Literature DB >> 33270781

Determining the effects of nanoparticulate air pollution on proteostasis in Caenorhabditis elegans.

Emily H Green1, Elise A Kikis1.   

Abstract

The proteostasis network comprises the biochemical pathways that together maintain and regulate proper protein synthesis, transport, folding, and degradation. Many neurodegenerative diseases are characterized by a failure of the proteostasis network to sustain the health of the proteome, resulting in protein misfolding, aggregation, and, often, neurotoxicity. Although important advances have been made in recent years to identify genetic risk factors for neurodegenerative diseases, we still know relatively little about environmental risk factors such as air pollution. Exposure to nano-sized particulate air pollution, referred to herein as nanoparticulate matter (nPM), has been shown to trigger the accumulation of misfolded and oligomerized amyloid beta in mice. This suggests that the ability to maintain proteostasis is likely compromised in Alzheimer 's disease (AD) pathogenesis upon exposure to nPM. We aim to determine whether this aspect of the environment interacts with proteostasis network machinery to trigger protein misfolding. This could at least partially explain how air pollution exacerbates the symptoms of neurodegenerative diseases of aging, such as AD. We hypothesize that nPM challenges the buffering capacity of the proteostasis network by reducing the efficiency of folding for metastable proteins, thereby disrupting what has proven to be a very delicate proteostasis balance. We will test this hypothesis using C. elegans as our model system. Specifically, we will determine the impact of particulate air pollution on the aggregation and toxicity of disease-associated reporters of proteostasis and on transcriptional responses to stress.

Entities:  

Year:  2020        PMID: 33270781      PMCID: PMC7714337          DOI: 10.1371/journal.pone.0243419

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The term ‘proteostasis’ refers to the ability of cells and organisms to maintain a healthy proteome via the activity of the many pathways and processes that comprise the proteostasis network. The proteostasis network consists of nearly 2000 proteins [1] and coordinates the regulation of protein synthesis, protein folding, protein trafficking, and protein turnover [2]. In aging, disease, and under conditions of proteotoxic stress, the proteostasis network becomes overwhelmed, resulting in proteostasis collapse and an increased load of misfolded proteins [2]. This proteostasis collapse has been documented both in young C. elegans engineered to express misfolded Huntington’s disease (HD)-associated protein [3] and during aging [4]. HD is a progressive autosomal dominant neurodegenerative disorder for which the genetic determinant is an expansion of a polyglutamine (polyQ)-encoding CAG repeat in the gene that encodes the huntingtin protein [5]. PolyQ-expanded huntingtin protein misfolds and aggregates in aging individuals, and is neurotoxic. As in HD pathogenesis, protein aggregation is also a hallmark of Alzheimer’s disease (AD). For example, the amyloid precursor protein, APP, is misprocessed into a misfolded and aggregation-prone neurotoxic peptide, referred to herein as amyloid beta (Aβ). The misfolding/aggregation of Aβ precedes tau hyperphosphorylation, the formation of neurofibrillary tangles, and the onset of cognitive decline [6]. Genome-wide association studies have uncovered 29 genetic risk factors for sporadic AD [7]. ApoE4, identified in 1993, is the strongest such risk factor, associated with a two- to ten-fold increased risk for the disease compared to the general population. It likely acts via an interaction with Aβ [8,9], whose misfolding and deposition within specific regions of the brain may partially contribute to neurodegeneration [10]. Environmental risk factors for AD are also under intense investigation, pointing to the need to consider the role that gene—environment interactions play in AD progression. Underscoring the disease-relevance of gene—environment interactions, a recent epidemiological study revealed that particulate air pollution significantly exacerbates the effects of ApoE4 in women [11]. Likewise, in a mouse model of familial AD, the presence of the human ApoE4 allele was associated with increased susceptibility to nano-sized particulate matter (nPM) obtained from traffic-derived air pollution, leading to an increase in Aβ aggregation [11]. These important findings suggest that the ability to maintain proteostasis is likely compromised upon exposure to particulate air pollution. Consistent with this hypothesis, it was recently shown that the expression levels of proteostasis network genes in C. elegans are responsive to nPM [12]. Furthermore, the degradative pathways of the proteostasis network have also been shown to be activated in mice exposed to nPM [13]. The effects of this dysregulation on the folding, or misfolding, of disease-associated proteins has never been directly tested. We therefore propose testing the hypothesis that exposure to nPM will challenge the buffering capacity of the proteostasis network, thereby reducing the efficiency of disease-associated protein folding. We will use wild type C. elegans and strains that have been engineered to express aggregation-prone disease-associated proteins to determine: Whether exposure to nPM exacerbates the formation of large visible amyloid beta (Aβ) or polyglutamine (polyQ) protein aggregates in the genetically tractable C. elegans. Whether chronic exposure to nPM triggers an increase in polyQ or Aβ toxic oligomers in C. elegans. Whether alterations in chaperone gene expression in response to chronic nPM stress can explain the observed effects on proteostasis in C. elegans. It is important to note that neuroinflammation is induced upon nPM exposure [14], making it difficult to ascertain whether effects of nPM on proteostasis are upstream or downstream of inflammation. Utilizing C. elegans as our model system will allow us to separate these two processes because this model nematode lacks the transcription factor NFκB and thus does not experience a canonical inflammatory response. Therefore, we will be able to examine the impact of particulate air pollution on proteostasis without the confounding effects of inflammation. Furthermore, the tools and sensors required to monitor changes in C. elegans proteostasis in real-time are plentiful and well-documented, making this animal an especially powerful tool for the proposed study.

