Literature DB >> 33312721

Effect of C-phycocyanin on HDAC3 and miRNA-335 in Alzheimer's disease.

Zhengyu Li1, Li Gan1, Si Yan1, Yufang Yan1, Wei Huang1.   

Abstract

BACKGROUND: Amyloid-beta (Aβ) plaque deposits and neurofibrillary tangles containing tau proteins are the key pathognomonic manifestations of Alzheimer's disease (AD). Lack of holistic drugs for AD has reinvigorated enthusiasm in the natural product-based therapies. In this study, our idea to decipher the beneficial effects of C-phycocyanin (CPC) in the management of AD is buoyed by its multifaceted and holistic therapeutic effects.
METHODS: We evaluated the effect of CPC treatment on epigenetic factors and inflammatory mediators in a mouse with oligomeric Aβ1-42-induced AD. Besides, the cognitive function was evaluated by the spatial memory performance on a radial arm maze.
RESULTS: The results showed cognitive deficit in the mice with AD along with upregulated HDAC3 expression and diminished miRNA-335 and brain-derived neurotrophic factor (BDNF) expressions. In addition, inflammation was provoked (manifested by increased interleukins (IL)-6 and IL-1β) and neuronal apoptosis was accelerated (indicated by increased Bax, caspase-3, and caspase-9 along with decreased Bcl2) in the hippocampus of the mice with AD. Interestingly, CPC treatment in the mice with AD improved spatial memory performance and decreased the perturbations in the epigenetic and inflammatory biofactors.
CONCLUSION: These results underscore that mitigation of inflammation via regulation of epigenetic factors might be the key pathway underlying the ameliorative effect of CPC against the aberrations in AD. Our findings provide the rationale for considering CPC as a viable therapeutic option in the management of AD.
© 2020 Zhengyu Li et al., published by De Gruyter.

Entities:  

Keywords:  Alzheimer’s disease; C-phycocyanin; HDAC3; amyloid beta-peptide; miRNA-335

Year:  2020        PMID: 33312721      PMCID: PMC7705988          DOI: 10.1515/tnsci-2020-0101

Source DB:  PubMed          Journal:  Transl Neurosci        ISSN: 2081-6936            Impact factor:   1.757


Background

Alzheimer’s disease (AD) is an ultimately fatal, degenerative brain disease in the elderly population. Senile plaques with amyloid-beta (Aβ) peptides in the extracellular milieu, neurofibrillary tangles encompassing tau proteins, and synapse dysfunction and the associated neuronal loss are the key pathognomonic of AD [1]. There are evidences indicating that AD is a metabolic disease caused by the alterations in the brain metabolites [2]. According to a recent report by Alzheimer’s Disease International (ADI), globally, 50 million people are living with dementia and it will burgeon to more than 150 million by 2050 [3]. Despite several endeavors to develop a safe and effective drug candidate for AD, only four drugs have been approved in the past two decades. Notably, an unusual 99.6% failure rate is observed in the drug discovery for AD [4]. This indicates the need to identify the most potential therapeutic target and develop an effective drug. Although various therapeutic targets and mechanisms have been proposed for successful drug design for AD, amyloid and tau-based theories are the commonly accepted hypotheses. Although amyloid hypothesis explains the neurodegenerative effect of Aβ plaques, the distal pathological effects of Aβ peptides demand the need for an alternative hypothesis. In line with this, Aβ oligomer hypothesis proposed that soluble forms of Aβ oligomers cause neurodegeneration of the brain regions with/without amyloid plaque deposits [5]. Moreover, oligomeric Aβ peptides exhibit more deleterious effects than Aβ monomers and the fibrillar forms in the brain [6]. It is well known that soluble Aβ oligomers cause cognitive dysfunction by eliciting various synaptotoxic/neurotoxic events in various research models [7]. Neuropathological researches in AD underscored that hippocampus is one of the first regions in brain affected by the accumulation of oligomeric Aβ peptides [8]. In rodents, hippocampal lesions have been shown to negatively affect the spatial memory and spatial navigation capabilities [9]. Hippocampal place cells and time cells function in a coherent manner, which facilitate the learning of spatio-temporal relationships through an integrated cognitive mapping [10]. Mably et al. demonstrated that functional aberrations of hippocampal place cells’ rhythm may result in spatial disorientation and pertinent spatial memory problems in AD [11]. However, the cascade of events and the intact role of various molecular entities involved in the pathology of AD still remain elusive. Emerging evidences are accentuating the key pathological role of epigenetic mechanisms in AD [12]. The modulations in genetic expression without any makeover in DNA sequence are studied by epigenetics; it is focused on various genetic/chromatin modifications, including histone acetylation, histone methylation, regulation of non-coding RNAs, and DNA methylation. Griñán-Ferré et al. showed that epigenetic abnormalities may lead to neuroinflammation and cognitive impairment in 5XFAD mice [13]. A heap of research reports advocate that abnormal glial activation-mediated neuroinflammation is a pivotal mechanism in AD pathogenesis [14,15]. Besides, Benito et al. proposed that histone deacetylase (HDAC) inhibition effectively improved the spatial memory by modulating the epigenetic dyshomeostasis and inflammatory conditions in AD [16]. Researchers in the recent decades have been focusing on the development of natural bioactive products to treat the neurodegenerative diseases like AD [17]. C-phycocyanin (CPC) is a phycobiliprotein pigment and also a vital phytocomponent of Spirulina platensis, an edible blue-green alga. It also exhibits anti-inflammatory, antioxidant, neuroprotective, hepatoprotective, nephroprotective, and wound healing effects [18,19,20,21,22]. Singh et al. [23] reported that phycocyanin might offer neuroprotection in AD by inhibiting the activity of β-secretase. In this study, based on the above evidence, we hypothesized that treatment with CPC exhibits beneficial effect on the cognitive (spatial memory) impairment, epigenetic dysregulation, and neuroinflammation in an oligomeric Aβ1–42-induced AD mice model.

