Literature DB >> 33300060

Long non‑coding RNA ZFPM2‑AS1 promotes colorectal cancer progression by sponging miR‑137 to regulate TRIM24.

Meihua Xiao1, Zhi Liang1, Zhihui Yin1.   

Abstract

Accumulating evidence indicates that long non‑coding RNAs (lncRNAs) may serve essential roles during tumorigenesis of colorectal cancer (CRC). The lncRNA ZFPM2AS1 was observed to be involved in the progression of numerous types of cancer, such as lung adenocarcinoma and cervical cancer. The aim of the present study was to investigate the expression levels and function of ZFPM2AS1 in CRC. Expression levels of ZFPM2AS1 in tissue and CRC cells were measured by reverse transcription‑quantitative PCR. Furthermore, cell proliferation and Transwell assays were conducted to investigate the functional role of ZFPM2AS1 in vitro. In addition, bioinformatics analysis, luciferase reporter assay, RNA immunoprecipitation assay and western blotting were performed to explore the possible underlying mechanism. The expression levels of ZFPM2AS1 were significantly upregulated in tissue samples from patients with CRC and CRC cell lines compared with normal tissue and normal human colorectal mucosa cell line. Notably, the upregulation of ZFPM2AS1 was significantly associated with tumor size, histological differentiation, lymph node metastasis and TNM stage. In addition, ZFPM2AS1 knockdown significantly inhibited cell proliferation, migration and invasion compared with the control group in vitro. Moreover, it was found that ZFPM2AS1 positively regulated tripartite motif containing 24 (TRIM24) expression by sponging miR‑137. In conclusion, the present study indicated that ZFPM2AS1 may serve as an oncogene in CRC by regulating the miR‑137/TRIM24 axis.

Entities:  

Year:  2020        PMID: 33300060      PMCID: PMC7723173          DOI: 10.3892/mmr.2020.11737

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Colorectal cancer (CRC) is a common digestive tract malignancy, which ranks third amongst cancer incidence rates and is the second leading cause of cancer-related death worldwide. CRC accounts for >6.1% of all malignant incidences, with ~1.8 million new CRC cases diagnosed worldwide in 2018 (1). Despite the significant progress made in CRC treatment, including in chemotherapy and surgical techniques, patients with distant metastases have a poor prognosis. Indeed, the 5-year survival rate is <10% for patients with distant metastases (2). Tumor metastasis is the primary cause of poor prognosis in patients with CRC (3). Thus, understanding the underlying molecular mechanisms associated with CRC metastasis is an urgent requirement. Long non-coding RNAs (lncRNAs) are non-protein-encoding RNAs >200 nucleotides in length (4). A previous study indicated that lncRNAs participate in the regulation of gene expression and serve functional roles both in physiological and pathological processes (5). Furthermore, aberrant expression of lncRNAs has been implicated in tumorigenesis and the development of hepatocellular carcinoma and pancreatic ductal adenocarcinoma (6,7). For example, lncRNA SNHG6 has been reported to promote the migration, invasion and epithelial-mesenchymal transition of CRC cells through the microRNA (miRNA/miR)-26a/EZH2 axis, thereby acting as an oncogene (8). Zhan et al (9) reported that the overexpression of lncRNA ROR promoted the invasion and metastasis of pancreatic cancer by upregulating ZEB1 expression levels. Kong et al (10) demonstrated that the recently identified lncRNA ZFPM2-AS1, located on human chromosome 8, was upregulated in gastric cancer tissue and that ZFPM2-AS1 overexpression promoted the proliferation and inhibited the apoptosis of gastric cancer cells by inhibiting the p53 pathway. Furthermore, Xue et al (11) indicated that ZFPM2-AS1 played an oncogenic role in lung adenocarcinoma progression through miR-18b-5p and VMA21. However, whether ZFPM2-AS1 is expressed in CRC tissue or plays a biological role in CRC progression remains unknown. The aim of the present study was to elucidate the function of ZFPM2-AS1 in the development of CRC. This study demonstrated that ZFPM2-AS1 expression was upregulated in CRC tissues compared with normal tissue, and that high ZFPM2-AS1 expression was associated with poor prognosis for patients with CRC. Moreover, ZFPM2-AS1 knockdown inhibited the proliferation, migration and invasion of CRC cells in vitro. Prediction of target genes, luciferase reporter and rescue experiment assays indicated that miR-137 was a target of ZFPM2-AS1, and tripartite motif containing 24 (TRIM24) was identified as a target of miR-137. Mechanistic studies further clarified that ZFPM2-AS1 served as a competing endogenous RNA (ceRNA) that upregulates TRIM24 expression by sponging miR-137 in CRC.