Methods

C. elegans strains, growth, and maintenance

The following C. elegans strains will be utilized: N2 (wild type, Bristol), AM140 (rmIs132 [unc-54::polyQ35::YFP]) [15], AM141 (rmIs133 [unc-54::polyQ40::YFP]) [15], OG412 (drIs20 [vha-6p::Q44::YFP]) [16] and GMC101 (dvIs100 [unc54p::Abeta1-42]) [17]. All strains of C. elegans will be obtained from the Caenorhabditis Genetics Center (University of Minnesota) and maintained at 20°C on Nematode Growth Media (NGM) seeded with OP50 E. coli bacteria as a food source according to the standard methods [18].

Acquiring nanoparticulate matter from polluted air

Traffic-derived nanoparticulate air pollution samples (nPM) were collected in Los Angeles, California using a high-volume ultrafine particulate (HVUP) sampler with a Teflon filter. Dried nPM samples were eluted to 150 μg/mL with deionized water according to established methods [19]. Characterized and validated nPM samples have been generously gifted to us by the laboratory of Caleb Finch of the University of Southern California. As bacterial contamination could affect proteostasis, nPM samples will be sterilized by UV-C irradiation in a biosafety cabinet for at least 15min. To ensure that samples are free of bacterial contamination, 20uL of nPM will be transferred to an NGM plate, incubated for 3 days and examined for the appearance of colonies. For consistency, a single batch of eluted nPM will be used for all of the experiments proposed herein.

Exposure paradigm

C. elegans will be grown to the L1 or L4 stage, at which point 20–50 animals will be exposed to 75ug/mL nPM. The exact number of animals exposed will depend on the constraints of specific experiments as described in our experimental design. M9 will serve as our negative control, while 5mM paraquat (PQ) will be a positive control for oxidative stress. Exposures will be performed at 20°C in 96 well plates. 100μL of 2X M9 liquid medium will be diluted with an equal volume of nPM (or water for unexposed controls) supplemented with 10μg/mL cholesterol and OP50 bacteria for up to 3 days. To maintain uniform nPM concentration for the duration of the experiment, and to prevent animals from falling to the bottom of the well, 96-well plates will undergo continuous gentle rocking on a nutator. All exposures will be performed in biological triplicate.

Counting aggregates

For YFP-tagged polyQ-expressing animals, at least 20 individuals for each exposure will be singled onto seeded plates and chilled on ice to slow movement. Aggregates will be counted in individual live animals using a fluorescent stereomicroscope (Leica M165 FC) fitted with a digital camera according to established methods [20]. All experiments involving aggregate counting will be performed in at least biological triplicate. Amyloid beta (Aβ) is not fluorescently tagged; therefore, nPM-mediated changes in aggregation propensity will be determined via immunofluorescence as previously described [3]. In short, animals will be fixed with paraformaldehyde, treated with β-mercaptoethanol and collagenase, and incubated with the monoclonal anti-amyloid beta antibody derived from clone BAM-10 sold by Sigma (St. Louis, MO). Secondary antibodies will be labeled with FITC for visualization on a Leica sp7 laser scanning confocal microscope, or with a fluorescent compound microscope (Zeiss Axio observer).

Thrashing assays

To assay for changes in proteotoxicity triggered by exposure to nPM, thrashing assays will be performed as described previously [21]. Specifically, 30 L4 AM140 or AM141 animals expressing polyQ35-YFP or polyQ40-YFP in body wall muscle cells will be exposed to nPM in liquid for 72hrs at which time they will be allowed to recover on seeded plates for 15-30min and then picked onto a drop of M9. After a 30s recovery, the number of body bends per minute will be counted manually under a Leica M165 FC stereomicroscope. All thrashing assays will be performed in at least biological triplicate.