Materials and methods

Chemical products

CPC (purity: A620/A280 ≥ 4, obtained from S. platensis) and synthetic Aβ1–42 peptides (Figure 1) were purchased from Far East Bio-Tec Co., Ltd (Taipei, Taiwan) and American Peptide Co., (Sunnyvale, CA), respectively. Unless specified, all other chemicals used in the study were of analytical grade and purchased from local companies.
Figure 1

Chemical structure of (a) CPC and (b) Aβ peptide sequence.

Chemical structure of (a) CPC and (b) Aβ peptide sequence.

Animals

Forty male C57BL/6 mice, weighing 23–25 g, were housed in a temperature-controlled environment (12 h/12 h L/D cycles) and allowed for ad libitum energy intake. Every mouse was handled for about 5 min every day for 3 sequential days to get them acclimatized; this was done 2 days after their procurement from the animal house. Ethical approval: The research related to animals use has been complied with all the relevant national regulations and institutional policies for the care and use of animals.

Preparation of Aβ1–42 oligomers

Aβ oligomers were prepared from Aβ1–42 peptide, as described by Klein [24]. Briefly, ice-cold Aβ1–42 peptide was dissolved in an ice-cold solution of hexafluoroisopropanol (HFIP; Sigma-Aldrich, USA) to enable dissociation of any Aβ aggregates and a final concentration of 1 mM HFIP was made. The Aβ–HFIP mixture was kept aside for 1 h incubation period. Then, the solution was kept on ice and vortexed and aliquoted into Eppendorf tubes, and HFIP was allowed to evaporate by leaving the tubes overnight. The lyophilized sample was again suspended in anhydrous dimethyl sulfoxide (Merck, USA) to make a 5 mM stock solution of Aβ oligomer. The resulting mixture containing insoluble fibrillar aggregates and soluble oligomeric Aβ peptides was processed with Ham’s F-12 medium. Finally, the supernatant solution containing oligomeric forms of Aβ peptides was separated and stored at 4℃ until required.

Neurodegeneration and drug treatment protocol

Mice were separated into four groups (n = 10 each): sham-operated mice (saline injected i.c.v.), oligomeric Aβ1–42-intoxicated mice with AD (single i.c.v. injection), CPC (200 mg/kg for 2 weeks, intraperitoneal injection of saline) [25], and oligomeric Aβ1–42 + CPC. All the animals were deeply anesthetized intraperitoneally with a solution containing ketamine (100 mg/kg) and xylazine (10 mg/kg) and placed on a stereotaxic apparatus. Then, oligomeric Aβ1–42 peptide solution or saline was injected into the lateral ventricle according to the following stereotaxic coordinates: anterior–posterior distance from the bregma (−0.6 mm), medial–lateral distance from the bregma (1.2 mm), and dorsal–ventral distance from the bregma (−2 mm).