Materials and methods

Patient tissues

Human CRC tissue samples and the matched normal tissue (n=58 pairs) were collected from The First Affiliated Hospital of the University of South China between May 2016 and March 2019. The inclusion criteria included: Patients who were diagnosed with CRC by a pathologist and underwent radical surgery. The exclusion criteria included the following: Patients had received radiotherapy or chemotherapy prior to the operation. Written informed consent was obtained from all patients. The present study was approved by the Medical Ethics Committees of The First Affiliated Hospital of University of South China.

Cell lines and culture

The human CRC cell lines (SW480, SW620, HT-29, Caco-2 and HCT116) and the normal human colorectal mucosa cell line FHC were purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. All cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.), supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (Beijing Solarbio Science & Technology Co., Ltd.) in an incubator at 37°C with 5% CO2.

Cell transfection

To stably knockdown the expression of ZFPM2-AS1, three short hairpin (sh) RNA targeting ZFPM2-AS1 (sh-ZFPM2-AS1-1, 5′-GCGACCTAGGATCGAACCGAT-3′; sh-ZFPM2-AS1-2, 5′-AGCTGAATTCGAGCCAATTGCGT-3′; sh-ZFPM2-AS1-3, 5′-GCCGGAACGGATTTCGGAGAC-3′) and sh-negative control (NC, 5′-TTCTCCGAACGTGTCACGT-3′) were synthesized by Shanghai GenePharma Co., Ltd. These sequences were inserted into a pLKO.1 vector (BioSettia, Inc.). miR-137 mimics (5′-GUACUUCCUAACCCAUUGUUCA-3′), miR-137 inhibitors (5′-AUUCUUCAGAUUUCCAGGGACU-3′), mimics NC (5′-CAGUACUUUUGUGUAGUACAA-3′) and inhibitor NC (5′-CAGUACUUUUGUGUAGUACAA-3′) were also obtained from Shanghai GenePharma Co., Ltd. To construct the TRIM24 expression vector, the full-length sequence of TRIM24 were cloned into the pcDNA3.1 vector (pcDNA3.1-TRIM24). Before transfection, cells were sub-cultured into 6-well plates (Corning, Inc.) at ~50% confluence (3×105). sh-RNAs (100 nM) or miR-137 mimics (50 nM) or miR-137 inhibitor (150 nM) or plasmids (1.5 µg per well) were transfected into SW480 and HCT116 cells. Cell transfection was performed using Lipofectamine® LTX (Invitrogen; Thermo Fisher Scientific, Inc.). After incubation for 48 h, cells were collected for subsequent experiments.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA from CRC tissue, normal tissue, SW480 and HCT116 cells were extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). To determine mRNA and lncRNA expression levels, the extracted RNA was reverse transcribed into cDNA using a PrimeScript RT reagent kit (Takara Bio, Inc.). Reverse transcription protocol consisted of 37°C for 15 min, followed by 85°C for 5 sec. To determine miRNA expression levels, cDNA was synthesized using the qScript microRNA cDNA Synthesis kit (Guangzhou RiboBio Co., Ltd.). The thermocycling conditions were as follows: 94°C for 3 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 60 sec, and a final extension at 72°C for 5 min. RT-qPCR was subsequently performed using SYBR-Green (Takara Bio, Inc.), GAPDH and U6 were used as the internal loading controls for lncRNA, mRNA and miRNA, respectively. The relative expression of these genes was determined using the 2−ΔΔCq method (12). The primers used for the RT-qPCR are presented in Table I.
Table I.

Primer sequences.

GenePrimer sequences (5→3)
ZFPM2-AS1F: TTTCCTACAATGAATCCACCAG
R: TTTGAGCCACTCTTTGAGG
miR-137F: UUAUUGCUUAAGAAUACGCGUAG
R: GTCGTATCCAGTGCAGGGTCCGAGGT
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
TRIM24F: CGCCACCCAAGTTGGAGT
R: GCTGGGAACCTCAGTAGTGTCCT
GAPDHF: GCACCGTCAAGGCTGAGAAC
R: GCCTTCTCCATGGTGGTGAA

miR, microRNA, TRIM24, tripartite motif containing 24; F, forward; R, reverse.