Paralysis assays

To assay for changes in Aβ toxicity in body wall muscle cells in response to nPM, GMC101 animals will be exposed to +/- nPM either as L4s for 1hr (acute stress) or as L1s for 3d (chronic stress). Paralysis will then be monitored at 20° or 25°C for at least 3 days. N2 animals will be utilized as a control to ascertain whether any observed paralysis is due to a gene (Aβ)—environment (nPM) interaction or is simply an effect of the nPM, irrespective of Aβ. All paralysis assays will be performed in at least biological triplicate.

qRT-PCR

RNA will be isolated using 250μL Trizol (Sigma-Aldrich, St. Louis, MO) according to the manufacturer’s instructions. Removal of genomic DNA and cDNA synthesis will be performed with the iScript gDNA clear cDNA synthesis kit (Bio-Rad, Hercules, CA). qPCR will be performed with the SYBR green master mix (Bio-Rad, Hercules, CA) using previously published gene-specific primers (). To control for differences in sample concentration, the expression of stress genes will be normalized to actin. We will plot gene expression relative to the M9 control and perform t-tests to compare each exposure to the control. All gene expression studies will be performed in at least biological triplicate.

Native gels

Native protein from ~50 animals will be extracted mechanically by grinding in liquid nitrogen followed by the addition of 30μL of ice cold native lysis buffer as described previously [24]. Native samples will be resolved immediately after extraction on a 6% native PAGE gel. Fluorescent bands containing YFP protein will be detected under UV light on a BioRad gel-doc imaging system (Hercules, CA). YFP-containing polyQ protein bands representing either monomeric protein or high molecular weight species will be quantified using ImageJ and the ratio of monomers to high molecular weight species will be calculated. Detection of unlabeled Aβ1–42 oligomers will be as described above for polyQ, but with some modifications. Specifically, after electrophoresis, gels will be heated in SDS to denature the resolved protein and then a western transfer to a PVDF membrane will be performed as described [24]. Standard immunoblot protocols with anti-Aβ antibodies (clone BAM-10, Sigma) will allow visualization using the LI-COR Odyssey system (Lincoln, NE). All native gels will be performed in at least biological triplicate.

SDS-PAGE

Total protein will be isolated from 10–20 individuals by boiling in laemmli sample buffer. Samples will be run on a 10% SDS-PAGE gel and transferred to a PVDF membrane. Immunodetection will be performed with anti- anti-Aβ antibody (clone BAM-10, Sigma), anti-YFP antibody (Rockland), anti-polyQ antibody (clone 3B5H10, Sigma), or anti-alpha-tubulin antibody (B-5-1-2, Sigma) as a loading control. All secondary antibodies will be IR-conjugated for visualization using the LI-COR Odyssey system (Lincoln, NE). All SDS-PAGE gels will be performed in at least biological triplicate.

Experimental design and rationale

A. Does the exposure to nPM exacerbate the formation of large visible amyloid beta (Aβ) or polyglutamine (polyQ) protein aggregates in the genetically tractable C. elegans?

Background/Rationale

AD-associated fragments of Aβ have been expressed in C. elegans and shown to display age-dependent and temperature-dependent toxicity [17]. Likewise, polyQ-containing proteins have been expressed in C. elegans muscle cells [15], intestines [16] or neurons [25], where they aggregate and are toxic in a manner dependent both on age and the length of the polyQ repeat expansion. The polyQ-expressing animals in particular have been extraordinarily sensitive reporters of the protein folding environment, as various stresses such as increased misfolded protein load [3] or aging [15] trigger premature polyQ aggregation. If nPM causes generalized damage to cellular proteins that is of sufficient magnitude to stress the proteostasis network, then we would expect to observe an increase in Aβ or polyQ aggregation.

Experiment

To investigate the effects of exposure to nPM on disease-associated protein folding in the intestine, the initial site of contact with nPM, we will expose 20–30 OG412 (Q44-YFP) animals at the L4 larval stage to nPM for three days and the formation of large visible protein aggregates will be monitored as described above. These exposure assays will be performed in at least biological triplicate. Results from each replicate will be pooled and the number of large visible aggregates in the intestines of individual animals will be plotted along with mean and standard error of the mean (SEM). To determine whether nPM exposure affects proteostasis in more distal tissues, such as the body wall muscle cells, AM140 (Q35-YFP), AM141 (Q40-YFP), or GMC101 (Aβ1–42) animals will be exposed to nPM at the L1 or L4 stage and the formation of large visible protein aggregates will be monitored as described above. Exposures will be performed in at least biological triplicate. Results from each replicate will be pooled and the number of large visible aggregates in body wall muscle cells of individual animals will be plotted along with mean and SEM. As an additional assay for changes in the relative concentration of large visible aggregates in response to nPM, SDS-PAGE gels will be performed as described above. This is expected to reveal the formation of SDS-insoluble protein species.