Cognitive assessment using radial arm maze

Both reference and working components of spatial memory were investigated on an eight-arm radial maze, as described by Brown et al. [26]. During the habituation phase, the food baits (sunflower seeds) were scattered throughout the maze, and the animals were permitted to explore the maze for about 5 min per trial twice a day for 2 days. Next, one food bait was placed in the training phase, and the mice were exposed to the maze in a similar manner. During these phases, the memory errors were not recorded, as these trials are aimed at reducing the errors in the radial arm maze (RAM) task. In the testing phase, alternate arms of the RAM were baited and assessed for spatial working and reference memory capabilities for about 10 consecutive days. The trial was interrupted when all food baits were eaten or after a 5-min period, whichever is earlier. Error recording was scored based on three outcomes, as proposed by Schmitt et al. [27]: reference memory errors (RME), defined as the sum of entries into never baited arms. The working memory errors were further evaluated as “correct” working memory errors (CWME), defined as the sum of reentries into baited arm, and “incorrect” working memory errors (IWME), defined as the sum of reentries into an arm without any bait.

Isolation of RNA and RT-PCR analysis

After spatial memory performance investigation, the hippocampi were taken out on ice from the excised brains of all the mice. To perform the RT-PCR analysis, total RNA was extracted from the hippocampi using total RNA isolation kit – Rneasy (Qiagen, Valencia, CA). The target gene expression was normalized using β-actin gene as the control in each sample. The following PCR primers were used for the analysis – β-actin: F: TCTTGGGTATGGAATCCTGTG and R: ATCTCCTTCTGCATCCTGTCA; caspase-3: F: TGTCATCTCGCTCTGGTACG and R: CCCTTTCTGCCTGTCTTCTG; caspase-9: F: CATCCTTGTGTCCTACTCCACC and R: CAGCTTTTTCCGGAGGAAGT; miR-335-5p: UCAAGAGCAAUAACGAAAAAUG; and miR-335-3p: UUUUUCAUUAUUGCUCCUGACC.

Western blot analysis

The hippocampal tissues were chopped and homogenized in ice-cold radio-immunoprecipitation assay using an electric homogenizer. The homogenized solution was centrifuged at 16,000 × g at 4℃ for 20 min to obtain the supernatant containing proteins. The protein assay reagent from Bio-Rad Laboratories (Hercules, CA) was used for the protein assay. The SDS–polyacrylamide gel was used along with the Tris buffer system to separate the proteins, which are then impregnated to a polyvinylidene difluoride membrane (Millipore, Billerica, MA). The membrane was blocked after washing with a blocking solution, followed by overnight incubation with specific primary antibodies: BDNF (1:2,000; Abcam, Cambridge, UK), HDAC3 (1:1,000; Cell Signaling, Danvers, MA, USA), Bcl2 (1:2,000; Abcam, Cambridge, UK), Bax (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), IL-6 (1:500; Abcam, Cambridge, UK), and IL-1β (1:500; Proteintech, USA). The membranes were washed and subsequently incubated with secondary horseradish peroxidase–conjugated antibodies (Santa Cruz Biotechnology, Inc., CA). Finally, quantitative analysis of the reactive bands was done with the Tanon imaging system.

Immunohistochemical measurement of Bcl2 and Bax

According to the instructions of the immunohistochemical staining kit, the pretreated hippocampal sections were treated with 3% H2O2 and then subjected to microwave oven heating with 10 mM citrate buffer (pH 6.0) for 10 min, followed by serum blocking procedures. The corresponding primary antibodies for Bcl2 and Bax (Beijing Biosynthesis Biotechnology Co., Ltd, China) were added, and the tissue sections were incubated overnight at 4℃. The secondary antibody was then added and incubated for 30 min and treated with 3,3′-diaminobenzidine, a chromogen for brown staining. The stained slides were analyzed by Image-Pro Plus image analysis system (Media Cybernetics, USA).

Immunofluorescence analysis

The hippocampal slices from the animal cohorts were fixed in 4% phosphate-buffered saline (PBS) (pH 7.4), and cryosections of 3 μm thickness were made. The sections were washed with PBS and permeabilized with 0.3% Triton X-100 and 0.05% Tween-20 in PBS, followed by treatment with a blocking buffer (5% normal goat serum) for 1 h at room temperature. Subsequently, the sections were incubated overnight at 4℃ with primary antibodies BDNF (1:500; Boster Bio, USA) and HDAC3 (1:500; Boster Bio, USA) in a humidified compartment. The sections prewashed with PBS were incubated with Alexa-Fluor secondary antibodies (1:250; Invitrogen, Oregon, USA). Finally, the tissue sections were washed with PBS and examined the under fluorescence microscope (Olympus FV1000, Japan).

