Literature DB >> 33270669

Morphological description of a novel synthetic allotetraploid(A1A1G3G3) of Gossypium herbaceum L.and G.nelsonii Fryx. suitable for disease-resistant breeding applications.

Xiaomin Yin1, Rulin Zhan1, Yingdui He1, Shun Song1, Lixia Wang1, Yu Ge1, Di Chen1.   

Abstract

Wild species of Gossypium ssp. are an important source of traits for improving commercial cotton cultivars. Previous reports show that Gossypium herbaceum L. and Gossypium nelsonii Fryx. have better disease resistance characteristics than commercial cotton varieties. However, chromosome ploidy and biological isolation make it difficult to hybridize diploid species with the tetraploid Gossypium hirsutum L. We developed a new allotetraploid cotton genotype (A1A1G3G3) using a process of distant hybridization within wild cotton species to create new germplasms. First of all, G. herbaceum and G. nelsonii were used for interspecific hybridization to obtain F1 generation. Afterwards, apical meristems of the F1 diploid cotton plants were treated with colchicine to induce chromosome doubling. The new interspecific F1 hybrid and S1 cotton plants originated from chromosome duplication, were tested via morphological and molecular markers and confirmed their tetraploidy through flowrometric and cytological identification. The S1 tetraploid cotton plants was crossed with a TM-1 line and fertile hybrid offspring were obtained. These S2 offsprings were tested for resistance to Verticillium wilt and demonstrated adequate tolerance to this fungi. The results shows that the new S1 cotton line could be used as parental material for hybridization with G. hirsutum to produce pathogen-resistant cotton hybrids. This new S1 allotetraploid genotype will contributes to the enrichment of Gossypium germplasm resources and is expected to be valuable in polyploidy evolutionary studies.

Entities:  

Year:  2020        PMID: 33270669      PMCID: PMC7714114          DOI: 10.1371/journal.pone.0242620

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The Gossypium genus includes 54 species, of which 50 are wild cotton species and four are cultivated cotton species made up of two diploids and two tetraploids [1, 2]. Approximately 90% of commercially produced cotton is cultivated from G. hirsutum L. However, as the high-yielding quality of cultivated species continuously increases, abiotic and biotic resistance usually does not increase and can even be weakened [3, 4]. To increase the resistance in G. hirsutum L., the existing genetic basis of cultivated cotton should be expanded to adapt to biotic and abiotic stresses. It is generally believed that wild cotton species contain a large treasure trove of traits that could be used to improve cultivated species [5]. The wild cotton species are widely distributed in various ecological conditions in the Americas, Oceania, Africa, and Asia. These species have undergone long-term natural selection, and are resistant to many types of adverse factors, such as disease, insects, drought, heat, and salinity. At the same time, there are many mutant varieties, all of which contribute to cotton's rich genetic foundation [6, 7]. G. herbaceum L. is a diploid cotton species cultivated in Western China and Russia. This species is highly resistant to drought, cotton leaf curl virus and sap-feeding insects such as leafhoppers, whiteflies, thrips, and aphids [8, 9]. G. nelsonii Fryx. is a wild diploid cotton species that originated in Australia and has many economically valuable characteristics, such as delayed pigment gland formation. This is beneficial for producing seeds with low gossypol levels. In addition, it is resistant to blight, Verticillium wilt, aphids, and mites; and is tolerant to abiotic stress conditions such as high temperatures and drought. Furthermore, its brown, straight, extensible, and high-strength fibers are valuable agronomical traits. If these characteristics can be transferred to tetraploid G. hirsutum L. (2n = 4x = 52, AADD), then the resulting species will be extremely valuable. Owing to biological isolation barriers, it is difficult to directly hybridize wild diploid cotton species with tetraploid G. hirsutum. We are proposing a new pathway for transferring genes from two diploid cotton species into tetraploid G. hirsutum. Specifically, two different diploid species undergo interspecific hybridization so that they can recognize and overcome their biological segregations to form the diploid hybrid F1. Following that, artificial ploidy doubling of the apical regions in F1 hybrids is carried out to obtain a tetraploid cotton species that has the same chromosome number as G. hirsutum L. The new tetraploid cotton is then hybridized with the tetraploid G. hirsutum to achieve efficient gene transfer. This process shortens the time needed to introduce essential genes from two species and is currently the most direct and easiest method that has the potential to be utilized with wild cotton. In the last few decades, studies on interspecific hybrids have been reported, including G. arboretum × G. raimondii [10], G. hirsutum × G. sturtianum [11], G. arboreum × G. bickii [12], G. hirsutum × G. klotzschianum [13], G. hirsutum × G. trilobum [14], G. arboreum × G. anomalum [15], G. hirsutum × G. anomalum [16], G. herbaceum × G. australe [17], G.hirsutum × G.australe [18], G.hirsutum × G. arboretum [19], and G. capitis-viridis × (G.hirsutum × G.australe)2 [20]. To the best of our knowledge, there has been no report of using G. herbaceum and G. nelsonii to successfully synthesize an allotetraploid (A1A1G3G3). In this work, we applied homoploid hybridization to provide a pathway to simultaneously transfer genes from these two diploid cotton species into G. hirsutum using G. herbaceum as the female parent and G. nelsonii as the male parent to successfully generate the interspecific hybrid F1 (2n = A1G3 = 26). Colchicine treatments were used to double the chromosome number and form a new tetraploid cotton genotype (code: S1) (2n = 4x = 52, A1A1G3G3). The birth of the new S1 cotton tetraploid not only enriches the germplasm of cotton but also provides a valuable intermediate material for cotton hybridization and a new tool for breeding. This is a successful example of using wild cotton species for distant hybridization and has important significance for promoting scientific research on cotton genetics.