Cell proliferation assay

The proliferative capacity of SW480 and HCT116 cells were determined using MTS and colony formation assays. For the MTS assay, 2×103 cells/well were seeded into 96-well plates and cultured for 0, 24, 48, 72, 96 and 120 h. Following the incubation, 10 µl MTS solution/well was added for 2 h, and then dimethyl sulfoxide was used to dissolve formazan. Finally, the absorbance at 450 nm was measured using a microplate reader (Bio-Rad Laboratories, Inc.). For the colony formation assay, 800 cells/well were seeded into 6-well plates and incubated at 37°C in 5% CO2 for 14 days. Following the incubation, the colonies were fixed with methanol at room temperature for 10 min and stained with 0.1% crystal violet at room temperature for 10 min. The number of colonies (a single colony was defined as cell number >50) was counted using an inverted microscope (magnification, ×200; CKX41; Olympus Corporation).

Transwell migration and invasion assays

Transwell assays were performed to analyze the migratory and invasive abilities of SW480 and HCT116 cells. For invasion assays, the Transwell membrane was coated with Matrigel™ (BD Biosciences) and 5×104 cells/well were suspended in 200 µl serum-free medium and plated into the upper chambers. For migration assays, cells were plated in the same conditions, but the Transwell membrane was left uncoated. A volume of 750 µl medium containing 10% FBS was added to the lower chamber. Following 48 h of incubation at 37°C with 5% CO2, the cells were fixed with methanol at room temperature for 10 min and stained with 0.1% crystal violet at room temperature for 10 min. The stained cells were counted under an inverted microscope (magnification, ×200; CKX41; Olympus Corporation).

Dual-luciferase reporter assay

The potential targets of ZFPM2-AS1 or miR-137 were predicted using miRBase 21.0 (http://www.mirbase.org/) or TargetScan 7.2 (http://www.targetscan.org/vert_72/). The sequences of the NC, wild-type (WT) ZFPM2-AS1 (ZFPM2-AS1-WT) and mutant (MUT) ZFPM2-AS1 (ZFPM2-AS1-MUT) were inserted into the pmirGLO reporter vector (Shanghai GenePharma Co., Ltd.). Subsequently, pmirGLO-NC, pmirGLO-ZFPM2-AS1-WT and pmirGLO-ZFPM2-AS1-MUT were co-transfected into SW480 and HCT116 cells along with the miR-137 mimics or miR-NC using LTX (Invitrogen; Thermo Fisher Scientific, Inc.). Similarly, the sequences of NC, TRIM24-WT and TRIM24-MUT were inserted into the pmirGLO reporter vector. pmirGLO-NC, pmirGLO-TRIM24-WT and pmirGLO-TRIM24-MUT were then co-transfected into SW480 and HCT116 cells along with the miR-NC or miR-137 mimics with Lipofectamine 2000. Following 48 h of transfection, the relative luciferase activity was analyzed using the Dual Luciferase Reporter Assay System (Promega Corporation). The Renilla luciferase was selected as an internal control.

RNA immunoprecipitation (RIP) assay

A RIP assay was conducted to determine the interaction between ZFPM2-AS1 and miR-137 using a Magna RIP kit (EMD Millipore). Briefly, cells were lysed in RIP lysis buffer (EMD Millipore) containing magnetic beads (2 µg) conjugated with human anti-Argonaute 2 (Ago2) antibody (5 µg) (cat. no. 186733; Abcam). Input and normal IgG (EMD Millipore) were used as internal controls. Then, RT-qPCR was performed to analyze ZFPM2-AS1 and miR-137 expression levels.

Western blotting

Western blotting was performed according to a previously described study (13). Total protein was extracted with a pre-cooled RIPA lysis (cat. no. KGP703-100; Nanjing KeyGen Biotech Co., Ltd.). Protein concentration was detected with a BCA assay (Thermo Fisher Scientific, Inc.). Equal amounts (60 µg/lane) of protein aliquots were loaded on 10% gel and separated via SDS-PAGE, following which, separated proteins were transferred to PVDF membranes (EMD Millipore). Membranes were blocked with 5% skimmed milk at room temperature for 2 h, and then incubated with primary antibodies at 4°C overnight. The following primary antibodies were used: Anti-TRIM24 (1:3,000; Abcam; cat. no. 70560) and anti-GAPDH (1:2,500; Abcam; cat. no. 9485). Subsequently, membranes were incubated with a HRP-conjugated rabbit anti-goat IgG antibody (1:10,000; cat. no. BA1060; Wuhan Boster Biological Technology, Ltd.) at room temperature for 1 h. Finally, the immunoblots were visualized with LI-COR Odyssey CLX Two-colour infrared laser imaging system (LI-COR Biosciences). ImageJ v1.8.0 software (National Institutes of Health) was used for densitometric analysis.