Statistical analyses

SPSS software (V13.0; SPSS, Inc., Chicago, USA) was used for the statistical evaluation, and the experimental data are indicated as mean ± S.D. For the behavioral assessment (RAM tasks), one-way analysis of variance (ANOVA) was applied. For the biochemical evaluations, one-way ANOVA was applied using Tukey’s post-hoc test for comparisons among different animal groups. Statistical differences for all analyses were considered significant at P < 0.05 level.

Results

CPC treatment prevents cognitive dysfunction induced by Aβ

The effect of CPC on the cognitive (spatial memory) functions of the mice injected with Aβ was assessed using an eight-arm radial maze. In the RAM paradigm, utilizing alternately baited arms challenges the ability of mice to manage both short-term working and long-term reference memory components. Although several brain regions are involved in the RAM task, successful spatial working memory navigation depends mainly on the hippocampal activity [28]. The Aβ-injected mice showed a remarkable increase (P < 0.05) in reference and working memory errors (RME: 1.8-fold; CWME: 1.6 fold; IWME: 2-fold increase vs sham) in finding the baits, as compared with the control mice (Figure 2a–c). This indicates the possible damage in the hippocampus in the Aβ-challenged mice. However, CPC treatment significantly (P < 0.05) attenuated the spatial memory deficits in the mice injected with Aβ.
Figure 2

Effect of CPC treatment on the spatial reference and working memory functions against Aβ. (a) RME measured as a day/group function; (b) CWME measured as a day/group function; (c) IWME measured as a day/group function. Data are indicated as mean ± S.D. (n = 10 in each group). *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone).

Effect of CPC treatment on the spatial reference and working memory functions against Aβ. (a) RME measured as a day/group function; (b) CWME measured as a day/group function; (c) IWME measured as a day/group function. Data are indicated as mean ± S.D. (n = 10 in each group). *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone).

Inhibitory effect of CPC on epigenetic dysregulation induced by Aβ

Perturbation in the histone deacetylation and miRNA elements of the epigenetic system is one of the key disruptive events in Aβ neurotoxicity. We observed that HDAC3 and miRNA-335 function differentially: in the Aβ-intoxicated mice, the HDAC3 expression was significantly (P < 0.05) amplified (3-fold), while a significant (P < 0.05) downregulation (76%) in the miRNA-335 expression was observed (Figure 3). The expression of BDNF, one of the key genes involved in the synaptic plasticity and memory functions, was found to be significantly (P < 0.05) reduced to 24% in the Aβ group, when compared with the control group. These changes were restored in the hippocampal tissues of the CPC-treated AD mice (Figure 3). To validate the western blot findings, we further assessed the expression pattern of HDAC3 and BDNF using immunofluorescence analysis, which showed that HDAC3 expression is down-modulated and BDNF expression is up-modulated in the CPC group against Aβ toxicity (Figure 3e and f).
Figure 3

CPC treatment alters HDAC3, BDNF, and miRNA-335 expressions in the Aβ-challenged mice. (a) Representative bands of HDAC3 and BDNF expressions with β-actin as an internal control. (b) Densitometric assessment of HDAC3/β-actin and BDNF/β-actin, represented as % of control. (c) Indicative RT-PCR image of miRNA-335 expression in various animal groups. (d) Relative miRNA-335 expression level in each group. Data are indicated as mean ± S.D. *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone). (e) Shown are representative images of BDNF and HDAC3 expressions in various animal groups. (f) Quantitative assessment of BDNF and HDAC3 expressions, represented as % of control.

CPC treatment alters HDAC3, BDNF, and miRNA-335 expressions in the Aβ-challenged mice. (a) Representative bands of HDAC3 and BDNF expressions with β-actin as an internal control. (b) Densitometric assessment of HDAC3/β-actin and BDNF/β-actin, represented as % of control. (c) Indicative RT-PCR image of miRNA-335 expression in various animal groups. (d) Relative miRNA-335 expression level in each group. Data are indicated as mean ± S.D. *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone). (e) Shown are representative images of BDNF and HDAC3 expressions in various animal groups. (f) Quantitative assessment of BDNF and HDAC3 expressions, represented as % of control.