Materials and methods

Plant material

The diploid G. herbaceum cotton species that has been cultivated in China is also known as Hongxingcaomian (2n = 2x = 26, A1A1), and is a line that has not been subjected to inbreeding. G. nelsonii is a diploid cotton species from Australia (2n = 2x = 26, G3G3), and the two G. hirsutum lines, cv. Jimian11 (a commercial variety from China) and the control variety TM-1 (a prototype for molecular mapping in cotton) were used in our experiments. The lines mentioned above were obtained from the China National Wild Cotton Nursery in Sanya, China. The Verticillium dahliae strain Dahlia Vd080, used for disease resistance identification, was provided by the Institute of Cotton Research, Chinese Academy of Agricultural Sciences.

Interspecific hybridization

Interspecific hybridization of the cotton was carried out in Sanya (18°25′34″N, 109°28′25″E), Hainan, China in 2015 [21]. When the two parental species flowered at the same time, G. herbaceum plants were selected as the female parents. One day before flowering, all stamens in the flowers from the female parents were completely removed. Wax tubes were used to cover the stigmas and non-woven bags were used to cover all of the floral buds. The afternoon before flowering, cotton thread was used to tie the apices of the petals in the flowers of the male parents (G. nelsonii), and non-woven bags were used to cover the floral buds entirely. From 9 am to 12 pm on the day of flowering, pollen from the male parents was used to pollinate the stigmas of the female parents for hybridization. After pollination was completed, wax tubes were used to cover the stigmas, non-woven bags were used to cover the entire floral buds, and labels were hung. After the cotton bolls had matured, the seeds were removed and sown in nutrient pots containing sterile soil. After one or two true leaves had sprouted, the plants were transplanted into fields and normal fertilizer and water management was carried out. The morphological characteristics of the plants were observed, including the type of plant, stems, leaves, flowers and bolls. All these observations for each plant part at different biological stages were photographed using a digital camera, and the photographs were edited by using Photoshop software.

