Literature DB >> 33318614

Different expression of lipid metabolism-related genes in Shandong black cattle and Luxi cattle based on transcriptome analysis.

Ruili Liu1, Xianxun Liu1, Xuejin Bai1,2, Chaozhu Xiao2, Yajuan Dong3,4.   

Abstract

To provide new ideas for improving meat quality and generating new breeds of cattle, the important candidate genes affecting fat deposition in two kinds of cattle were identified. Eighteen months Shandong black cattle (n = 3) and Luxi cattle (n = 3) were randomly assigned into two environmental. The longissimus dorsi muscles of Shandong Black Cattle and Luxi Cattle were collected and analyzed by fatty acid determination, high-throughput sequencing transcriptomics, qRT-PCR expression profile and western blot. The ratio of unsaturated fatty acids to saturated fatty acids was 1.37:1 and 1.24:1 in the muscle tissues of Shandong black cattle and Luxi cattle, respectively. The results of RNA-Seq analysis revealed 1320 DEGs between the longissimus dorsi of Shandong black cattle and Luxi cattle. A total of 867 genes were upregulated, and the other 453 genes were downregulated. With GO enrichment analysis, it was found that the identified DEGs were significantly enriched in regulation of the Wnt signaling pathway, negative regulation of the Wnt signaling pathway, cAMP metabolic process, fat cell differentiation and among other functions. We found that regulation of lipolysis in adipocytes was the significant enrichment pathway of upregulated genes and downregulated genes, PPAR signaling pathway and AMPK signaling pathway are highly representative pathways of lipid metabolism in Shandong black cattle. Network analysis showed that PPARGC1A, ADCY4, ANKRD6, COL1A1, FABP4, ADIPOQ, PLIN1, PLIN2, and LIPE genes were correlated with key loci genes in multiple metabolic pathways. Meanwhile we found that FABP4 and ADIPOQ had 7 common regulatory factors in different genes, which were PLIN1, PLIN2, PPARGC1A, RXRA, PCK1, LEPR, LEP. These genes were involved in regulation of lipolysis in adipocytes, adipocytokine signaling pathway, PPAR signaling pathway. FABP4 and ADIPOQ were selected as important candidate marker genes for fat deposition based on the results.

Entities:  

Mesh:

Year:  2020        PMID: 33318614      PMCID: PMC7736358          DOI: 10.1038/s41598-020-79086-4

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

High-throughput RNA-Seq (RNA-Seq) technology can simultaneously detect the expression of thousands of genes and thus plays an important role in the identification of functional genes and analysis of regulatory networks. In recent years, high-throughput RNA-Seq (RNA-Seq) technology has provided an opportunity to generate large amounts of sequence data for non-model organisms, making it superior to traditional microarray analysis[1,2]. Zhang Yingying[3] found that 12 genes, including COL1A2, COL1A1, SPP1, MMP2, MYH3, MYH8 and CFD, may be important candidate genes affecting beef quality traits in both sexes of Qinchuan cattle. Matthew McCabe5[4] used RNA-seq analysis in 2012 to conclude that the negative regulation of liver production in lactating dairy cows was related to fat metabolism; High-throughput RNA-Seq (RNA-Seq) is an emerging technology at the frontier of biological research and has gradually become the focus of research in this field[5,6]. Shandong black cattle was the first embryo transfer calf to obtain vitrified frozen somatic cell cloned embryos in China, which was the combination of Japanese black cattle, Luxi cattle and Bohai black cattle. First, using the method of a combination of incompletely locked group generations and overlapping generations, the Japanese black cattle were crossed with Luxi cattle and bohai black cattle respectively[7]. Then according to the breeding goal, the new generation core breeding group was established by filial generation of Shandong black cattle. Then the new generation core breeding group hybridized with Shandong black cattle. Finally the second generation group of Japan black cattle (3/4) × luxi cattle (1/4) and the new generation (3/4) × bohai black cattle (1/4) was formed. Then the ideal black cattle and Shandong black cattle were selected from the second generation group and entered the cross-cross fixation stage. In this stage, Several good lines with distant relatives were cross-bred, and then selected and reserved the excellent lines groups. After 4 generations, a new Shandong black cattle variety matching line was finally bred and used as a bull. In 2015, Shandong black cattle was approved by the National Animal and Poultry Genetic Resources Committee as a new population and successfully established a new variety cultivation Chinese base. Luxi cattle is one of the five local beef cattle breeds in China, with high meat production capacity, fresh and tender meat and the reputation of "five flavors and three layers of meat"[8,9]. In this study, Luxi cattle as the first generation of hybrid mother hybridized with Shandong black cattle to improve new breeding varieties. The purpose of our study was to find the changes in transcriptome expression between hybrid cattle and cows, and then to explore the gene expression differences between hybrid offspring and original mother generation from the transcriptome. In this study, we analyzed the gene regulatory network of fat deposition in the longissimus dorsi muscle of Shandong black cattle and Luxi cattle, identified candidate genes and important metabolic pathways affecting fat deposition, revealed the molecular mechanism affecting fat deposition in beef cattle. New ideas are provided for character improvement and the breeding of new breeds.

Method

Experimental animals

The animals used in the experiment, i.e., Shandong black cattle and Luxi cattle, were obtained from Shandong black cattle Technology Co., Ltd., and Dadi Luxi Cattle, respectively. According to the standard NY5127—2002 pollution-free feeding management of beef cattle, feeding Shandong black cattle and Luxi cattle was mainly using green coarse feed and reasonably matched with concentrate feed. Fed three times a day and supplied sufficient drinking water. At the same time, the cattle body should be brushed frequently and the cattle house should be ventilated and dried. Kept clean inside and outside of the cattle house and disinfected once a month. The farm carried on the unified feeding management to the Shandong black cattle and Luxi cattle. 18-Month-old healthy beef cattle were selected, and their bones, muscles and bodies were gradually mature. There are no scratches, scars and scabs on the body surface, and fat deposits in the internal organs and abdomen. No disease was found during examination, and all physiological and biochemical indexes were normal. Specific phenotypic data were shown in Table 1.
Table 1

The phenotype data of Shandong black cattle and Luxi cattle.

VarietyWeight (kg)Body height (cm)Body length (cm)Chest circumference (cm)Cannon circumference (cm)Thickness of backfat (cm)Carcass weight (kg)
Shandong black cattle-1513137161200201.8418
Shandong black cattle-2510135158197191.7411
Shandong black cattle-350613115319218.51.7400
Luxi cattle-1490135147178171.2285
Luxi cattle-2486130143182151.2270
Luxi cattle-3492138152173181.3276
The phenotype data of Shandong black cattle and Luxi cattle.

Sample collection

After acceptance and body measuremengt, live cattle would be slaughtered according to the GBT19477-2004 cattle slaughtering procedures, and then immediately disinfection and anatomy. The longissimus dorsi muscle (located between ribs 12–13 of the thorax) was selected as a sample and divided into small squares of about 2–3 cm3. A part of them putted in the cryopreservation tube and the other part putted in 4% paraformaldehyde. Fixed the samples and then marked time, name and number. Finally putted the cryopreservation tube into liquid nitrogen immediately. In the sampling process, spray 75% alcohol on the operating table and in the surrounding environment every 2 or 3 min, try to keep the sterile state, and finally bring the sample back to the laboratory. The samples should be ventilated, dried for preservation and prepared for using.