CPC regulates neuroinflammation induced by Aβ

To explore the potential role of CPC in alleviating neuroinflammation, the expression of inflammatory cytokines in the hippocampi of the Aβ-administered mice was studied. According to our western blot results, IL-6 and IL-1β expressions were significantly (P < 0.05) upregulated (3-fold and 1.8-fold, respectively) in the hippocampal tissues challenged with Aβ, whereas treatment with CPC strikingly reduced the oligomeric Aβ–induced IL-6 and IL-1β expressions (Figure 4a and b). These results support the notion that amelioration of the detrimental effects of neuroinflammation and the associated decline in adult neurogenesis might be associated with the restored spatial memory functions in the CPC-treated mice (Figure 4a and b).
Figure 4

CPC treatment alleviates IL-6, IL-1β, caspase-3, and caspase-9 levels in the Aβ-challenged mice. (a) Representative images of IL-6 and IL-1β expressions with β-actin as an internal control. (b) Densitometric assessment of IL-6/β-actin and IL-1β/β-actin, represented as% of control. (c) Indicative RT-PCR image of caspase-3 and caspase-9 expressions in various animal groups. (d) Relative mRNA expression levels of caspase-3 and caspase-9 in each group. Data are indicated as mean ± S.D. *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone).

CPC treatment alleviates IL-6, IL-1β, caspase-3, and caspase-9 levels in the Aβ-challenged mice. (a) Representative images of IL-6 and IL-1β expressions with β-actin as an internal control. (b) Densitometric assessment of IL-6/β-actin and IL-1β/β-actin, represented as% of control. (c) Indicative RT-PCR image of caspase-3 and caspase-9 expressions in various animal groups. (d) Relative mRNA expression levels of caspase-3 and caspase-9 in each group. Data are indicated as mean ± S.D. *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone).

CPC treatment mitigated Aβ-induced upregulation of apoptotic markers

The mechanisms and functions involved in the activation of an array of caspases remain as the mainstay in apoptosis. In this study, we noted that caspase-9 and caspase-3 expressions were significantly (P < 0.05) increased (4-fold and 3-fold, respectively) in the Aβ-induced AD mice (Figure 4c and d). However, CPC treatment was found to uphold the levels of caspases against the oligomeric Aβ-induced neurotoxic assaults. The Bcl-2 family proteins encompass the sentinel regulatory network that modulates the mitochondrial or intrinsic apoptotic processes. Hence, we conjectured that the expression of Bcl2 and Bax might get altered due to Aβ toxicity. As anticipated, the Bcl2 expression was significantly (P < 0.05) repressed (52%) and Bax was significantly (P < 0.05) overactivated (3.8-fold) in the Aβ mice, while these abnormalities were reversed in the hippocampal tissues of the CPC-treated mice (Figure 5a and b). We have validated these results by using immunohistochemical analysis, which revealed that Bax-positive cells were more prominent and Bcl2-positive cells were less expressed in the hippocampus of the Aβ group (Figure 5c and d).
Figure 5

CPC treatment ameliorates Bcl2 and Bax expressions against Aβ in mice. (a) Indicative RT-PCR image of Bcl2 and Bax expressions in various animal groups. (b) Relative levels of Bcl2 and Bax mRNA expressions in each group. Data are indicated as mean ± S.D. *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone). (c) Representative immunohistochemical sections showing Bax and Bcl2 positive cells. (d) Quantitative assessment of Bcl2 and Bax expression, represented as % of positive cells.

CPC treatment ameliorates Bcl2 and Bax expressions against Aβ in mice. (a) Indicative RT-PCR image of Bcl2 and Bax expressions in various animal groups. (b) Relative levels of Bcl2 and Bax mRNA expressions in each group. Data are indicated as mean ± S.D. *P < 0.05 (Aβ compared with sham); # P < 0.05 (CPC plus Aβ compared with Aβ alone). (c) Representative immunohistochemical sections showing Bax and Bcl2 positive cells. (d) Quantitative assessment of Bcl2 and Bax expression, represented as % of positive cells.