Statistical analysis

Statistical analysis was performed using SPSS 18.0 software (SPSS Inc.) and data are presented as the mean ± SD. A paired t-test was performed to compare expression between tumor and healthy tissues. For other comparisons between two groups, the unpaired t-test was performed. For all comparisons among ≥3 groups of data, Tukey's test was performed after one-way ANOVA analysis. The association between the clinical parameters of patients with CRC and ZFPM2-AS1 expression levels in the CRC cohort were analyzed using a χ2 test. Pearson's correlation was used to analyze the expression levels of ZFPM2-AS1, miR137 and TRIM24. All experiments were performed in triplicate. P<0.05 was considered to indicate a statistically significant difference.

Results

ZFPM2-AS1 expression levels are upregulated in CRC tissue and predict an unfavorable prognosis for patients with CRC

The expression levels of ZFPM2-AS1 in 58 CRC tissue samples and matched normal tissue were analyzed by RT-qPCR. ZFPM2-AS1 expression levels were significantly upregulated in CRC tissue, compared with healthy tissue (Fig. 1A). The expression levels of ZFPM2-AS1 in the SW480, SW620, HT-29, Caco-2 and HCT116 human CRC cell lines, were also significantly upregulated, compared with FHC cells (Fig. 1B).
Figure 1.

ZFPM2-AS1 knockdown attenuates the proliferation, migration and invasion of CRC cells. (A) ZFPM2-AS1 expression in CRC tumor tissues and in adjacent normal tissues. (B) ZFPM2-AS1 mRNA expression in CRC cell lines. (C) ZFPM2-AS1 expression in SW480 and HCT116 cells stably expressing sh-NC or sh-ZFPM2-AS1. (D and E) Effects of sh-ZFPM2-AS1 on cell proliferation of SW480 and HCT116 cells. (F) Effects of sh-ZFPM2-AS1 on cell migration and invasion of SW480 and HCT116 cells (scale bar, 200 µm). **P<0.01, ***P<0.001 vs. control group. CRC, colorectal cancer; sh, short hairpin; NC, negative control; OD, optical density.

Subsequently, to further determine the clinical significance of ZFPM2-AS1 expression levels in CRC, patients with CRC were divided into a high expression group (n=29) and a low expression group (n=29), according to the median expression levels of ZFPM2-AS1 across all CRC tissue samples. The expression levels of ZFPM2-AS1 were positively associated with tumor size (P=0.004), histological differentiation (P=0.012), lymph node metastasis (P=0.019) and TNM stage (P=0.031) (Table II). Taken together, these results suggested that ZFPM2-AS1 could function as an oncogenic lncRNA in CRC.
Table II.

Association between ZFPM2-AS1 expression and clinicopathological characteristics of patients with colorectal cancer.

ZFPM2-AS1 expression

Clinicopathological characteristicsCases, nLow, nHigh, nχ2 valueP-value
Age, years
  <602311120.2320.630
  ≥60351916
Sex
  Male3115160.2970.586
  Female271512
Tumor size, cm
  <5282088.4170.004
  ≥5301020
Differentiation
  Good/moderate221666.2620.012
  Poor361422
Lymph node metastasis
  No191455.4570.019
  Yes391623
TNM stage
  I + II251786.6610.031
  III + IV331320

ZFPM2-AS1 knockdown inhibits the proliferation, migration and invasion of CRC cells

Loss-of-function experiments were conducted to investigate the function of ZFPM2-AS1 in CRC progression. SW480 and HCT116 cells were transfected with sh-ZFPM2-AS1-1, −2 or −3 downregulate ZFPM2-AS1 expression. sh-ZFPM2-AS1-1 used in subsequent experiments, due to its superior knockdown efficiency (Fig. 1C), compared with the other two shRNA candidates. MTS and colony formation assays demonstrated that ZFPM2-AS1-1 knockdown significantly inhibited the proliferative ability of CRC cells (Fig. 1D and E), compared with sh-NC. In addition, Transwell assays indicated that the migratory and invasive abilities of CRC cells transfected with sh-ZFPM2-AS1 were markedly decreased (Fig. 1F). Thus, ZFPM2-AS1-1 knockdown may lead to significant inhibition of the proliferation, migration and invasion of CRC cells.