Fatty acid determination

The fatty acid methyl ester of animal fat was prepared according to the method in GB/T 9695.2-2008. First, reflux was performed with an appropriate sodium hydroxide methanol solution, 12–15% boron trifluoride methanol solution was added to the solution for reflux, and saturated sodium chloride solution and isooctane were added. The solution was mixed, the extract was obtained, and the isooctane layer was used for analysis on a gas chromatograph. After collecting and entering the fatty acid data of the two groups with Excel 2007, ANOVA was conducted with SPSS 17.0 software. The difference between the two groups was analyzed by one-way ANOVA. The data were expressed as the mean ± standard deviation, with P < 0.05 indicating statistical significance.

RNA extraction and sequencing

Extraction, library preparation and sequencing of total RNA from the longissimus dorsi muscle of Shandong black cattle (B) and Luxi Cattle (L) were performed. Total RNA was extracted by Trizol reagent (Invitrogen) according to the manufacturer's instructions, and genomic DNA was removed by DNase I (Takara). RNA quality (RNA integrity number, RIN) was determined by an Agilent 2100 Bioanalyzer, and a NanoDrop 2000 spectrophotometer (NanoDrop) was used for quantification. High-quality RNA samples (OD260/280 = 1.8–2.2, OD260/230 ≥ 2.0, RIN ≥ 6.5) were used to construct sequence libraries. Illumina Hiseq xten sequencing platform was used in this study. We have stored the RNA sequence data in the public domain GEO NCBI to obtain the GEO accession numbers: GSM4904154, GSM4904155, GSM4904156, GSM4904157, GSM4904158, GSM4904159.

Read quality control and mapping

The original sequencing data was processed by Fastp software with parameters “‘-Q 20 -P90”’ through the disjointing sequence and low-quality sequence. In this step, reads containing adapter, ploy-N, and low-quality reads were removed from raw data to obtain clean clean reads. The clean reads were aligned to the Bos taurus genome (ARS-UCD1.2) using HISAT v2-2.1.0 software (https://daehwankimlab.github.io/hisat2/) and obtain the orientation pattern. The genome was constructed on the superfast short read mapper Bowtie 2 for mapping with default parameters. All downstream analyses were based on clean, high-quality data.

Analysis and annotation of differentially expressed genes

To identify the DEGs between the two samples, we used the number of fragments per thousand exons (FPKM) to calculate the expression level of each transcript. The mapped reads of each sample were assembled by StringTie v2.1.3 in a reference-based approach. Cuffdiff tool in Cufflink v2.2.1 was used to calculate FPKMs of coding genes in each sample. Gene FPKMs were computed by summing the FPKMs of transcripts in each gene group. Cuffdiff (http://cufflinks.cbcb.umd.edu/) was used to analyze the differential expression[10]. The selected criteria for DEGs were as follows: the logarithm of fold change was greater than 2, and the q-value (q < 0.05) with FDR correction was less than 0.05. GO (gene ontology) terms were assigned based on the best-hits BLASTx resulted from NR alignments that were derived from Blast2GO v5.2.5 against GO database.

Analysis of functions and protein–protein interactions (PPIs) of DEGs

To understand the functions of DEGs, goatools (https://pypi.org/project/goatools/) and KOBAS v3.0 (http://kobas.cbi.pku.edu.cn/) were used to conduct analyses of GO functional enrichment and Kyoto Encyclopedia of Genes and Genes (KEGG) pathway enrichment[11,12]. When the q value of a DEG was less than 0.05, the GO and KEGG pathways were considered to be significantly enriched. The GO enrichment analysis for DEGs (hypergeometric test, q-value < 0.05) was performed using clusterProfiler v3.16.0 in the R package. The PPI network of DEGs was analyzed using the STRING v11 (http://string-db.org/) database, which contains direct and indirect protein associations. Based on the STRING analysis results and expression change information for each DEG, a network diagram of the selected DEGs (connecting one or more DEGs) was drawn by using Cytoscape v3.7.1 software[13].

Real-time quantitative PCR (qRT-PCR)

The reaction system (20 μL) consisted of the following: 1 μL of template cDNA, 10 μL each of the upstream and downstream primers, and 5 ml (5 × 1 mL vials) of RNase-free water. The thermal cycling procedure was as follows: 94 °C for 10 min, 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 40 s, with 40 cycles[14].The expression of GAPDH was calculated by the 2−△△CT method. Primers used for qRT-PCR as shown in Table 2.
Table 2

Primers used for qRT-PCR.

GenePrimer sequence (5′ → 3′)Product length (bp)Annealing temperature (°C)
GAPDH

F:CCCTTCATTGACCTTCACTACA

R:TCCATTGATGACGAGCTTCC

10861
FABP7

F:CAGGACTCAAAGCACATTCAAG

R:CTTTGCCATCCCATTTCTGTAC

79462
PCK1

F:CATGACGAGGATGGGCAC

R:GTGGGCGATGAGTGTGAG

25762
PILN1

F:GCCAGCACTTCAGACAAAATC

R:GGGAGGTTTCTGGGCATC

77159
LIPE

F:TTCTTTCGCACCAGCCACAA

R:CGTAGGAAGTCGGCAATTACCCT

16158
ADIPOQ

F:CATTATGACGGCAGCAC

R:CAGATGGAGGAGCACAG

19252
FABP4

F:AGTGGGCGTGGGCTTTG

R:CTCTTTATGGTGGTTGAT

25249
PPARGC1A

F:TCCCCAGGCAGTAGATCTTC

R:TCCTCGTAGCTGTCATACCTG

86162
COL6A2

F:GAGATCCAGGCATCGAAGG

R:CCCATCTGTCCCGTTCTTG

76162
COL4A5

F:GAAAGGACCCAGTGGAGTA

R:CATTGTGGAGCATCTGTTGT

42655
MYLPF

F:GACCTGCGGGACACTTT

R:GTCGGCACCTTTGAGCT

14156
MYL3

F:CACGCCCAAGTGCGAGAT

R:CCCTCCACGAAGTCCTCA

21959
ADCY1

F:AGCACTTCCTAATGTCCAACC

R:GAAGGCGTAGACATTCCACC

96062
ATGL

F:CCTGCTGATTGCTATGAGTGT

R:TCTTTGGAGTTGAAGTGGGTT

10152
IPMK

F:GGATGTAAAGATAGGGCGGAAA

R:AAGCACCAAGAACCCAATCT

10956
AMPK

F:TCACCAGTGGACACGAGGAAAG

R:CTCAGGTAGCACGGGTCGGAAT

21756
AQP7

F:GCCATCATCTACTTGTTCTT

R:GCTGAGGGTCTATCTTCG

17652
Primers used for qRT-PCR. F:CCCTTCATTGACCTTCACTACA R:TCCATTGATGACGAGCTTCC F:CAGGACTCAAAGCACATTCAAG R:CTTTGCCATCCCATTTCTGTAC F:CATGACGAGGATGGGCAC R:GTGGGCGATGAGTGTGAG F:GCCAGCACTTCAGACAAAATC R:GGGAGGTTTCTGGGCATC F:TTCTTTCGCACCAGCCACAA R:CGTAGGAAGTCGGCAATTACCCT F:CATTATGACGGCAGCAC R:CAGATGGAGGAGCACAG F:AGTGGGCGTGGGCTTTG R:CTCTTTATGGTGGTTGAT F:TCCCCAGGCAGTAGATCTTC R:TCCTCGTAGCTGTCATACCTG F:GAGATCCAGGCATCGAAGG R:CCCATCTGTCCCGTTCTTG F:GAAAGGACCCAGTGGAGTA R:CATTGTGGAGCATCTGTTGT F:GACCTGCGGGACACTTT R:GTCGGCACCTTTGAGCT F:CACGCCCAAGTGCGAGAT R:CCCTCCACGAAGTCCTCA F:AGCACTTCCTAATGTCCAACC R:GAAGGCGTAGACATTCCACC F:CCTGCTGATTGCTATGAGTGT R:TCTTTGGAGTTGAAGTGGGTT F:GGATGTAAAGATAGGGCGGAAA R:AAGCACCAAGAACCCAATCT F:TCACCAGTGGACACGAGGAAAG R:CTCAGGTAGCACGGGTCGGAAT F:GCCATCATCTACTTGTTCTT R:GCTGAGGGTCTATCTTCG