SSR molecular marker analysis in F1 hybrids

We randomly selected 568 pairs of SSRs based on our cotton genetic map [22] to screen for parental polymorphisms. The polymorphic primers obtained were used to validate the authenticity of the interspecific F1 hybrids. These SSR primer sequences can be found at http://www.cottonmarker.org. A programmable gradient thermal cycler (Bio-Rad T100) was used for SSR-PCR amplification [23]. Electrophoresis and silver staining of the PCR products were carried out according to previously reported methods [24]. The bands generated by electrophoresis were photographed and edited by Photoshop software.

Chromosome duplication in the F1 interspecific hybrid

In 2016–2018, the F1 hybrids that were validated by the SSR molecular markers were grafted. The temperature was kept at 25°C and the apical growth points of the F1 hybrids were immersed in 0.30% (w/v) colchicine for 6 h. After immersion, they were placed in pots in the greenhouse that were not exposed to light and incubated until new growth points or floral buds sprouted. When the length of the new meristematic apices reached 5 cm, they were removed and grafted for storage and further validation of the chromosome doubling results [20]. Newly sprouted floral buds could grow until the afternoon before flowering. Then, a cotton thread was used to tie the tip of the petal for self-pollination and non-woven bags were used to cover the entire floral bud to prevent outcrossing. After the cotton bolls matured and underwent dehiscence, the seeds were removed and sown in nutrient pots. After one or two true leaves sprouted, the plants were transplanted into fields. The morphological characteristics of the plants were observed, including the plant shape, stems, leaves, flowers, and bolls. The resulting tetraploid plant was named S1, and chromosome counting and flowcytometric analysis were performed for validation. The morphological characteristics of each plant part were photographed using a camera, and the photographs were edited by using Photoshop software.

Ploidy analysis

In order to detect whether the S1 chromosome had been doubled, flow cytometry was used to examine the differences in nuclear DNA content between F1 hybrid and S1 cotton plants using also the diploid G. herbaceum and the tetraploid G. hirsutum (cv TM-1) as controls. The operational steps were divided into preparation of the sample cell suspensions, specific staining of DNA, and loading. Specific methods were carried out according to the description of Galbraith) [25]. A Sysmex-Partec CyFlow Cube8 flow cytometer was used to determine the nuclear DNA content. CellQuest Pro software was used to analyze the results. The experimental data are displayed in a single-parameter histogram. The ordinate represents the number of nuclei (counted), and the abscissa represents the relative intensity of the fluorescent channel.

Karyotype analysis

Microscopic observations on the number of root tip chromosomes in the F1 hybrid and its resultant tetraploid S1 progenies were carried out to observe the differences in the chromosome number between the two genotypes, and G. herbaceum and G. nelsonii which were used as controls. Finally, karyotype analysis of the F1 hybrid was performed for determination of chromosome doubling. Root tip fixation, preservation, dissection, squash preparation, and microscopy were carried out according to previously reported methods [26]. The editing of all images was done using the Photoshop software.

Validation of disease resistance in the tetraploid S2

The S2 offsprings were chosen as the target of disease resistance identification. The tetraploid S2 seedlings, growing in nutrient pots, were inoculated indoors with the Verticillium dahliae strain (code: Dahlia Vd080 strain) for preliminary determination of disease resistance. The strain cv. Jimian11 was used as an infection control group; G. herbaceum and G. nelsonii were used as disease resistance controls. In the experiment, there were two treatments (fungal suspension or sterile water for inoculation) performed in triplicate. Each replicate of the experiment contained 540 plants. Inoculations of the seedlings in the nutrient pots were carried out according to a previously reported method [27]. Seeds were sown in cylindrical paper pots (height 8 cm and diameter 5 cm) with no bottom and filled with sterile medium. When the first true leaf had grown until it was level, 107 conidia/ml of suspension was directly injected into the 8-cm-dimeter plastic tray. Only sterile water was used for inoculation in the control group. The paper pot and seedlings were placed upright in the trays so that the root systems adsorbed the suspension liquid. Examination of the disease symptoms was carried out according to previously reported methods [19]. Changes in leaf color and degree of wilting were used as a basis for preliminary observations of disease resistance in the experimental materials.