B. Does exposure to particulate air pollution trigger an increase in polyQ or Aβ toxic oligomers in C. elegans?

While large visible deposits of aggregated protein are hallmarks of many neurodegenerative diseases, overwhelming evidence points to these large aggregates being cytoprotective, with small oligomers being the toxic species [26]. Thus, while the large aggregates examined in the previous aim may be indicative of proteostasis imbalance, they cannot be taken as evidence of proteotoxicity. Therefore, we will determine whether exposure of C. elegans to nPM alters the relative amounts of soluble, aggregated, and oligomeric protein and whether this leads to proteotoxicity. To determine whether nPM or PQ exposure alters the aggregation profile in animals expressing expanded polyQ or Aβ, 50 AM140 (muscle Q35-YFP), AM141 (muscle Q40-YFP), GMC101 (muscle Aβ1–42) or OG412 (intestinal Q44-YFP) animals will be exposed as L4s to nPM or PQ as described above. High molecular weight species, likely representing oligomers, will be quantified via native gel electrophoresis and compared to the abundance of monomers. Exposures and native gels will be performed in triplicate and mean ratios will be calculated and plotted. T-tests will be performed with GraphPad Prism comparing the ratios observed in control (M9) samples to those observed following exposure to nPM or PQ. Toxicity of polyQ35, polyQ40, or Aβ in body wall muscle cells will be measured as a function of thrashing rate in liquid as described previously [21]. Because toxicity is only observed for the Aβ-expressing strain (GMC101) under elevated temperature [17], it will be interesting to determine whether nPM, like thermal stress, causes sufficient proteostatic stress to expose Aβ-toxicity. Exposures and thrashing assays will be performed in biological triplicate. Results from each replicate will be pooled and data from individual animals will be plotted along with mean and SEM.

C. Can alterations in chaperone gene expression in response to chronic nPM stress explain the observed effects on proteostasis in C. elegans?

As cells and organisms are exposed to conditions that trigger protein misfolding, transcriptional responses involved in protein quality control, such as the heat shock response (HSR), the Unfolded Protein Response (UPR), and the oxidative stress response, are induced [27-29]. If particulate air pollution is a significant source of proteotoxic stress, we would expect it to trigger stress-responsive gene expression. In fact, the immediate transcriptional upregulation of some UPR targets such as the molecular chaperone gene hsp-4 and oxidative stress targets such as the antioxidant gene, gst-4 [12] has been recently reported for L1-stage wild type C. elegans exposed to nPM for 1hr. As at least some of the studies proposed here will involve chronic (3d) exposures to nPM, we aim to determine whether the expression of proteostasis network components responds to nPM stress over this time period. Such gene expression changes would be expected to underlie any observed changes in the protein folding environment revealed via the completion of this study. As exposure to particulate air pollution is presumably a chronic event that leads to protein damage over time, we will examine the transcriptional effects of chronic (72hr) exposure to nPM. Specifically, we will expose 50 L4 stage wild type (N2) animals to nPM or PQ as described above. M9 will serve as the negative control (no stress). PQ will serve as a positive control for oxidative stress, as nPM has been shown to trigger this stress response [12,30]. Samples will be harvested after 1hr, 24hrs, or 72hrs of exposure for RNA isolation. qRT-PCR will be utilized to monitor the expression of the HSR targets, C12C8.1 and F44E5.4, the UPR target hsp-4, the mitochondrial UPR target hsp-6, and the oxidative stress response target gst-4. Gene expression changes will be represented relative to the basal levels of gene expression (M9 sample) at each time point. Exposures will be performed a minimum of three times, resulting in at least biological triplicates for each time point. All qRT-PCR reactions will be prepared in technical triplicate to control for pipetting error.

Timeline

It is our estimation that the proposed gene expression analysis and the examination of the effects of nPM exposure on polyQ-expressing animals will be completed by the middle of 2021. Analysis of Aβ-expressing animals will commence near the middle of 2021 and will take approximately one year. Therefore, we expect to have this study completed and a manuscript ready for submission by the end of 2022.