Western blotting

Muscle tissue samples were placed in a precooled mortar, fully ground into a powder with liquid nitrogen, kept at a low temperature, and transferred to a centrifuge tube containing 1.5 ml of RIPA lysis buffer. The powder and liquid were fully mixed, placed on ice for 30 min, and then vibrated violently every 10 min for 30 s. Then, 5 μL of 5 × SDS was added and suspended, and the mixture was vibrated for 20 s and centrifuged at 3500 r/min for 1 min. After boiling water treatment for 5 min and centrifugation for 5 min at 12,000 r/min, the supernatant, i.e., total protein of muscle tissue, was collected. For specific steps, see[15]. A luminescence kit was used to expose and develop the film in the darkroom. The film negative was scanned, and ImageJ 1.39u was used to analyze the optical density of the target strip.

Ethics approval and consent to participate

All experimental design and procedures of this study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of Qingdao Agricultural University IACUC (Institutional Animal Care and Use Committee).

Results

The phenotype data of Shandong black cattle and Luxi cattle

According to SPSS 22.0(Table 1), the average body weight, body height, body length, chest circumference, cannon circumference, thickness of backfat and carcass weight of Shandong black cattle were 509.67 kg, 134.33 cm, 157.33 cm, 196.33 cm, 19.17 cm, 1.73 cm and 409.67 kg respectively. The average body weight, body height, body length, chest circumference, cannon circumference, thickness of backfat and carcass weight of Luxi yellow cattle were 489.33 kg, 134.33 cm, 147.33 cm, 177.67 cm, 16.67 cm, 1.23 cm and 277.00 kg respectively. The results of correlation coefficient significance test showed that the correlation coefficients between carcass weight and body weight, body height, body length, chest circumference and cannon circumference of Shandong black cattle were 0.999, 0.998, 0.999 and 0.950 respectively, while the correlation coefficients between carcass weight and body weight, body height, body length, chest circumference and tube circumference of Luxi yellow cattle were 0.564 and 0.524 respectively.

Determination of fatty acids in beef cattle

To confirm the difference in partial fatty acid content between Shandong black cattle (B) and Luxi cattle (L), the fatty acid content of beef was determined. As shown in Table 3, the saturated fatty acid content of Shandong black cattle was 1.34% lower than that of Luxi cattle, and the monounsaturated fatty acid content of Shandong black cattle was higher; the polyunsaturated fatty acid content of Shandong black cattle was significantly higher than that of Luxi cattle. The stearic acid (saturated fatty acid) and linoleic acid (polyunsaturated fatty acid) contents in Shandong black cattle were significantly lower than those in Luxi cattle. The ratio of unsaturated fatty acids to saturated fatty acids in the muscle tissue of Shandong black cattle and Luxi cattle was 1.37:1 and 1.24:1, respectively, and the percentage of monounsaturated fatty acids relative to the total fatty acids of Shandong black cattle was 54.28%. These results confirmed that the beef of Shandong black cattle had a better fatty acid composition and flavor than that of Luxi cattle.
Table 3

Difference in the fatty acid content of beef between group B and group L.

Fatty acid componentShandong black cattleLuxi cattle
(SFAs) Saturated fatty acids42.67 ± 4.1344.01 ± 3.43
(MUFAs) Monounsaturated fatty acids54.28 ± 3.7752.11 ± 3.06
(PUFAs) Polyunsaturated fatty acids3.97 ± 0.55*2.36 ± 0.33
Myristic acid2.62 ± 0.452.29 ± 0.66
Palmitic acid23.44 ± 2.8024.15 ± 2.11
Stearic acid9.72 ± 0.915*15.43 ± 4.64
Margaric acid0.66 ± 0.110.57 ± 0.11
Palmitoleic acid3.24 ± 0.653.98 ± 1.27
Myristoleic acid0.75 ± 0.220.93 ± 0.28
Oleic acid50.90 ± 3.3147.69 ± 4.76
Peanut olefinic acid0.38 ± 0.110.49 ± 0.12
Linoleic acid2.52 ± 0.47*1.06 ± 0.31
Linolenic acid0.43 ± 0.110.45 ± 0.18
Others3.13 ± 0.693.11 ± 0.88

In the table, * indicates a significant difference (P < 0.05).

Difference in the fatty acid content of beef between group B and group L. In the table, * indicates a significant difference (P < 0.05).

Transcriptome quantification

After removing the low-quality reads and the reads with adapter sequences from the RNA-Seq raw reads, 223,609,230 clean reads (B: 122,463,284, L: 101,145,946; Table 4) were obtained. In the B and L samples, 98.08% and 97.53% of the reads were located in the reference genome, and the clean (Q30) base rate was 94.30% and 93.72%, respectively.
Table 4

Read quality and mapping results for RNA-Seq.

SampleTotal raw readsTotal clean readsMapped readsMapping rate (%)Clean (Q30) Base Rate (%)
L1126,735,736122,463,284120,167,80198.1394.00
L2125,664,524119,811,368117,518,65498.0994.36
L3125,900,178119,637,778117,281,32398.0394.54
B199,182,29895,960,69294,094,17298.0593.75
B2105,345,396101,145,94697,711,02196.6093.56
B3102,435,92498,666,43696,633,74097.9493.86
Read quality and mapping results for RNA-Seq.

DEG analysis and functional annotation

For a gene to be considered a DEG, the criteria of an FPKM of l, fold change (FC) ≥  ± 2, and q < 0.05 had to be met. A total of 1320 genes were identified as significantly differentially expressed in the Shandong black cattle group (B). Of the 1320 genes, 867 were upregulated, and 453 were downregulated (Fig. 1; and attachment 1: Fig. S1: Heat map of DEGs between Shandong black cattle and Luxi cattle samples, where yellow indicates upregulation and blue indicates downregulation (PDF, 47 KB); attachment 2: table S1: Differentially expressed genes in Shandong black cattle and Luxi cattle samples (XLS, 111 KB)).
Figure 1

Summary of differentially expressed genes between Shandong black cattle (B) and Luxi cattle (L) a A total of 1321 genes were identified as significantly differentially expression, 867 were upregulated, and 453 were downregulated. b According to the two variables of fold change and P-value, the volcano map was drawn. When the abscissa value is 0, it means that the expression of gene is the same between the two samples, while the ordinate value represents the significant level, and the larger the value is, the higher the significant level is.