Hybridization between the S1 interspecific hybrid and G. hirsutum (TM-1 cultivar)

In the winter of 2017, hybridization was carried out in Sanya, Hainan province, China, using the tetraploid S1 as the male parent (♂) and the TM-1 line (♀) as the female parent. The hybridization method used was similar to the previously described for G. herbaceum (♀) and G. nelsonii (♂) [21], and the boll-forming rate and effective boll-forming rate of hybrids were determined. After the hybridized cotton bolls matured and underwent dehiscence, seeds were removed and sowed in nutrient pots containing sterile soil. After one or two true leaves sprouted, the plants were transplanted into fields. The morphological characteristics of the plants were observed, including plant shape, stems, leaves, flowers and bolls. Based on the morphological characteristics, the authenticity of the hybrids was preliminarily assessed and the fertility of the tetraploid S1 hybrids was examined.

Image acquisition and editing

A Canon EOS 70D digital camera with an RF 35 mm F1.8 Macro Lens was used to photograph the morphology of plant parts and electrophoresis bands of the PCR products. The images were edited with Adobe Photoshop CS5 software.

Results

F1 hybrid generation and trait observations

In 2016, hybridization was conducted using G. herbaceum as the female parent and G. nelsonii as the male parent. A total of 235 flowers were pollinated, 205 of which formed bolls. However, most bolls did not form seeds and only three effective bolls were finally obtained; each containing one seed. In 2017, the three seeds were sown in a pot and all germinated after 5 days. After the first true leaves were level, the seedlings were transplanted to the field. Floral buds appeared after 43–45 days and flowering occurred after 68–70 days. In Sanya, China, the three F1 plants showed exuberant growth, were tall, produced large numbers of flowers throughout the year, and could produce pollen. However, the pollen produced was non-viable and did not produce bolls. The samples have been preserved, but are still infertile. This observation underline the difficulty in obtaining F1 hybrids from interspecific hybridizations between G. herbaceum L. and G. nelsonii Fryx. The morphological traits of the F1 plants showed classical hybrid characteristics (Fig 1) according to the 14–item investigation data analysis (Table 1). Morphological comparison with parental plants showed that two items were greater than the parents: plant height (Fig 1A–1C) and corolla color (Fig 1E–1G). Five items were intermediate between the parents: leaf shape and color, number of lobes, bract shape, calyx teeth shape, and number of bract teeth (Fig 1E–1G). Two items were similar to the female parent, anther and pollen color (Fig 1E and 1G). Five items were similar to the male parent: stem and leaf trichomes, flowering habit, bract extension, flower opening, and extrafloral nectary (Fig 1F and 1G).
Fig 1

Pictures of plants, leaves, flowers, corollas, basal patches, filaments, anthers, pollen, calyxes, and bracts.

G. herbaceum (a, e), G. nelsonii (b, f), the F1 (c, g), the S1 (d, h).

Table 1

Comparison of morphological traits between G. herbaceum L. × G. nelsonii Fryx. F1 hybrid and its parental genotypes.

CharacterG. herbaceum L.G. nelsonii Fryx.F1
Plant height (cm)80200300
Stem/branch characteristicsLess trichomesMore trichomesMore trichomes
Shape and color of leafBroad-leaved, GreenOvoid, gray greenBroad-leaved, ovoid, subcircular, Green
No. of lobes3–50–10–3
Bract size (length × width, cm)1.1×1.31.2×0.21.1×0.5
Bract shape, No. of teethHeart-shaped, 4–6Lanceolate, 1Sword-shaped, 1–3
Bract jointingJointNo jointNo joint
Floral nectaryIntra-floralExtrafloralExtrafloral
CalyxCup-shapedWavySerration
Bract tooth5–914–6
Corolla shape and color Corolla length (cm)Yellow trumpet, around 2.1Light pink, funnel-shaped, around 3.5Pink trumpet, around 2.5
Color and size of spotRosePurpleRed
Filaments colorsPink interspersed with milky whiteRoseLight pink
Anther colorsYellowRoseLight yellow
Pollen colorsYellowMilky whiteYellow
Stigma colorsMilky whiteLight greenMilky white
BollConicalOval/
FiberSpiralUpright/

Pictures of plants, leaves, flowers, corollas, basal patches, filaments, anthers, pollen, calyxes, and bracts.