Dissemination of results

Following the completion of the study proposed here, the results will be published as a Registered Report in PLoS ONE. 25 Sep 2020 PONE-D-20-23642 Determining the effects of nanoparticulate air pollution on proteostasis in Caenorhabditis elegans PLOS ONE Dear Dr. Kikis, Thank you for submitting your manuscript to PLOS ONE. I apologize for the delay in obtaining a review, but I believe that you now have some useful comments to consider. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. The main questions to address are related to your choice of methodology that you will find below.  There were several other minor issues to address. Please ensure that your decision is justified on PLOS ONE’s publication criteria and not, for example, on novelty or perceived impact. ============================== Please submit your revised manuscript by Nov 08 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, David R Borchelt Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions (e.g. necessary controls, absence of floor or ceiling effects) to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory. Reviewer #1: Yes Reviewer #2: Partly ********** 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors described where all data underlying the findings will be made available when the study is complete? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics. You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This is an exciting study. Please address minor concerns: The Registered Report Study by Green and Kikis titled “Determining the effects of nanoparticulate air pollution on proteostasis in Caenorhabditis elegans” explores the impact of air pollution on organismal proteostasis. Nano-sized particulate matter (nPM) is known to contribute to the pathogenesis of neurodegenerative diseases across mouse models and in humans. Moreover, previous research using mice and C. elegans suggests that nPM affects host proteostasis. The authors pose to investigate the effect of nPM on the host by posing an interesting hypothesis “that exposure to nPM will challenge the buffering capacity of the proteostasis network, thereby reducing the efficiency of disease-associated protein folding.” C. elegans is an ideal model organism to test this hypothesis as it offers a comprehensive collection of neurodegenerative disease models, proteostasis reporters, and genetic tools. Moreover, the model lacks inflammatory response and can therefore be used to study a direct effect of nPM on proteostasis. Overall, the authors propose experiments that will explore a novel area of research that has been recently gaining interest within the scientific community. If successful, the results of this study can be extrapolated to and followed up in higher organisms. This study will provide exciting results and is recommended for publication in PLoS One. There are minor comments that need to be addressed: • Why is nano-sized particulate air pollution abbreviated as nPM? What does M stand for? Missing “matter”? • The threshold of polyQ aggregation is between 35-40. The authors may benefit by including polyQ37 strain instead of, or in addition to, polyQ40. • It is assumed that the animals will ingest nPM, and the immediate effect will be on the proteostasis in the intestine. The study may benefit from including intestinal polyQ44. If the particulates are restricted to the intestine, muscle-specific polyQs may not be affected; however, that would not mean there is no effect. • Are the nPM samples sterile? If not, will they be sterilized by UV, heat, or any other method? If not sterile, the bacteria in the sample may affect proteostasis. • Line 108: change the citation style to numerical so it matches the rest of the paper. • Line 108: with deionized water? • If the stock nPM concentration is 150ug/mL and the animals will be exposed to 75ug/mL that means the stock will have to be diluted 1:1 to obtain the final concentration. The protocol states that 200uL of M9 supplemented with 10ug/mL cholesterol will be present in each well. It may be more clear to write that 100uL of 2X M9 at 20ug/mL cholesterol will be diluted with an equal volume of nPM. • For aggregate counting, will only one biological replicate be performed? • For qRT-PCR, it would be good if the authors could include mitochondrial hsp70 (hsp-6) as well. That way, all major stress pathways are assessed. • Line 174: please add particulates “…exposure to air pollution particulates.” • The authors have to be cautious about interpreting aggregate counts when normalized to body size. Although the animals may be smaller in size, they are not developmentally delayed (post L4) and their biological age does not change. The absolute numbers of aggregates may be a better approximation of the actual effect of nPM. • Line 198: Please write out standard error of the mean and then abbreviate. • The timeline seems appropriate Reviewer #2: This Registered Report Protocol by Green and Kikis outlines an interesting set of experiments aimed at understanding the effects of nano-sized particulate air pollution (nPM) on proteostasis using C. elegans. While the general premise of the study will be of interest to a wide audience, the motivations for this particular protocol require clarification, the methods in some cases require modification, and the overall organization of the study can be improved. Major comments: Overall, the organization of the study goals appears to be in reverse order. Establishing nPM-induced phenotypic changes, i.e. motor dysfunction and protein aggregation, should precede the mechanistic investigation of chaperone gene changes that may explain these phenotypes. The authors should either re-organize the study, or provide clear and explicit justification for the order of experiments chosen. Aggregates simply cannot be counted by eye on a stereo-microscope. This is neither accurate nor reproducible. Individual protein aggregates are only grossly visible using the method described, and are indistinguishable along the 3-dimensional axis of the animal. The method for fluorescent aggregate quantification as described is simply unacceptable. A single thrashing assay (manual counting of body bends) is proposed for measurement of motor defects. However, manual quantification is prone to error, and using only a single assay is unlikely