Summary of differentially expressed genes between Shandong black cattle (B) and Luxi cattle (L) a A total of 1321 genes were identified as significantly differentially expression, 867 were upregulated, and 453 were downregulated. b According to the two variables of fold change and P-value, the volcano map was drawn. When the abscissa value is 0, it means that the expression of gene is the same between the two samples, while the ordinate value represents the significant level, and the larger the value is, the higher the significant level is. In our study, 1320 unigenes were assigned to 50 sub-categories of GO terms belonging to the following three main categories: cellular component (CC), biological process (BP), and molecular function (MF). These main categories included 16, 23, and 11 sub-term categories, respectively (Fig. 2).The DEGs were mainly enriched in the processes of cellular process (BP),biological regulation (BP) of GO sub-categories of biological process (BP) and cell part (CC) of cellular component (CC).The upregulated DEGs were associated with 27 terms, the mainly enriched sub-categories were mainly involved in cell part (CC), cellular process (BP), binding (MF), biological regulation (BP) and metabolism process (BP). The downregulated DEGs were associated with 23 GO terms. The most frequently annotated GO terms were cell part (CC), binding (MF), cellular process (BP), biological regulation (BP) and organelle part (CC).
Figure 2

GO annotation of DEGs between the longissimus dorsi muscle of Shandong black cattle and that of Luxi cattle. A total of 1320 DEGs were annotated with 50 different GO terms. The upregulated DEGs were associated with 27 terms, and the downregulated DEGs were associated with 23 GO terms. Red represents upregulated genes, green represents downregulated genes.

GO annotation of DEGs between the longissimus dorsi muscle of Shandong black cattle and that of Luxi cattle. A total of 1320 DEGs were annotated with 50 different GO terms. The upregulated DEGs were associated with 27 terms, and the downregulated DEGs were associated with 23 GO terms. Red represents upregulated genes, green represents downregulated genes.

Functional and PPI analyses of DEGs

After the enrichment analysis of GO terms, the enrichment ratio of DEGs for different GO terms was analyzed. The DEGs related to fat metabolism were significantly enriched in negative regulation of the Wnt signaling pathway, brown fat cell differentiation, regulation of the Wnt signaling pathway, cAMP metabolic process, fat cell differentiation, biological regulation, regulation of cellular metabolic process, and regulation of primary metallic process, among others (attachment 3: Fig. S2 and attachment 4: Table S2: Results of DEG enrichment analysis between Shandong black cattle and Luxi cattle samples (XLS 159 kb)). We have analyzed the upregulated genes and downregulated genes respectively for enrichment and other ways, and it is interesting that we find the pathways that upregulated and downregulated genes are significantly enriched is the Regulation of lipolysis in adipocytes. Among the 32 pathways with significant enrichment, focal adhesion, regulation of lipolysis in adipocytes, ECM receiver interaction, AMPK signaling pathway, PPAR signaling pathway and adipocytokine signaling pathway were enriched in typical pathways (www.kegg.jp/kegg/kegg1.html) (attachment 5: Fig. S3, Table 4 and attachment 6: Table S3:KEGG pathway enrichment result of the DEGs.). As a whole significantly enriched lipid metabolism pathway, the upregulated genes is ECM-receptor interaction and Focal adhesion and the downregulated genes is PPAR signaling pathway and AMPK signaling pathway. We regard PPAR signaling pathway and AMPK signaling pathway as a highly representative pathway of lipid metabolism in Shandong black cattle. The differential genes involved in the above pathway are shown in the Table 5.
Table 5

List of significantly enriched KEGG pathways related to lipid metabolism.

PathwaysIDNo. of DEGsP-valueUpregulated genesDownregulated genes
Regulation of lipolysis in adipocytesKo04923130.00093ADCY4, TAHR, PIK3R3, ADCY1, NPY1RPTGS1, FABP4, PDE3B, ADORA1, ADCY7, LIPE, PLIN1, PTGER3
Adipocytokine signaling pathwayKo04920110.039847RXRA, SOCS3, NFKBIA, PPARGC1A, ACSBG2PCK1, G6PC, LEPR, SLC2A1, LEP, ADIPOQ
PPAR signalingKo03320120.032492PXPA, FADS2, ACSBG2PLIN2, FABP7, PCK1, FABP4, FABP3, PLIN1, GK, ADIPOQ, SCD5
ECM-receptor interactionKo04512160.000853COL6A1, COL6A2, LOC530102, COL4A2, ITGA6, LAMA5, COL1A1, HSPG2, DAG1, LAMB2, LAMA3, COL4A6, COL4A5, COL6A3, COL1A2, ITGB8
AMPK signaling pathwayKo04512180.018498PFKFB3, CREB3L1, PFKFB2, EEF2K, PIK3R3, PFKM, PPARGC1AADRA1A, FBP1, PCK1, LIPE, CAB39, G6PC, LEPR, LEP, ADIPOQ, SCD5, PPP2R2C
Focal adhesionKo04510240.017491COL6A1, COL6A2, LOC530102, COL4A2, COL4A2, ITGA6, LAMA5, MYLK3, COL1A1, LAMB2, VEGFA, MYLK4, LAMA3, MYLPF, PAK1, COL4A6, COL4A5, PIK3R3, COL6A3, COL1A3, ITGB8, PDGFB, KDRDIAPH1, MYL12A
List of significantly enriched KEGG pathways related to lipid metabolism. The potential interaction network between different genes was studied by using STRING analysis. As shown in Fig. 3, most of the DEGs were related to metabolic pathway, focal adhesion, purine metabolism, regulation of lipolysis of adipocytes and the cAMP signaling pathway. Among the upregulated genes, COL6A1, COL6A2, LAMB2, VEGFA, MYLK4, LAMA3 and MYLPF were located in the core of the network and connected to many other DEGs; among the downregulated genes, the key loci were FABP4, ADIPOQ, PLIN1, PLIN2 and LIPE, which were related to the largest numbers of genes. In addition, not all DEGs were connected to other DEGs because their functions were either not relevant or not yet clarified (attachment 7: Fig. S4:STRING analysis of all DEGs between S2 Shandong black cattle bull and Luxi cattle samples (SVG, 8290 kb)). These DEGs were not included in Fig. 4.
Figure 3

Prediction of differential gene targeting network. Blue represents differential regulatory gene, Green represents predictive regulatory gene, Orange represents the regulator of FABP4 and ADIPOQ genes.

Figure 4

Expression profile of fat metabolism-related genes. The expression of different genes related to fat metabolism in Shandong black cattle and Luxi cattle was determined by qRT-PCR. Data are shown as the mean ± S.D. Columns marked with *(P < 0.05) are significantly different from each other, and those with **(P < 0.01) show extreme differences.

Prediction of differential gene targeting network. Blue represents differential regulatory gene, Green represents predictive regulatory gene, Orange represents the regulator of FABP4 and ADIPOQ genes. Expression profile of fat metabolism-related genes. The expression of different genes related to fat metabolism in Shandong black cattle and Luxi cattle was determined by qRT-PCR. Data are shown as the mean ± S.D. Columns marked with *(P < 0.05) are significantly different from each other, and those with **(P < 0.01) show extreme differences.

Expression profile analysis of genes related to fat metabolism

qRT-PCR was used to detect the expression of differentially expressed genes related to fat metabolism. As shown in Fig. 4, most of the DEGs showed significantly different expression (P < 0.01), except COL6A2 (P < 0.05). Among the 10 genes related to fat metabolism, ADIPOQ exhibited the highest expression in the longissimus dorsi, followed by FABP4, LIPE and PCK1, and the expression of the other genes was relatively low.