ZFPM2-AS1 serves as a sponge for miR-137

To further identify the underlying mechanisms of ZFPM2-AS1 in CRC progression, miRBase was used to predict potential target miRNAs for ZFPM2-AS1. Thus, miR-137 was identified as a candidate target of ZFPM2-AS1 (Fig. 2A). Following ZFPM2-AS1 knockdown, miR-137 expression levels were significantly upregulated, compared with sh-NC (Fig. 2B). miR-137 mimics and inhibitor, as well as their respective NC were then transfected into SW480 and HCT116 cell lines. The expression of miR-137 was significantly upregulated in miR-137 mimics-transfected cells, whereas miR-137 expression was significantly decreased in miR-137 inhibitor-transfected cells, compared with their NC (Fig. 2C). The miR mimics and mimics NC were then used in dual-luciferase reporter assays. Co-transfection with miR-137 mimics significantly decreased the relative luciferase activity of ZFPM2-AS1-WT, but not MUT, compared with mimics-NC (Fig. 2D).
Figure 2.

miR-137 is a direct target of ZFPM2-AS1. (A) Predicted binding site of miR-137 in ZFPM2-AS1. (B) miR-137 expression in SW480 and HCT116 cells transfected with sh-ZFPM2-AS1. (C) miR-137 expression in SW480 and HCT116 cells following transfection with miR-137 mimics or miR-137 inhibitor. (D) Effects of miR-137 mimics on luciferase activity WT or MUT ZFPM2-AS1 gene constructs. (E) Radioimmunoprecipitation and reverse transcription-quantitative PCR analysis of the binding between ZFPM2-AS1 and miR-137. (F) miR-137 expression in CRC tumor tissues and in adjacent normal tissues. (G) miR-137 expression in CRC cell lines. (H) Correlation between ZFPM2-AS1 and miR-137 expressions in CRC tissues. (I and J) Effects of sh-ZFPM2-AS1 and miR-137 inhibitor on proliferation of SW480 and HCT116 cells. (K) Effects of sh-ZFPM2-AS1 and miR-137 inhibitor on cell migration and invasion of SW480 and HCT116 cells (scale bar, 200 µm). **P<0.01, ***P<0.001 vs. control group. miR, microRNA; CRC, colorectal cancer; sh, short hairpin; NC, negative control; OD, optical density; WT, wild-type; MUT, mutant; Ig, immunoglobulin; Ago2, Argonaute 2.

In a RIP assay, both ZFPM2-AS1 and miR-137 were significantly enriched in Ago2-containing beads, compared with the IgG-containing beads (Fig. 2E). Furthermore, the relative expression levels of miR-137 were significantly downregulated in CRC tissue compared with matched normal tissue (Fig. 2F). The expression levels of miR-137 were significantly downregulated in CRC cell lines (SW620, HT-29, Caco-2, SW480 and HCT116) compared with FHC cells (Fig. 2G). In addition, miR-137 expression levels were negatively correlated with ZFPM2-AS1 expression in CRC tissue (Fig. 2H). Notably, co-transfection of SW480 and HCT116 cells with miR-137 inhibitor and sh-ZFPM2-AS1-1 significantly increased cell proliferation, migration and invasion abilities, compared with shRNA alone (Fig. 2I-K). These results suggested that ZFPM2-AS1 may promote CRC progression by sponging miR-137.

miR-137 targets TRIM24 in CRC

TargetScan7 was used to predict the downstream targets of miR-137, which identified TRIM24 as a potential candidate gene (Fig. 3A). TRIM24 mRNA expression levels were significantly upregulated in CRC tissues compared with the adjacent normal tissues (Fig. 3B). Moreover, TRIM24 mRNA levels were significantly upregulated in CRC cell lines (SW620, HT-29, Caco-2, SW480 and HCT116), compared with FHC cells (Fig. 3C). The effects of miR-137 mimics and miR-137 inhibitor on TRIM24 mRNA and protein expression in CRC cells were then evaluated. Compared with mimics NC, TRIM24 expression was significantly decreased both at the mRNA and protein levels in CRC cells transfected with miR-137 mimics. By contrast, the miR-137 inhibitor increased the expression levels of TRIM24 (Fig. 3D and E). In a dual-luciferase reporter assay, miR-137 mimics significantly inhibited the relative luciferase activity of TRIM24-WT, but not TRIM24-MUT (Fig. 3F). Pearson's correlation analysis also indicated that miR-137 expression levels were negatively correlated with TRIM24 expression levels in CRC tissues (Fig. 3G).
Figure 3.