to produce meaningful results. Instead, the authors should consider video capture of thrashing worms followed by automated analysis of multiple motor parameters as a much more powerful assessment of motor function. The authors propose to use Native gels for biochemical analysis of aggregates. SDS-PAGE should be performed as well, in order to resolve SDS- and heat-stable aggregate species. Minor comments: In the introduction, the authors should be careful not to give the impression that the mechanisms of HD or AD are entirely known. The statement that AD is more mechanistically complex than HD is not warranted, given that both diseases involve protein aggregation and the relationship of aggregates with neurotoxicity is still poorly understood in both cases. The authors should introduce the diseases and state what is as yet unknown, in order to set up the motivation for their study. The authors should not overstate the evidence for the link between air pollution and AD onset as being “well-established” (line 69). The authors should simply cite the relevant literature, describing specifically what has been found that supports this link. It is not clear from the introduction precisely what is still not known regarding the effects of nPM on proteostasis. For example, the authors cite a C. elegans study in which nPM induced changes in proteostasis network genes, yet the first goal outlined for the current study is to determine “Whether chaperone gene expression is altered in C. elegans exposed to chronic nPM stress.” Aren’t the changes in chaperone gene expression in response to nPM already known from the cited reference? Please clarify how the proposed goal is novel. The second goal outlined in the introduction reads “Whether the folding of amyloid beta (Aβ) or polyglutamine (polyQ) proteins” but the authors intend to say “Whether the misfolding…” Please correct. It is not clear how the second goal (whether the misfolding of disease-linked proteins is exacerbated with nPM) and the third goal (whether nPM induces toxic oligomers) are different. Is the second goal looking at inclusions rather than oligomers? Is the distinction between the goals related to toxicity? Please revise such that the two goals are clearly delineated. In line 108, I believe “deionized” should read “deionized water”. Please correct. The authors should state whether negative control wells will have equal volume of the same solvent that is used to make up the working solution of nPM. The authors should consider using complete S medium instead of M9 for liquid culture of C. elegans, since S medium contains additional nutrients to support C. elegans survival. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Daniel Czyz Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Review_PONE-D-20-23642.docx Click here for additional data file. 6 Nov 2020 1. Reviewer #1 pointed out that we did not define the letter “M” in “nPM.” This has been corrected. Specifically, we have included the following sentence in the introduction “…nano-sized particulate matter (nPM) obtained from traffic-derived air pollution…” 2. Reviewer #1 suggested that we “may benefit by including polyQ37 instead of, or in addition to, polyQ40.” This was an interesting suggestion and one that we seriously considered. In the end, we would like to stick to polyQ35 and polyQ40. This is because the polyQ40 strain has already been shown to be highly sensitive to changes in the protein folding environment. Namely, Gidalevitz et. al. demonstrated this is in Science 311 (5766), 1471-1474. More recently, this same protein was shown to be sensitive to changes in the genetic background BMC biology 18 (1), 1-20. Taken together, we think that polyQ40 is a very important strain to use in our proposed project. Fewer studies have utilized polyQ37. While we could theoretically use all three strains, we feel that that would be excessive and would needlessly use up too much of our stock of nPM, especially as we are also including in our study a strain expressing polyQ44 in the intestine and a strain expressing Abeta in body wall muscle cells. 3. Reviewer #1 asked whether the nPM samples are sterile. Based on this comment, we have included the following sentence in the methods section, “As bacterial contamination could affect proteostasis, nPM samples will be sterilized by UV-C irradiation in a biosafety cabinet for at least 15min. To ensure that samples are free of bacterial contamination, 20uL of nPM will be transferred to an NGM plate, incubated for 3 days and examined for the appearance of colonies.” 4. Reviewer #1 suggested that we clarify the way our nPM will be diluted to obtain the appropriate final concentrations of nPM and Reviewer #2 also asked about the solvent for nPM and negative controls (I am paraphrasing these comments/suggestions): To address these concerns, we have added the following sentence to the methods section, “Exposures will be performed at 20°C in 96 well plates. 100μL of 2X M9 liquid medium will be diluted with an equal volume of nPM (or water for unexposed controls) supplemented with 10μg/mL cholesterol and OP50 bacteria for up to 3 days.” It should be noted that nPM is already in water, so there are no solvent considerations beyond those addressed in the sentence above. 5. Reviewer #1 asked whether only one biological replicate will be performed for aggregate counting. All experiments in this study will be performed in at least biological triplicate. We have now clarified this throughout the text (in the section on aggregate counting and other sections as well). 6. Reviewer #1 cautioned us not to normalize aggregate counts to body size. Thank you for this suggestion. The text has been revised to remove any normalization to body size. 7. Reviewer #2 expressed concern about the organization of the study. Specifically, this reviewer suggested that “establishing nPM-induced phenotypic changes should precede the mechanistic investigation of chaperone gene expression.” This point is well-taken and we have rearranged the aims accordingly. 