Partial verification of RNA-Seq data

To further verify the RNA-Seq data, the DEGs determined to be related to the fat metabolism response with RNA-Seq were selected for qRT-PCR analysis. As shown in Table 6 and Fig. 5 selected genes showed consistent results between the RNA-Seq and qRT-PCR analyses, and the correlation coefficient between the RNA-Seq and qRT-PCR results (Fig. 6) was very high (R2 = 0.97302). Some DEGs were detected by Western blot, as shown in Fig. 7 (attachment 8: Fig. S5: Gel pictures of Western blot). The expression of ADIPOQ and FABP4 decreased significantly (Fig. 7a), and the expression of MYLPF and MYL3 increased significantly (Fig. 7b). In addition, there was no change in the expression of β-actin (used as a control). The relationship between the Shandong black cattle and Luxi cattle was consistent with the results of RNA-Seq. These results confirmed that the differentially expressed genes identified by RNA-Seq were reliable.
Table 6

The immune response-related DEGs and partial validation of RNA sequencing data by qRT-PCR.

Gene IDGene nameFunctional annotationFC (log2(L/B))
RNA-SeqqRT-PCR
Downregulated
NM_001078162.2FABP7Fatty acid binding protein 7− 3.7202− 3.3823
NM_174737.2PCK1Phosphoenolpyruvate carboxykinase 1− 3.1438− 3.2106
NM_001083699.1PLIN1Perilipin 1− 3.9278− 3.6566
NM_001080220.1LIPEHormone sensitive type− 2.0047− 2.2774
NM_174742.2ADIPOQAdiponectin, C1Q and collagen domain containing− 3.4458− 3.2016
NM_174314.2FABP4Fatty acid binding protein 4, adipocyte− 3.9620− 3.8339
Upregulated
NM_177945.3PPARGC1APPARG coactivator 1 alpha3.13633.4889
NM_001075126.1COL6A2Collagen type VI alpha 2 chain1.39822.9828
XM_002699862.5COL4A5Collagen type IV alpha 5 chain1.38151.6453
NM_001075647.1MYLPFMyosin light chain, phosphorylatable, fast skeletal muscle2.31862.0552
NM_001076501.2MYL3Myosin light chain 34.08114.1010
NM_174229.2ADCY1Adenylate cyclase 13.75713.4890
Figure 5

Comparison of gene expression levels detected with RNA-seq and qRT-PCR.

Figure 6

Linear fitting of RNA-seq and qRT-PCR gene expression data. The DEGs related to fat metabolism were selected for qRT-PCR analysis. The 14 selected genes showed consistent results between the RNA-seq and qRT-PCR analyses, with a correlation coefficient (R2) = 0.97302.

Figure 7

Expression of protein-coding DEGs. a The expression of ADIPOQ, FABP4, MYLPF and MYL3 in the samples was determined by Western blot using anti-beta actin polyclonal antibody (Abcam) and anti-rabbit IgG (whole-molecule) antibody (Sigma), unprocessed images are presented in Supplementary Figure S5. b The quantitative data of the Western blotting are presented as fold changes compared to the anti-beta actin data after ImageJ quantification; *, ** indicate significant differences among the different treatments (n > 3; P < 0.05).

The immune response-related DEGs and partial validation of RNA sequencing data by qRT-PCR. Comparison of gene expression levels detected with RNA-seq and qRT-PCR. Linear fitting of RNA-seq and qRT-PCR gene expression data. The DEGs related to fat metabolism were selected for qRT-PCR analysis. The 14 selected genes showed consistent results between the RNA-seq and qRT-PCR analyses, with a correlation coefficient (R2) = 0.97302. Expression of protein-coding DEGs. a The expression of ADIPOQ, FABP4, MYLPF and MYL3 in the samples was determined by Western blot using anti-beta actin polyclonal antibody (Abcam) and anti-rabbit IgG (whole-molecule) antibody (Sigma), unprocessed images are presented in Supplementary Figure S5. b The quantitative data of the Western blotting are presented as fold changes compared to the anti-beta actin data after ImageJ quantification; *, ** indicate significant differences among the different treatments (n > 3; P < 0.05).