Discussion

The results of this study highlight that CPC provides beneficial effects through the modulation of epigenetic factors, followed by the attenuation of inflammation and neuronal apoptosis against oligomeric Aβ-induced neurodegeneration in mice. In this model, intracerebroventricularly injected soluble oligomeric Aβ peptides reach the neurological and glial cells through cerebrospinal fluid influx by the glymphatic (glial + lymphatic) and meningeal lymphatic systems [29]. The physiopathological studies revealed that Aβ is generated from the amyloid precursor protein (APP), which is cleaved by two secretase enzymes: β-secretase, a β-site APP-cleaving secretase, and γ-secretase, an enzyme that produces Aβ peptides [30]. Hence, the drug candidates that are capable of attenuating Aβ formation by inhibiting the secretase enzymes could exhibit beneficial effects in AD. In a transgenic Caenorhabditis elegans worm model of AD, Singh et al. showed that phycocyanin inhibits β-secretase and might offer protection against AD [23]. However, the disappointing clinical trial outcomes with beta-secretase 1 (BACE-1) inhibitors (e.g., aducanumab and verubecestat) indicate that BACE-1 inhibition alone could not successfully treat AD, although this property offer benefits in the management of AD [31,32]. Hence, we inferred that the drugs targeting multiple neuropathological mechanisms and cognitive enhancement associated with AD may prove successful. Cognitive dysfunction manifested by spatial memory loss and perturbations in spatial navigation mechanisms are known to be the early clinical signs of AD, both in rodents and in humans [33,34]. Various models have been proposed to assess the spatial memory impairments in rodents. Zhu et al. demonstrated that degeneration in hippocampal cholinergic synapses leads to impairments in spatial memory in mice with AD [35]. Facchinetti et al. proposed a novel model of AD using intrahippocampal injection of Aβ peptides [36]. This model, although suitable for short-term studies of Aβ1–42 peptides on hippocampus or any specific brain region, demands competent individuals for performing the study. On the other hand, conventional intrahippocampal infusion models might provide erroneous results due to the damage caused by the needle at the injection site. There are multiple evidences to advocate that intracerebroventricular injection of Aβ peptides in mice is a reliable AD model [37,38]. An interesting report by Balducci et al. [39] indicated that intracerebroventricular injection of synthetic Aβ1–42 peptide oligomers hampered long-term memory, while fibrillar Aβ peptides failed to cause memory impairment. In our study, the mice showed spatial memory impairment in the RAM task after intracerebroventricular injection of Aβ. However, treatment with CPC ameliorated the learning and memory deficits in mice with AD. The research reports underscored that CPC might be one of the key constituents in Spirulina maxima or Klamin® (a nutraceutical product) responsible for memory-enhancing effects in the Aβ-injected or prematurely senescent mice models [40,41]. The spatial memory impairments in AD is associated with dysregulated epigenetic mechanisms and hippocampal functions [42,43]. Targeted epigenetic regulation modulates the genes related to synaptic plasticity and neurological functions including memory. Histone acetylation, which is regulated by the equilibrium between histone acetyltransferase and HDAC, is considered to be a fulcrum factor in the pathogenesis of AD via modulation of chromatin structure and accessibility [44]. In recent years, there is an ever increasing focus on the HDAC inhibitors, as abnormal histone acetylation and subsequently altered expression of some key learning and memory genes may lead to cognitive impairment in AD [45,46]. However, most HDAC inhibitors are pan-targeted (nonselective), with many off-targeted side effects. Hence, many researchers have been developing HDAC inhibitors with increased isoform selectivity and improved efficacy and safety. Dual inhibition of histone deacetylases and phosphodiesterase 5 is one of the novel approaches in the treatment of AD [47]. Zhu et al. showed that HDAC3 inhibition in the hippocampal tissue effectively alleviated spatial memory deficits through controlled microglial activation, enhanced dendritic spine density, and decreased Aβ burden in the APP/PS1 mice [48]. In another recent work, lentivirus-mediated HDAC3 inhibition attenuated the Aβ production and ameliorated spatial memory