8. Reviewer #2 stated that “aggregates simply cannot be counted by eye on a stereo-microscope.” To address this concern, we have now indicated that “Aggregates will be counted in individual live animals using a fluorescent stereomicroscope (Leica M165 FC) fitted with a digital camera according to established methods (20).” The polyQ aggregates are very large, bright, and defined. Stereomicroscopes, albeit fitted with nice digital cameras, have been used successfully in many studies to quantify aggregate number. These studies include the original paper in which the muscle polyQ model was studied (Morley et. al., (2002) PNAS) and a more recent report of the effects of genetic background on polyQ aggregation (Alexander-Floyd et. al. (2020) BMC Biology). The methods we are proposing here mirror those of the more recent study. 9. Reviewer #2 suggested that we “consider video capture of thrashing worms followed by automated analysis of multiple motor parameters.” We are aware that recent technological advances have made such automated analysis increasingly common. If cost were not prohibitive, we would (gladly and enthusiastically) purchase a MicroTracker or similar device. However, at $16,400, this far exceeds our budget. Fortunately, our lab and others have utilized manual counting of thrashing effectively to observe changes in motility for these and similar animals. Thus, we are cautiously optimistic that, even with our proposed methods, we will be able to observe decreases in muscle function. 10. Reviewer #2 suggested that “SDS-PAGE should be performed… in order to resolve SDS- and heat-stable aggregate species.” We have now included this in the section on the characterization of large, visible, protein aggregates. Specifically, we state “As an additional assay for changes in the relative concentration of large visible aggregates in response to nPM, SDS-PAGE gels will be performed as described above. This is expected to reveal the formation of SDS-insoluble protein species.” 11. Reviewer #2 suggested that we “be careful not to give the impression that the mechanisms of HD and AD are entirely known” and also “not overstate the evidence for the link between air pollution and AD onset being ‘well-established.’” These are good points and the introduction has been revised accordingly. 12. Reviewer #2 suggests that “it is not clear from the introduction precisely what is still not know regarding the effects of nPM on proteostasis.” Thank you for mentioning that, because this is a very important point. In fact, very little is known about the effects of nPM on proteostasis and that is why we think that this study is so important. Specifically, there have only been two studies that touch on this at all and neither examined the effects of nPM on protein folding. To clarify this point, we have revised the introduction to now say, “Consistent with this hypothesis, it was recently shown that the expression levels of proteostasis network genes in C. elegans are responsive to nPM (12). Furthermore, the degradative pathways of the proteostasis network have also been shown to be activated in mice exposed to nPM (13). The effects of this dysregulation on the folding, or misfolding, of disease-associated proteins has never been directly tested. We therefore propose testing the hypothesis that exposure to nPM will challenge the buffering capacity of the proteostasis network, thereby reducing the efficiency of disease-associated protein folding.” 13. Reviewer #2 pointed out that “it is not clear how the second goal and the third goal are different” and asked whether “the second goal is looking at inclusions rather than oligomers.” That is exactly right. What is now aim “A” is examining large visible aggregates and what is now aim “B” is examining oligomers. We have also included an analysis of toxicity in with aim B because of the likely connection between oligomers and toxicity. To clarify this, we have reworded aim A as follows, “Does the exposure to nPM exacerbate the formation of large visible amyloid beta (Aβ) or polyglutamine (polyQ) protein aggregates in the genetically tractable C. elegans?” We have likewise reworded aim B, “Does exposure to particulate air pollution trigger an increase in polyQ or Aβ toxic oligomers in C. elegans? 14. Reviewer #2 suggested that we use complete S medium instead of M9. We had originally proposed using M9 because the one prior C. elegans study involving exposure to nPM utilized M9 and we wanted to be as consistent with that study as possible so as to compare results. However, it is worth noting that the prior study did short exposures, so media would have admittedly less of an effect on C. elegans growth and development. Therefore, we did some pilot studies in our lab to ensure that our chronic exposure in M9 does not negatively affect the animal. We found that under our proposed conditions, animals reach adulthood as expected and are phenotypically normal—meaning that they lay fertilized eggs and the eggs hatch as expected. There are no obvious developmental delays, bagging, etc. Thus, we propose sticking with the M9-based media supplemented with cholesterol and OP50. 15. Both reviewers identified some sentences with missing or incorrect words. Thank you for pointing these out! We have corrected them in the revised manuscript. Submitted filename: Response to Reviewers_Kikis.docx Click here for additional data file. 23 Nov 2020 Determining the effects of nanoparticulate air pollution on proteostasis in Caenorhabditis elegans PONE-D-20-23642R1 Dear Dr. Kikis, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, David R Borchelt Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field. Reviewer #2: Yes ********** 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions (e.g. necessary controls, absence of floor or ceiling effects) to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory. Reviewer #2: Yes ********** 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? Reviewer #2: Yes ********** 4. Have the authors described where all data underlying the findings will be made available when the study is complete? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics. You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: The authors have carefully revised and re-organized the manuscript, and all of my concerns have been addressed. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: No 26 Nov 2020 PONE-D-20-23642R1 Determining the effects of nanoparticulate air pollution on proteostasis in Caenorhabditis elegans Dear Dr. Kikis: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. David R Borchelt Academic Editor PLOS ONE
Table 1