Discussion

The main fatty acids that play a role in the flavor of beef are unsaturated fatty acids (UFAs), among which polyunsaturated fatty acids (PUFAs) play the greatest role. The main principle of fatty acid analysis is to determine the relative levels of ω-6 and ω-3 groups in PUFAs. The average ratio of unsaturated fatty acids to saturated fatty acids in beef is 1.37:1, and the percentage of monounsaturated fatty acids (MUFAs) relative to total fatty acids is greater than 55%[16]. The results showed that the ratio of unsaturated fatty acids to saturated fatty acids was 1.37:1 and 1.24:1 in the muscle tissue of Shandong black cattle and Luxi cattle, respectively, and the ratio of monounsaturated fatty acids to total fatty acids was 54.28%. The results showed that the fatty acid composition of Shandong black cattle beef was suitable and that the flavor was good. According to previous research, unsaturated fatty acids can reduce plasma cholesterol, enhance antioxidant enzyme activity, and reduce the incidence of coronary heart disease[17]. A high saturated fatty acid content will lead to arteriosclerosis, narrowing of the arteries and other adverse conditions. The average saturated fatty acid and fatty acid contents in ordinary beef are greater than 50%[18]. A high saturated fatty acid content will lead to an increase in blood lipid concentration[19]. The results showed that the saturated fatty acid content in the two kinds of beef was less than 50%, which was lower than the average level. In mammals, intramuscular fat content was positively correlated with meat color and light and shade[20]. Principal component analysis and sequence clustering analysis also found that beef with higher type 1 fiber contained higher intramuscular fat, saturated fatty acid and monounsaturated fatty acid, which gave us a better understanding of different fatty acid composition in skeletal muscle with different metabolic and stretching characteristics[21]. Therefore, Shandong black cattle has better meat performance and significant improvements compared to Luxi cattle, making it a very good germplasm resource for beef cattle. A large number of studies have reported quantitative trait loci (QTLs) that affect different fat deposition sites in different strains and experimental populations. Theoretically, genes involved in lipid metabolism have potential regulatory effects on intramuscular fat content[22]. However, there are few reports on intramuscular fat related molecular markers (DNA maker)[23]. It is of great significance to search for intramuscular fat related marker genes for modern beef cattle breeding. In this study, the longissimus dorsi muscle of Shandong black cattle and Luxi cattle was used, and its transcriptome was detected in 18-month-old individuals to understand the overall gene expression changes between Shandong black cattle (offspring of cloned cattle) and Luxi cattle (clone receptor) and to explore the molecular mechanism regulating the metabolism of fat. Recently, Jin et al. used digital expression profile technology to analyze the transcriptome of subcutaneous adipose tissue of individuals with different thicknesses of subcutaneous adipose tissue in two hybrid varieties and found 36 and 152 differentially expressed genes in the two varieties[24]. Nine genes specifically expressed in skeletal muscle related to intramuscular fat deposition have been identified in cattle[25], but the understanding of fat deposition interaction is not complete. In this study, 1320 genes were identified as significantly differentially expressed in the B group. Among these 1320 genes, 867 were upregulated, and 453 were downregulated. Candidate genes that play an important role in fat metabolism were screened. We founded that the GO functional annotation cluster is divided into three categories: biological process (365 terms), cellular component (45 terms) and molecular function (68 terms), among which biological process accounts for the largest number of genes. We further screened six highly enriched pathways related to fat metabolism, including upregulated genes (COL6A1, COL6A2, COL4A2, ITGA6, COL1A1, HSPG2, DAG1, LAMB2, LAMA3, COL4A6, COL4A5, COL6A3, COL1A2) and downregulated genes (PLIN2, FABP7, PCK1, FABP4, FABP3, PLIN1, GK, ADIPOQ, SCD5). Previous studies have shown that the upregulated genes COL5A3, COL6A2, LAMC2, FN1 and COL3A1 jointly activate CD44 and then positively regulate the docosanoic acid, palmitic acid and trans-oleic acid contents while negatively regulating the tridecanoic acid, stearic acid and cis-5, 8, 11, 14-eicosapentaenoic acid contents in cells[26]. At the same time, we found that differentially expressed genes(PLIN2, FABP7, PCK1, FABP4, FABP3, PLIN1, GK, ADIPOQ, SCD5, LEPR, LEP, ) were enriched in the ECM-receiver interaction pathway, PPAR signaling and focal adhesion pathway, which negatively regulate polyunsaturated fatty acids, stearic acid and linoleic acid (P > 0.05). It is worth noting that we found that the significant enrichment pathway of upregulated genes and down regulated genes, PPAR signaling pathway and AMPK signaling pathway are highly representative pathways of lipid metabolism in Shandong black cattle, candidate marker genes affecting lipid metabolism were further screened. The PPAR signaling pathway plays an important role in regulating lipid metabolism, adipogenesis, insulin sensitivity, inflammatory response, cell growth and differentiation. It has been reported that PPAR family consists of three subtypes PPARα, PPARβ/δ and PPARγ, which play different roles in different tissues and belong to nuclear receptor superfamily ligand activated transcription factors. PPARα was mainly expressed in liver, heart and brown adipose tissue, which was the activator of fatty acid oxidation. PPARβ/δ was widely expressed and played an important role in adipogenic differentiation and adipogenesis[27]. PPARα played an important role in fatty acid oxidation. During the differentiation of preadipocytes, PPARβ/δ preferentially activated PPARγ expression, which was crucial for the subsequent adipogenic differentiation and activation of adipocyte functional genes, such as glucose transporter (GLUT4), fatty acid binding protein (FABP4), adiponectin(ADIPOQ), leptin(LEPR, LEP,) and other related genes. The known target genes of PPARα (PLIN1, PLIN3, LIPE, and FABP4) are related to almost all aspects of lipid metabolism and affect the transcription of various fatty acid transport and metabolism genes, among other roles[28]. FABP4, the known target gene of PPARα, has potential marbling prediction ability among different varieties[29]. In the present study, ADIPOQ, PLIN1, PLIN2, PLIN3, LIPE, FABP4, FABP3 and FABP7 were all downregulated, indicating that differences in the above fatty metabolism genes may promote the fatty acid-related metabolism pathway of beef cattle and positively regulate polyunsaturated fatty acids, stearic acid and linoleic acid (P > 0.05). The comparative analysis of expression profiles showed that the genes regulating fatty acid biosynthesis, such as FABP4, PLIN1 and LIPE, were highly expressed in Shandong black cattle, while the myogenic genes, namely, MYL3 and MYLPF, were highly expressed in Luxi cattle, which initially revealed the genetic basis of the high intramuscular fat content in Shandong black cattle at the molecular level. These studies show that the degree of intramuscular fat deposition depends on the breed. Combined with transcriptome data analysis, we found that ADIPOQ and FABP4 were expressed in lipolysis regulation, AMPK signaling pathway, adipocytokine signaling pathway and PPAR signaling pathway. Network analysis showed that PPARGC1A, ADCY4, ANKRD6, COL1A1 and FABP4, ADIPOQ, PLIN1, PLIN2 and LIPE genes were related to a large number of genes, which were the key loci of various metabolic pathways. FABP4 and ADIPOQ had 7 common regulatory factors in different genes, which were PLIN1, PLIN2, PPARGC1A, RXRA, PCK1, LEPR, LEP. These genes were involved in regulation of lipolysis in adpocytes, adpocytokine signaling pathway, PPAR signaling pathway. Gene expression appears to provide a simple assay for identification of the source of fatty acid for the deposition of intramuscular fat deposition[30]. FABP4 and ADIPOQ were selected as important candidate marker genes for fat deposition based on the results. We provided phenotype data of these 6 cattle in method, such as body weight before the kill, body composition and other available measurements. At the same time these data were also fitted to a linear model, and the selected FABP4 and ADPIOQ genes were analyzed for the association of expression amounts. The results are shown in supplement file (attachment 9: Fig. S6 and attachment 10: Fig. S7). In the phenotypic data of the six trial cattle, we found that the body weight, body length, tube circumference, chest circumference, back fat and carcass weight were positively correlated with the expression of FABP4 and ADPIOQ genes. Specially the FABP4 and ADPIOQ had the highest correlation coefficient with body weight and chest circumference, but FABP4 had stronger correlation with phenotypic data such as body weight and chest circumference.The aim of our study is to select marker candidate genes that affect fat deposition in our bred hybrid cattle. This result is particularly meaningful to us. We will further study this result and dig up the SNP sites that can be labeled. We deeply know that the above results are limited to these 6 trial cattle, which has great limitations on the scientificalness of the experimental results. It is worth noting that q-PCR and western blot in our study only confirmed the expression of RNA-seq identified genes in these 6 cattle, and the sample size had significant limitations on independent validation. Therefore, we will carry out biological verification in the following study to improve the scientific accuracy of this study. On this basis, it is necessary to continue to search for marker sites that can provide gene resources and a theoretical basis for the selection of beef fat traits and the cultivation of new breeds. Adiponectin (ADIPOQ) is a kind of adipocytokine mainly secreted by adipose tissue. Through the action of ADIPOR1 and ADIPOR2, it can activate the signaling pathway of AMPK and PPAR α and inhibit lipid synthesis[31,32]. Recently, researchers also found that some factors (such as ATGL and HSL) can act downstream of AMPK and mediate the lipid-lowering effect of ADIPOQ[33]. The data suggested ADIPOQ activated PPARα signaling to increase FGF21 expression and secretion, leading to 1.36 times increase in plasma FGF21 concentration, which suppressed lipolysis in white adipose tissue (WAT). It has been found that ADIPOQ gene plays an important role in lipid metabolism by promoting fatty acid oxidation and inhibiting lipid synthesis[34]. So far, the research on regulating animal lipid metabolism by ADIPOQ gene is mainly focused on human and rodents, but less on livestock and poultry[35]. In the early fattening stage, the expression level of ADIPOQ gene was positively correlated with intramuscular fat content[36], while it was negatively correlated with intramuscular fat content at the late fattening stage[37]. These results suggest that ADIPOQ gene plays an important role in adipogenesis and metabolism, and may be an important candidate gene affecting intramuscular fat. In this study, the expression profile and protein immunoblotting results showed that the transcription of ADIPOQ was downregulated, the expression level in Luxi cattle was significantly lower than that in Shandong black cattle, and there were many DEGs associated with metabolic pathways (regulation of lipolysis in adipocytes, AMPK signaling pathway, adipocytokine signaling pathway and PPAR signaling pathway), which were involved in the process of intramuscular fat regulation and are important candidate genes for the study of livestock meat quality. Based on these findings, further exploration of molecular marker sites in these genes is needed. FABP4 was another downregulated DEG found in our study. It not only is involved in the differentiation of fat cells in the PPAR signaling pathway and responsible for the transport of extracellular fatty acids but also plays a role in the lipolysis and fatty acid transport of different tissues[38-40]. Previous studies have shown that the expression of FABP4 is significantly increased during the process of fat differentiation. In the absence of FABP4, the efficiency of fat deposition of adipocytes is significantly reduced[40,41]. Hoashi et al. showed that the i74v mutation in the FABP4 gene was significantly related to the c16:1 content of fatty acids in 234 Shandong black cattle[42]. Guo studies have shown that FABP4 gene expression can determine the difference of IMF in the two species of cattle and sheep[43]. In 2012, A study of fatty acid composition in the muscle of Korean yellow cattle showed that the c14:0, c16:0 and c20:4 contents were significantly related to the g.3691g > a SNP site of the FABP4 gene[44]. In this study, FABP4 was selected as a key candidate gene for improving beef quality. The expression of FABP4 in the longissimus dorsi muscle of Shandong black cattle was significantly higher than that of Luxi cattle, which will have a significant effect on cattle improvement.