impairment in the hippocampus of the APP/PS1 mice [49]. RGFP-966, a selective HDAC3 silencing agent, decreased Aβ and hyperphosphorylated tau protein burden in the HEK-293 cells and the 3xTg-AD model [42]. In line with this evidence, we observed that mice injected with oligomeric Aβ peptides displayed increased HDAC3 levels, whereas CPC treatment attenuated the HDAC3 expression in the hippocampus. An interesting report by Sartor et al. illustrated that HDAC3 inhibition potentiates BDNF expression and improves neuroplasticity and memory through bromodomain-containing protein 4 (BRD4), an epigenetic reader of histone acetylation [50]. In harmony, this study revealed that spatial memory and BDNF expression were improved in the CPC-treated AD mice. We assume that HDAC3 inhibition and subsequent BRD4 upregulation might be the underpinning reasons behind the biological and functional improvements in the AD mice treated with CPC. In line with this, Pham et al. showed that S. platensis extract, dose- and time-dependently, inhibits HDAC protein levels and exhibits anti-inflammatory activity [19]. Dysregulation of miRNAs, the single-stranded non-coding RNAs, the post-transcriptional regulators of gene expression, is regarded as a critical cause of hippocampal neurodegeneration in AD [51]. In addition, pathological levels of miRNAs are known to impair long-term potentiation and associated learning and memory in AD [52]. Based on the gene regulatory network analysis using Cytoscape, Moradifard et al. showed that miRNA-30a-5p and miRNA-335 are the most prominent regulatory miRNAs in AD [53]. In an earlier study, investigation of miRNA expression profile revealed that miRNA-335 was downregulated in the cortical gray and white matter of the patients with AD [54]. In line with this, we observed that the mice injected with Aβ oligomers showed reduced miRNA-335 expression, while CPC treatment increased the levels of miRNA-335 in the hippocampus. Interestingly, upregulation of miRNA-335 has been shown to reduce apoptosis and knockdown of miRNA-335 amplified the levels of inflammatory mediators including IL-6 and IL-1β [55]. It is well documented that abnormal activation of microglia and astrocytes elevates the inflammatory mediators like chemokines and cytokines in AD [56]. In response to an increase in soluble Aβ oligomeric species, aggregated Aβ plaques, and neurofibrillary tangles of hyperphosphorylated tau proteins, microglial activation occurs in AD, leading to pro-inflammatory response and release of anaphylatoxins. These events trigger the production of APP, which consecutively amplifies Aβ production [14]. Besides, Aβ1–42-activated astrocytes in the brain of Alzheimers patients upregulate nod-like receptor (NLR) family pyrin domain containing 3 (NLRP3), which is a critical regulator of inflammation. NLRP3-inflammasome stimulation triggers the production of caspase-1 and IL-1β [57]. Aβ-intoxicated neurons show attenuated Bcl-2 and also increased levels of Bax through p53 activation, leading to apoptosis [58]. Inhibition of Bax through Bax-inhibiting peptide or the Bax knockout mice model showed decreased oligomeric Aβ-induced neuronal apoptosis [59]. Bax activation subsequently triggers caspase-3 release, leading to neuronal cell death [60]. Tamayev et al. reported that caspase-9 is a pathogenic molecule activated in hippocampal synaptic fractions of Danish dementia knock-in FDD(KI) mice and attenuation of caspase-9 improved memory impairment and synaptic plasticity [61]. In our study, we observed that Aβ-injected mice showed increased levels of caspase-3/9, IL-6, and IL-1β; also, Bax expression was upregulated in the hippocampi, while Bcl2 expression was downregulated, indicating apoptotic cell death, due to inflammation in the AD mice. These outcomes emphasize that inflammation-mediated downregulation of BDNF expression could be the reason underpinning compromised neuroplasticity and cognitive deficit in the AD mice [62]. Nevertheless, CPC treatment ameliorated these abnormalities in the Aβ-challenged mice. Our results are in agreement with an earlier report, which indicated that CPC administration restored the Bax/Bcl2 equilibrium and also attenuated the release of caspase-3 and caspase-9 [63]. Several evidences imply that the herbal source of CPC, S. platensis, is known to exert anti-apoptotic and anti-inflammatory activities [20,21,22]. Figure 6 represents the comprehensive sketch of the molecular mechanisms involved in the ameliorative effect of CPC against Aβ-provoked AD.
Figure 6