Primers used to investigate changes in gene expression.

GeneForward PrimerReverse PrimerReferences
hsp-4CTAAGATCGAGATCGAGTCACTCGCTTCAATGTAGCACGGAACHaghani et. al., 2019 [12]
gst-4GATGCTCGTGCTCTTGCTGCCGAATTGTTCTCCATCGACHaghani et. al., 2019 [12]
hsp-6TCGTGAACGTTTCAGCCAGACTCAGCGGCATTCTTTTCGGBennet et. al., 2014 [22]
C12C8.1ACGGGCTTTCCTTGTTTTACTCATGTGTCGGTATTTATCPrahlad et. al., 2008 [23]
F44E5.4TGTCCTTTCCGGTCTTCCTTTTGAATGAACCAACTGCTGCTGCTCTTPrahlad et. al., 2008 [23]
ActinATCACCGCTCTTGCCCCATCGGCCGGACTCGTCGTATTCTTPrahlad et. al., 2008 [23]
  30 in total

Review 1.  Alzheimer's disease: the amyloid cascade hypothesis.

Authors:  J A Hardy; G A Higgins
Journal:  Science       Date:  1992-04-10       Impact factor: 47.728

2.  Mammalian Heat Shock Response and Mechanisms Underlying Its Genome-wide Transcriptional Regulation.

Authors:  Dig B Mahat; H Hans Salamanca; Fabiana M Duarte; Charles G Danko; John T Lis
Journal:  Mol Cell       Date:  2016-03-24       Impact factor: 17.970

Review 3.  The Aβ oligomer hypothesis for synapse failure and memory loss in Alzheimer's disease.

Authors:  Sergio T Ferreira; William L Klein
Journal:  Neurobiol Learn Mem       Date:  2011-09-06       Impact factor: 2.877

4.  The threshold for polyglutamine-expansion protein aggregation and cellular toxicity is dynamic and influenced by aging in Caenorhabditis elegans.

Authors:  James F Morley; Heather R Brignull; Jill J Weyers; Richard I Morimoto
Journal:  Proc Natl Acad Sci U S A       Date:  2002-07-16       Impact factor: 11.205

5.  Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease.

Authors:  W J Strittmatter; K H Weisgraber; D Y Huang; L M Dong; G S Salvesen; M Pericak-Vance; D Schmechel; A M Saunders; D Goldgaber; A D Roses
Journal:  Proc Natl Acad Sci U S A       Date:  1993-09-01       Impact factor: 11.205

6.  The genetics of Caenorhabditis elegans.

Authors:  S Brenner
Journal:  Genetics       Date:  1974-05       Impact factor: 4.562

7.  Alzheimer disease risk genes: 29 and counting.

Authors:  Lars Bertram; Rudolph E Tanzi
Journal:  Nat Rev Neurol       Date:  2019-04       Impact factor: 42.937

Review 8.  The proteostasis network and its decline in ageing.

Authors:  Mark S Hipp; Prasad Kasturi; F Ulrich Hartl
Journal:  Nat Rev Mol Cell Biol       Date:  2019-07       Impact factor: 94.444

Review 9.  Adapting proteostasis for disease intervention.

Authors:  William E Balch; Richard I Morimoto; Andrew Dillin; Jeffery W Kelly
Journal:  Science       Date:  2008-02-15       Impact factor: 63.714

10.  A new Caenorhabditis elegans model of human huntingtin 513 aggregation and toxicity in body wall muscles.

Authors:  Amy L Lee; Hailey M Ung; L Paul Sands; Elise A Kikis
Journal:  PLoS One       Date:  2017-03-10       Impact factor: 3.240

View more
  1 in total

1.  The utility of alternative models in particulate matter air pollution toxicology.

Authors:  Jacob Smoot; Stephanie Padilla; Aimen K Farraj
Journal:  Curr Res Toxicol       Date:  2022-05-27
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.