Conclusions

In conclusion, through RNA-Seq analysis, a series of genes related to fatty acid metabolism were observed in Shandong black cattle and Luxi cattle, and ADIPOQ and FABP4, which are important candidate marker genes affecting fat deposition, were screened. At the same time, based on the correlation analysis of growth traits of the cattle, high-efficiency breeding for production performance, the establishment of a molecular marker database for local cattle and germplasm resources are expected to result from the findings of this study. The results can also provide a molecular genetic basis for conservation and utilization. Supplementary Information 1. Supplementary Information 2. Supplementary Information 3.
  31 in total

1.  Mapping and quantifying mammalian transcriptomes by RNA-Seq.

Authors:  Ali Mortazavi; Brian A Williams; Kenneth McCue; Lorian Schaeffer; Barbara Wold
Journal:  Nat Methods       Date:  2008-05-30       Impact factor: 28.547

2.  Fat pad-derived mesenchymal stem cells as a potential source for cell-based adipose tissue repair strategies.

Authors:  W S Khan; A B Adesida; S R Tew; U G Longo; T E Hardingham
Journal:  Cell Prolif       Date:  2012-01-20       Impact factor: 6.831

Review 3.  Cytoplasmic fatty acid-binding proteins: emerging roles in metabolism and atherosclerosis.

Authors:  Jeffrey B Boord; Sergio Fazio; MacRae F Linton
Journal:  Curr Opin Lipidol       Date:  2002-04       Impact factor: 4.776

4.  Genetic variants of the FABP4 gene are associated with marbling scores and meat quality grades in Hanwoo (Korean cattle).

Authors:  Sung-Chul Shin; Jae-Pil Heo; Eui-Ryong Chung
Journal:  Mol Biol Rep       Date:  2011-12-17       Impact factor: 2.316

5.  Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project.

Authors:  Ewan Birney; John A Stamatoyannopoulos; Anindya Dutta; Roderic Guigó; Thomas R Gingeras; Elliott H Margulies; Zhiping Weng; Michael Snyder; Emmanouil T Dermitzakis; Robert E Thurman; Michael S Kuehn; Christopher M Taylor; Shane Neph; Christoph M Koch; Saurabh Asthana; Ankit Malhotra; Ivan Adzhubei; Jason A Greenbaum; Robert M Andrews; Paul Flicek; Patrick J Boyle; Hua Cao; Nigel P Carter; Gayle K Clelland; Sean Davis; Nathan Day; Pawandeep Dhami; Shane C Dillon; Michael O Dorschner; Heike Fiegler; Paul G Giresi; Jeff Goldy; Michael Hawrylycz; Andrew Haydock; Richard Humbert; Keith D James; Brett E Johnson; Ericka M Johnson; Tristan T Frum; Elizabeth R Rosenzweig; Neerja Karnani; Kirsten Lee; Gregory C Lefebvre; Patrick A Navas; Fidencio Neri; Stephen C J Parker; Peter J Sabo; Richard Sandstrom; Anthony Shafer; David Vetrie; Molly Weaver; Sarah Wilcox; Man Yu; Francis S Collins; Job Dekker; Jason D Lieb; Thomas D Tullius; Gregory E Crawford; Shamil Sunyaev; William S Noble; Ian Dunham; France Denoeud; Alexandre Reymond; Philipp Kapranov; Joel Rozowsky; Deyou Zheng; Robert Castelo; Adam Frankish; Jennifer Harrow; Srinka Ghosh; Albin Sandelin; Ivo L Hofacker; Robert Baertsch; Damian Keefe; Sujit Dike; Jill Cheng; Heather A Hirsch; Edward A Sekinger; Julien Lagarde; Josep F Abril; Atif Shahab; Christoph Flamm; Claudia Fried; Jörg Hackermüller; Jana Hertel; Manja Lindemeyer; Kristin Missal; Andrea Tanzer; Stefan Washietl; Jan Korbel; Olof Emanuelsson; Jakob S Pedersen; Nancy Holroyd; Ruth Taylor; David Swarbreck; Nicholas Matthews; Mark C Dickson; Daryl J Thomas; Matthew T Weirauch; James Gilbert; Jorg Drenkow; Ian Bell; XiaoDong Zhao; K G Srinivasan; Wing-Kin Sung; Hong Sain Ooi; Kuo Ping Chiu; Sylvain Foissac; Tyler Alioto; Michael Brent; Lior Pachter; Michael L Tress; Alfonso Valencia; Siew Woh Choo; Chiou Yu Choo; Catherine Ucla; Caroline Manzano; Carine Wyss; Evelyn Cheung; Taane G Clark; James B Brown; Madhavan Ganesh; Sandeep Patel; Hari Tammana; Jacqueline Chrast; Charlotte N Henrichsen; Chikatoshi Kai; Jun Kawai; Ugrappa Nagalakshmi; Jiaqian Wu; Zheng Lian; Jin Lian; Peter Newburger; Xueqing Zhang; Peter Bickel; John S Mattick; Piero Carninci; Yoshihide Hayashizaki; Sherman Weissman; Tim Hubbard; Richard M Myers; Jane Rogers; Peter F Stadler; Todd M Lowe; Chia-Lin Wei; Yijun Ruan; Kevin Struhl; Mark Gerstein; Stylianos E Antonarakis; Yutao Fu; Eric D Green; Ulaş Karaöz; Adam Siepel; James Taylor; Laura A Liefer; Kris A Wetterstrand; Peter J Good; Elise A Feingold; Mark S Guyer; Gregory M Cooper; George Asimenos; Colin N Dewey; Minmei Hou; Sergey Nikolaev; Juan I Montoya-Burgos; Ari Löytynoja; Simon Whelan; Fabio Pardi; Tim Massingham; Haiyan Huang; Nancy R Zhang; Ian Holmes; James C Mullikin; Abel Ureta-Vidal; Benedict Paten; Michael Seringhaus; Deanna Church; Kate Rosenbloom; W James Kent; Eric A Stone; Serafim Batzoglou; Nick Goldman; Ross C Hardison; David Haussler; Webb Miller; Arend Sidow; Nathan D Trinklein; Zhengdong D Zhang; Leah Barrera; Rhona Stuart; David C King; Adam Ameur; Stefan Enroth; Mark C Bieda; Jonghwan Kim; Akshay A Bhinge; Nan Jiang; Jun Liu; Fei Yao; Vinsensius B Vega; Charlie W H Lee; Patrick Ng; Atif Shahab; Annie Yang; Zarmik Moqtaderi; Zhou Zhu; Xiaoqin Xu; Sharon Squazzo; Matthew J Oberley; David Inman; Michael A Singer; Todd A Richmond; Kyle J Munn; Alvaro Rada-Iglesias; Ola Wallerman; Jan Komorowski; Joanna C Fowler; Phillippe Couttet; Alexander W Bruce; Oliver M Dovey; Peter D Ellis; Cordelia F Langford; David A Nix; Ghia Euskirchen; Stephen Hartman; Alexander E Urban; Peter Kraus; Sara Van Calcar; Nate Heintzman; Tae Hoon Kim; Kun Wang; Chunxu Qu; Gary Hon; Rosa Luna; Christopher K Glass; M Geoff Rosenfeld; Shelley Force Aldred; Sara J Cooper; Anason Halees; Jane M Lin; Hennady P Shulha; Xiaoling Zhang; Mousheng Xu; Jaafar N S Haidar; Yong Yu; Yijun Ruan; Vishwanath R Iyer; Roland D Green; Claes Wadelius; Peggy J Farnham; Bing Ren; Rachel A Harte; Angie S Hinrichs; Heather Trumbower; Hiram Clawson; Jennifer Hillman-Jackson; Ann S Zweig; Kayla Smith; Archana Thakkapallayil; Galt Barber; Robert M Kuhn; Donna Karolchik; Lluis Armengol; Christine P Bird; Paul I W de Bakker; Andrew D Kern; Nuria Lopez-Bigas; Joel D Martin; Barbara E Stranger; Abigail Woodroffe; Eugene Davydov; Antigone Dimas; Eduardo Eyras; Ingileif B Hallgrímsdóttir; Julian Huppert; Michael C Zody; Gonçalo R Abecasis; Xavier Estivill; Gerard G Bouffard; Xiaobin Guan; Nancy F Hansen; Jacquelyn R Idol; Valerie V B Maduro; Baishali Maskeri; Jennifer C McDowell; Morgan Park; Pamela J Thomas; Alice C Young; Robert W Blakesley; Donna M Muzny; Erica Sodergren; David A Wheeler; Kim C Worley; Huaiyang Jiang; George M Weinstock; Richard A Gibbs; Tina Graves; Robert Fulton; Elaine R Mardis; Richard K Wilson; Michele Clamp; James Cuff; Sante Gnerre; David B Jaffe; Jean L Chang; Kerstin Lindblad-Toh; Eric S Lander; Maxim Koriabine; Mikhail Nefedov; Kazutoyo Osoegawa; Yuko Yoshinaga; Baoli Zhu; Pieter J de Jong
Journal:  Nature       Date:  2007-06-14       Impact factor: 49.962