TRIM24 is a direct target of miR-137. (A) Predicted binding site of miR-137 in TRIM24. (B) TRIM24 mRNA expression in CRC tumor and adjacent normal tissue. (C) TRIM24 mRNA expression in CRC cell lines. (D) TRIM24 mRNA and (E) protein expression following transfection with miR-137 mimics or miR-137 inhibitor in SW480 and HCT116 cells. (F) Effects of miR-137 mimics on luciferase activity of WT or MUT TRIM24 constructs. (G) Correlation between TRIM24 and miR-137 expressions in CRC tissues. (H) TRIM24 mRNA and (I) protein expression following transfection with sh-ZFPM2-AS1 and miR-137 inhibitor in SW480 and HCT116 cells. **P<0.01, ***P<0.001 vs. control group. miR, microRNA; CRC, colorectal cancer; TRIM24, tripartite motif containing 24; sh, short hairpin; NC, negative control; WT, wild-type; MUT, mutant.

RT-qPCR and western blot analysis were then carried out to determine whether ZFPM2-AS1 could regulate TRIM24 expression levels. TRIM24 expression levels were significantly downregulated following ZFPM2-AS1 knockdown. However, transfection with the miR-137 inhibitor and sh-ZFPM2-AS1-1 increased the expression levels of TRIM24, compared with shRNA alone (Fig. 3H and I). Thus, ZFPM2-AS1 may promote TRIM24 expression by sponging miR-137 in CRC.

ZFPM2-AS1 promotes CRC progression through TRIM24

To determine whether ZFPM2-AS1 promoted CRC progression through TRIM24, RT-qPCR and western blotting analyses were carried out following TRIM24 overexpression. TRIM24 expression was significantly increased after transfection with pcDNA3.1-TRIM24 (Fig. 4A). Compared with sh-NC and TRIM24 overexpression, ZFPM2-AS1 knockdown significantly downregulated TRIM24 expression levels, both at the mRNA and protein level (Fig. 4B and C). Pearson's correlation analysis indicated that TRIM24 expression levels were positively correlated with ZFPM2-AS1 expression levels in CRC tissue (Fig. 4D). Moreover, proliferation, migration and invasion of CRC cell lines were significantly inhibited by ZFPM2-AS1 silencing, which was partly reversed following TRIM24 overexpression (Fig. 4E-G). Taken together, these findings suggested that ZFPM2-AS1 may serve an oncogenic role in CRC through a miR-137/TRIM24 axis.
Figure 4.

TRIM24 overexpression reverses the effects of ZFPM2-AS1 knockdown in CRC cell lines. (A) Effects of pcDNA3.1-TRIM24 on TRIM24 protein expression in SW480 and HCT116 cells. (B) TRIM24 mRNA and (C) protein expression in SW480 and HCT116 cells transfected with sh-ZFPM2-AS1 and pcDNA3.1-TRIM24. (D) Correlation between TRIM24 and ZFPM2-AS1 expressions in CRC tissue. (E and F) Effects of sh-ZFPM2-AS1 and pcDNA3.1-TRIM24 on proliferation of SW480 and HCT116 cells. (G) Effects of sh-ZFPM2-AS1 and pcDNA3.1-TRIM24 on cell migration and invasion of HCT116 and SW480 cells. **P<0.01, ***P<0.001. CRC, colorectal cancer; TRIM24, tripartite motif containing 24; sh, short hairpin; NC, negative control; OE, overexpression.

