards are shown below. (B) Chromatogram at λmax = 254 nm. LTF is shown on top, while the reference standards are shown below.
Characterization of compounds in LTF.
| Peak no | Compound | Formula | Content (mg/g) | Source |
|---|---|---|---|---|
| 1 | Calycosin-7-O-β-D-glucoside | C22H22O10 | 0.51 |
|
| 2 | Notoginsenoside R1 | C47H80O18 | 0.45 |
|
| 3 | Ginsenoside Rg1 | C42H72O14 | 5.76 |
|
| 4 | Salvianolic acid B | C36H30O16 | 7.03 |
|
| 5 | Ginsenoside Rb1 | C54H92O23 | 0.54 |
|
| 6 | Aloe-emodin | C15H10O5 | 0.024 |
|
| 7 | Rhein | C15H8O6 | 0.17 |
|
| 8 | Emodin | C15H10O5 | 0.0088 |
|
| 9 | Chrysophanol | C15H10O4 | 0.029 |
|
| 10 | Physcion | C16H12O5 | 0.11 |
|
| 11 | Tanshinone II | C19H18O3 | 0.0026 |
|
Changes in body weight and blood glucose for 0, and 12 Weeks.
| Parameters | Weeks | Group | |||
|---|---|---|---|---|---|
| Normal | Diabetic | LTF | CaD | ||
| Weight, g | 0 | 266.35 ± 13.47 | 267.38 ± 11.46 | 269.18 ± 12.81 | 264.93 ± 17.01 |
| Blood glucose, mmol/L | 12 | 512.80 ± 21.69 | 348.69 ± 23.66* | 378.54 ± 25.47*△ | 375.62 ± 24.23*△ |
| 0 | 5.21 ± 0.42 | 28.63 ± 5.48* | 28.18 ± 5.53* | 29.99 ± 4.14* | |
| 12 | 5.23 ± 0.51 | 31.38 ± 2.20* | 30.87 ± 2.62* | 30.78 ± 2.82* | |
Note: Data are expressed as mean ± SD. N = 160 for 0 weeks, and n = 152 for 12 weeks. (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 2Effects of LTF and CaD on hemorrheological indicators. Data are mean ± SD from six rats per group. (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 3Effect of LTF and CaD on the retinal morphological changes. (A) HE staining of retina at 12 weeks (×400 magnification); (B) Toral retinal thickness; (C) Cell counts in the GCL; (B–C) Data are mean ± SD from six retinas per group. (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 4Effect of LTF and CaD on the retinal vascular morphological changes and BRB leakage. (A) PAS staining of retina at 12 weeks (400× magnification); (B) Number of acellular capillaries (Data are mean ± SD from six retinas per group); (C)The ratio of endothelial cells and pericytes (Data are mean ± SD from six retinas per group); (D) Measurement of BRB permeability (Data are mean ± SD from four retinas per group); (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 5Effect of LTF and CaD on the ZO-1, Occludin and Claudin-5 expressions. (A, B) Western blot and quantitative measurement of retinal ZO-1, Occludin and Claudin-5; C Real-time PCR analysis of ZO-1 and Occludin. Data are mean ± SD from six rats per group, and the experiments were repeated independently four times (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 6qRT-PCR of retinal miR-200b expression. Data are mean ± SD from six rats per group, and the experiments were repeated independently four times.(*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 7Effect of LTF and CaD on the VEGF, VEGFR and PEDF. (A) Immunostaining of retinal VEGF (400× magnification); (B) Immunostaining of retinal PEDF (400× magnification); (C, D) Western blot and quantitative measurement of retinal VEGF, PEDF and VEGFR. Data are mean ± SD from six rats per group, and the experiments were repeated independently four times. (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 8Effect of LTF and CaD on the Ang-1 and Tie-2. (A, B) Western blot and quantitative measurement of retinal Ang-1 and Tie-2. Data are mean ± SD from six rats per group, and the experiments were repeated independently four times (*p < 0.05: vs. NC group; △ p < 0.05: vs. DM group).
FIGURE 9The miR-200b/VEGF pathway is involved in DR, which is inhibited by LTF.