6.  Interaction of rat hormone-sensitive lipase with adipocyte lipid-binding protein.

Authors:  W J Shen; K Sridhar; D A Bernlohr; F B Kraemer
Journal:  Proc Natl Acad Sci U S A       Date:  1999-05-11       Impact factor: 11.205

7.  RNAi-mediated germline knockdown of FABP4 increases body weight but does not improve the deranged nutrient metabolism of diet-induced obese mice.

Authors:  R Yang; G Castriota; Y Chen; M A Cleary; K Ellsworth; M K Shin; J-Lv Tran; T F Vogt; M Wu; S Xu; X Yang; B B Zhang; J P Berger; S A Qureshi
Journal:  Int J Obes (Lond)       Date:  2010-07-06       Impact factor: 5.095

8.  Inducible overexpression of adiponectin receptors highlight the roles of adiponectin-induced ceramidase signaling in lipid and glucose homeostasis.

Authors:  William L Holland; Jonathan Y Xia; Joshua A Johnson; Kai Sun; Mackenzie J Pearson; Ankit X Sharma; Ezekiel Quittner-Strom; Trevor S Tippetts; Ruth Gordillo; Philipp E Scherer
Journal:  Mol Metab       Date:  2017-01-12       Impact factor: 7.422

9.  Pharmacological activation of PPARbeta promotes rapid and calcineurin-dependent fiber remodeling and angiogenesis in mouse skeletal muscle.

Authors:  Céline Gaudel; Chantal Schwartz; Christian Giordano; Nada A Abumrad; Paul A Grimaldi
Journal:  Am J Physiol Endocrinol Metab       Date:  2008-05-20       Impact factor: 5.900

10.  Association between fatty acid compositions and genotypes of FABP4 and LXR-alpha in Japanese black cattle.

Authors:  Shogo Hoashi; Tomoko Hinenoya; Atsuko Tanaka; Hideki Ohsaki; Shinji Sasazaki; Masaaki Taniguchi; Kenji Oyama; Fumio Mukai; Hideyuki Mannen
Journal:  BMC Genet       Date:  2008-12-11       Impact factor: 2.797

View more
  5 in total

1.  Genetic Variations within the Bovine CRY2 Gene Are Significantly Associated with Carcass Traits.

Authors:  Xuelan Li; Enhui Jiang; Kejing Zhang; Sihuan Zhang; Fugui Jiang; Enliang Song; Hong Chen; Peng Guo; Xianyong Lan
Journal:  Animals (Basel)       Date:  2022-06-23       Impact factor: 3.231

2.  Genome-Wide Identification and Characterization of Long Non-Coding RNAs in Longissimus dorsi Skeletal Muscle of Shandong Black Cattle and Luxi Cattle.

Authors:  Ruili Liu; Mingxuan Han; Xianxun Liu; Kun Yu; Xuejin Bai; Yajuan Dong
Journal:  Front Genet       Date:  2022-05-16       Impact factor: 4.772

3.  RNA-Seq Reveals Function of Bta-miR-149-5p in the Regulation of Bovine Adipocyte Differentiation.

Authors:  Hongfang Guo; Rajwali Khan; Sayed Haidar Abbas Raza; Syed Muhammad Suhail; Hamayun Khan; Sher Bahadar Khan; Ayman Hassan Abd El-Aziz; Linsen Zan
Journal:  Animals (Basel)       Date:  2021-04-22       Impact factor: 2.752

4.  Interference With ACSL1 Gene in Bovine Adipocytes: Transcriptome Profiling of mRNA and lncRNA Related to Unsaturated Fatty Acid Synthesis.

Authors:  Yanbin Bai; Xupeng Li; Zongchang Chen; Jingsheng Li; Hongshan Tian; Yong Ma; Sayed Haidar Abbas Raza; Bingang Shi; Xiangmin Han; Yuzhu Luo; Jiang Hu; Jiqing Wang; Xiu Liu; Shaobin Li; Zhidong Zhao
Journal:  Front Vet Sci       Date:  2021-12-16

5.  Transcriptome study digs out BMP2 involved in adipogenesis in sheep tails.

Authors:  Meilin Jin; Xiaojuan Fei; Taotao Li; Zengkui Lu; Mingxing Chu; Ran Di; Xiaoyun He; Xiangyu Wang; Caihong Wei
Journal:  BMC Genomics       Date:  2022-06-21       Impact factor: 4.547

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.