Discussion

Accumulating evidence suggests that lncRNAs exert pivotal functions in the development and progression of CRC. For example, Gao et al (14) reported that the upregulation of lncRNA CACS15 contributed to oxaliplatin resistance of CRC by regulating the miR-145/ABCC1 axis. Xu et al (15) demonstrated that lncRNA MALAT1 promoted CRC cell proliferation, invasion and migration by upregulating SOX9 expression. Xu et al (16) reported that the expression levels of the lncRNA SATB2-AS1 were downregulated in CRC; clinical analysis indicated that low SATB2-AS1 expression levels were associated with poor prognosis. Functional analysis also demonstrated that SATB2-AS1 knockdown enhanced migration and invasion of CRC cells (16). In the present study, the expression levels of ZFPM2-AS1 were upregulated in human CRC tissues. In addition, there was an association between ZFPM2-AS1 expression levels and clinical characteristics. Indeed, high expression levels of ZFPM2-AS1 were significantly associated with tumor size, histological differentiation, lymph node metastasis and TNM stage. Thus, it was hypothesized that ZFPM2-AS1 may serve as oncogenic role in CRC. ZFPM2-AS1 expression levels were also markedly upregulated in CRC cell lines, compared with a colorectal mucosa cell line. Furthermore, loss-of-function experiments suggested that ZFPM2-AS1 knockdown decreased SW480 and HCT116 cell proliferation, migration and invasion in vitro. Previous studies have demonstrated that lncRNAs function as ceRNA networks that sponge miRNAs and modulate the expression of target mRNA molecules, resulting in changes in the progression of multiple types of cancer, such as lung adenocarcinoma and pancreatic ductal adenocarcinoma (17,18). Thus, the potential miRNAs that can bind with ZFPM2-AS1 were examined in the present study, and miR-137 was identified as a potential target. miR-137 has previously been identified as a tumor suppressor in numerous types of cancer. For example, Chen et al (19) reported that miR-137 expression levels were downregulated in glioblastoma, and that the overexpression of miR-137 markedly suppressed the proliferation and invasion of glioma cell lines. In addition, Li et al (20) demonstrated that miR-137 induced the apoptosis of ovarian cancer cells by regulating X-linked inhibitor of apoptosis protein. miR-137 also inhibits the malignant phenotype of malignant melanoma (21), tongue squamous carcinoma (22), cervical cancer (23) and CRC (24). In the present study, miR-137 could directly bind ZFPM2-AS1. Moreover, miR-137 expression levels were upregulated following ZFPM2-AS1 knockdown, and ZFPM2-AS1 expression was inversely correlated with that of miR-137 in patients with CRC. Moreover, transfection with a miR-137 inhibitor reversed the effects of ZFPM2-AS1 knockdown in CRC cells. The downstream targets of this ZFPM2-AS1/miR-137 axis were also examined. TRIM24 was predicted as a potential target of miR-137. In a dual-luciferase reporter assay, miR-137 could directly bind to TRIM24. Moreover, TRIM24 expression levels were downregulated following the transfection with miR-137 mimics. Several previous studies have suggested that TRIM24 may serve as an oncogene in the development of several types of cancer. For instance, Zhang et al (25) reported that TRIM24 promoted glioma progression by enhancing the PI3K/AKT signaling pathway. Lv et al (26) also demonstrated that TRIM24 contributed to human glioblastoma development. In addition, Zhu et al (27) indicated that TRIM24 was highly expressed in human hepatocellular carcinoma (HCC) and that TRIM24 knockdown suppressed the proliferative and migratory abilities of HCC cells. Notably, a previous study also suggested that TRIM24 expression levels were significantly upregulated in CRC tissues, compared with normal tissues, and that TRIM24 upregulation was associated with poor prognosis in patients (28). Additionally, Wang et al (29) reported that TRIM24 silencing inhibited the proliferation and promoted the apoptosis of CRC cells. These previous studies suggested that TRIM24 may serve as an oncogene in human CRC. Thus, it was investigated whether TRIM24 participated in the miR-137/TRIM24 axis in CRC cells. It was identified that ZFPM2-AS1 silencing downregulated TRIM24 expression levels by binding to miR-137. In addition, TRIM24 overexpression could rescue the effects of ZFPM2-AS1 knockdown on CRC cell proliferation, migration and invasion. In conclusion, the findings of the present study suggested an important role for ZFPM2-AS1 in the proliferation, migration and invasion of CRC cells. These results also identified a novel mechanism through which the ZFPM2-AS1/miR-137/TRIM24 axis may regulate the progression of CRC.
  29 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  miR-137 is frequently down-regulated in glioblastoma and is a negative regulator of Cox-2.

Authors:  Lingchao Chen; Xiaofeng Wang; Hanbing Wang; Yongli Li; Wei Yan; Lei Han; Kailiang Zhang; Junxia Zhang; Yongzhi Wang; Yan Feng; Peiyu Pu; Tao Jiang; Chunsheng Kang; Chuanlu Jiang
Journal:  Eur J Cancer       Date:  2012-03-07       Impact factor: 9.162

3.  Overexpression of long non-coding RNA colon cancer-associated transcript 2 is associated with advanced tumor progression and poor prognosis in patients with colorectal cancer.