Schematic representation of the effect of CPC on Aβ-induced aberrations in the expression of various molecular markers in the mouse hippocampus and declined spatial memory function.

Schematic representation of the effect of CPC on Aβ-induced aberrations in the expression of various molecular markers in the mouse hippocampus and declined spatial memory function.

Conclusion

Taken together, the results of this study portray that CPC might be a putative remedial option in the management of AD. Also, mitigation of inflammation via regulation of epigenetic factors through inhibition of selective histone deacetylation proteins and augmentation of selective microRNAs may serve as a promising strategy to curb neurodegeneration and ameliorate the cognitive deficits in AD. However, further studies are warranted to explore the key molecular switches and regulatory signaling pathways involved in the progression and management of AD.
  62 in total

1.  C-phycocyanin attenuates cisplatin-induced nephrotoxicity in mice.

Authors:  Beom Jin Lim; Jin Young Jeong; Yoon-Kyung Chang; Ki-Ryang Na; Kang Wook Lee; Young-Tai Shin; Dae Eun Choi
Journal:  Ren Fail       Date:  2012-06-08       Impact factor: 2.606

Review 2.  miRNAs in Alzheimer Disease - A Therapeutic Perspective.

Authors:  Priya Gupta; Surajit Bhattacharjee; Ashish Ranjan Sharma; Garima Sharma; Sang-Soo Lee; Chiranjib Chakraborty
Journal:  Curr Alzheimer Res       Date:  2017       Impact factor: 3.498

3.  Beta-amyloid oligomers: recent developments.

Authors:  Vilmante Borutaite; Ramune Morkuniene; Gintaras Valincius
Journal:  Biomol Concepts       Date:  2011-06-01

4.  The effect of Alzheimer's disease on spatial navigation strategies.

Authors:  Martina Parizkova; Ondrej Lerch; Scott Douglas Moffat; Ross Andel; Adela Fendrych Mazancova; Zuzana Nedelska; Martin Vyhnalek; Jakub Hort; Jan Laczó
Journal:  Neurobiol Aging       Date:  2017-12-29       Impact factor: 4.673

Review 5.  Neuro-inflammation and anti-inflammatory treatment options for Alzheimer's disease.

Authors:  Tomris Ozben; Serkan Ozben
Journal:  Clin Biochem       Date:  2019-04-04       Impact factor: 3.281

6.  Synthetic amyloid-beta oligomers impair long-term memory independently of cellular prion protein.

Authors:  Claudia Balducci; Marten Beeg; Matteo Stravalaci; Antonio Bastone; Alessandra Sclip; Emiliano Biasini; Laura Tapella; Laura Colombo; Claudia Manzoni; Tiziana Borsello; Roberto Chiesa; Marco Gobbi; Mario Salmona; Gianluigi Forloni
Journal:  Proc Natl Acad Sci U S A       Date:  2010-01-19       Impact factor: 11.205

7.  Lost in spatial translation - A novel tool to objectively assess spatial disorientation in Alzheimer's disease and frontotemporal dementia.

Authors:  Sicong Tu; Stephanie Wong; John R Hodges; Muireann Irish; Olivier Piguet; Michael Hornberger
Journal:  Cortex       Date:  2015-04-02       Impact factor: 4.027

8.  Mecamylamine blocks enhancement of reference memory but not working memory produced by post-training injection of nicotine in rats tested on the radial arm maze.

Authors:  Russell W Brown; Karen S Beale; G D Jay Frye
Journal:  Behav Brain Res       Date:  2002-08-21       Impact factor: 3.332

Review 9.  The development prospection of HDAC inhibitors as a potential therapeutic direction in Alzheimer's disease.

Authors:  Shuang-Shuang Yang; Rui Zhang; Gang Wang; Yong-Fang Zhang
Journal:  Transl Neurodegener       Date:  2017-07-10       Impact factor: 8.014

Review 10.  Metabolism-Centric Overview of the Pathogenesis of Alzheimer's Disease.

Authors:  Somang Kang; Yong Ho Lee; Jong Eun Lee
Journal:  Yonsei Med J       Date:  2017-05       Impact factor: 2.759

View more
  3 in total

1.  C-Phycocyanin-derived Phycocyanobilin as a Potential Nutraceutical Approach for Major Neurodegenerative Disorders and COVID-19- induced Damage to the Nervous System.

Authors:  Giselle Pentón-Rol; Javier Marín-Prida; Mark F McCarty
Journal:  Curr Neuropharmacol       Date:  2021       Impact factor: 7.708

2.  Nutrigenomic Studies on the Ameliorative Effect of Enzyme-Digested Phycocyanin in Alzheimer's Disease Model Mice.

Authors:  Yasuyuki Imai; Yurino Koseki; Makoto Hirano; Shin Nakamura
Journal:  Nutrients       Date:  2021-12-10       Impact factor: 5.717

Review 3.  Beneficial Effects of Spirulina Consumption on Brain Health.

Authors:  Teresa Trotta; Chiara Porro; Antonia Cianciulli; Maria Antonietta Panaro
Journal:  Nutrients       Date:  2022-02-05       Impact factor: 5.717

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.