Authors:  Junling Zhang; Yong Jiang; Jing Zhu; Tao Wu; Ju Ma; Chuang Du; Shanwen Chen; Tengyu Li; Jinsheng Han; Xin Wang
Journal:  Oncol Lett       Date:  2017-09-25       Impact factor: 2.967

4.  Prognostic relevance of tripartite motif containing 24 expression in colorectal cancer.

Authors:  Feng-Qin Wang; Yan Han; WenJuan Yao; Jing Yu
Journal:  Pathol Res Pract       Date:  2017-08-25       Impact factor: 3.250

5.  LncRNA CACS15 contributes to oxaliplatin resistance in colorectal cancer by positively regulating ABCC1 through sponging miR-145.

Authors:  Rongrong Gao; Chun Fang; Jichong Xu; Huaqiao Tan; Peng Li; Lin Ma
Journal:  Arch Biochem Biophys       Date:  2019-01-09       Impact factor: 4.013

6.  TRIM24 promotes glioma progression and enhances chemoresistance through activation of the PI3K/Akt signaling pathway.

Authors:  L-H Zhang; A-A Yin; J-X Cheng; H-Y Huang; X-M Li; Y-Q Zhang; N Han; X Zhang
Journal:  Oncogene       Date:  2014-01-27       Impact factor: 9.867

Review 7.  Long noncoding RNAs in cancer cells.

Authors:  Duc-Hiep Bach; Sang Kook Lee
Journal:  Cancer Lett       Date:  2018-04-10       Impact factor: 8.679

Review 8.  Colorectal cancer development and advances in screening.

Authors:  Karen Simon
Journal:  Clin Interv Aging       Date:  2016-07-19       Impact factor: 4.458

9.  Long noncoding RNA CAR10 promotes lung adenocarcinoma metastasis via miR-203/30/SNAI axis.

Authors:  Xiaolu Ge; Gui-Yuan Li; Lin Jiang; Liqing Jia; Zhezhe Zhang; Xiaoling Li; Ranran Wang; Ming Zhou; Yanhong Zhou; Zhaoyang Zeng; Juanjuan Xiang; Zheng Li
Journal:  Oncogene       Date:  2019-01-07       Impact factor: 9.867

10.  LncRNA SATB2-AS1 inhibits tumor metastasis and affects the tumor immune cell microenvironment in colorectal cancer by regulating SATB2.

Authors:  Mu Xu; Xueni Xu; Bei Pan; Xiaoxiang Chen; Kang Lin; Kaixuan Zeng; Xiangxiang Liu; Tao Xu; Li Sun; Jian Qin; Bangshun He; Yuqin Pan; Huiling Sun; Shukui Wang
Journal:  Mol Cancer       Date:  2019-09-06       Impact factor: 27.401

View more
  5 in total

Review 1.  Long Non-coding RNA ZFPM2-AS1: A Novel Biomarker in the Pathogenesis of Human Cancers.

Authors:  Gabriel B K Sasa; Cheng Xuan; Guoliang Lyu; Xianfeng Ding; Fang Meiyu
Journal:  Mol Biotechnol       Date:  2022-01-31       Impact factor: 2.695

Review 2.  Apoptosis evasion via long non-coding RNAs in colorectal cancer.

Authors:  Muhammad Irfan; Zeeshan Javed; Khushbukhat Khan; Naila Khan; Anca Oana Docea; Daniela Calina; Javad Sharifi-Rad; William C Cho
Journal:  Cancer Cell Int       Date:  2022-09-08       Impact factor: 6.429

3.  The Pyroptosis-Related Long Noncoding RNA Signature Predicts Prognosis and Indicates Immunotherapeutic Efficiency in Hepatocellular Carcinoma.

Authors:  Tao Wang; Yi Yang; Ting Sun; Haizhou Qiu; Jian Wang; Cheng Ding; Ren Lan; Qiang He; Wentao Wang
Journal:  Front Cell Dev Biol       Date:  2022-05-26

4.  Human bone marrow mesenchymal stem cells-derived exosomes attenuated prostate cancer progression via the miR-99b-5p/IGF1R axis.

Authors:  Shichun Jiang; Haiyu Chen; Kai He; Juan Wang
Journal:  Bioengineered       Date:  2022-02       Impact factor: 3.269

5.  Long non-coding RNA PCED1B-AS1 promotes the proliferation of colorectal adenocarcinoma through regulating the miR-633/HOXA9 axis.

Authors:  Jianfeng Liu; Jun Qian; Qi Mo; Liming Tang; Qiang Xu
Journal:  Bioengineered       Date:  2022-03       Impact factor: 6.832

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.