G. herbaceum (a, e), G. nelsonii (b, f), the F1 (c, g), the S1 (d, h). SSR molecular marker determination was carried out and six pairs of parental polymorphic primers (Table 2) were obtained from the screening. These six pairs of primers could be used to amplify the complementary bands from the parents in the F1 hybrids (Fig 2A), of which two primer pairs (NAU1052 and NAU3093) amplified not only the bands that are characteristic of the parents but also determined the characteristic bands of the hybrid (Figs 2A/ⅲ and 3A/ⅵ) showing the hybridized stature of F1 hybrids. Flow cytometry showed that the peak value of the control sample of G. herbaceum was approximately 200 channels (Fig 2B); the peak value of TM-1 was close to 400 channels (Fig 2C); and the peak value of the F1 hybrid was close to 200 channels (Fig 2D), indicating that the F1 hybrid was a diploid. Root tip staining and microscopy observations showed that the root tip chromosome number of both the G. herbaceum and G. nelsonii control samples (Fig 2E and 2F), and the F1 hybrid (Fig 2G) was also 26 pairs, indicating that the F1 hybrid was a diploid.
Table 2

SSR polymorphism primer sequences.

Primer numberForward sequence (5′-3′)Reverse sequence (5′-3′)
NAU1157GAGTTTGGTTCTGGGTTGAGGATCCTTTTCATCTCCTCCA
NAU1355ATCTGTTTACGCCACTCTCCCCAGCCTTTGACATTTTTCT
NAU1052CGCAGATAAAGGATGGATTTAGAGCTGGAGGACATAACAAA
JESPR156GCCTTCAATCAATTCATACGGAAGGAGAAAGCAACGAATTAG
BNL1679AATTGAGTGATACTAGCATTTCAGCAAAGGGATTTGCTGGCAGTA
NAU3093GTCTTGAACCGGAACTTGATTCCTGTTGAACACCAAAGTG
Fig 2

Validation of F1 and S1 by detecting DNA polymorphism, ploidy analysis, and the number of chromosomes.

(a) Microsatellite loci identified by SSR primers including (ⅰ) NAU1157, (ⅱ) NAU1355, (ⅲ) NAU1052, (ⅳ)J ESPR156, (ⅴ) BNL1679, and (ⅵ) NAU3093. The novel bands produced in F1 and S1 are indicated by red and blue arrows (1, G. herbaceum; 2, G. nelsonii; 3, the F1; 4, the S1). (b) G. herbaceum at 200 channels. (c) TM-1 at 400 channels, respectively. (d) F1 and S1 at 200 channels and 400 channels respectively. (e) 26 of G. herbaceum. (f) 26 of G. nelsonii. (g) 26 of the F1. (h) 52 of the S1. The root tip cells (red arrows) and the chromosomes (black arrows) stained with Carbol fuchsin solution under 40× microscope.

Fig 3

Pictures of cotton bolls and fibers.

(a) G. herbaceum had conical, smooth green and red bolls. (b) G. nelsonii had oval, green cotton bolls. (c) Green pear-shaped boll of S1. (d) G. herbaceum had 3-chambered bolls with gray-white spiral cotton fibers. (e) G. nelsonii had 3-chambered bolls with dark brown upright fibers. (f) The S1 had 3-chambered bolls with brown fibers.

Validation of F1 and S1 by detecting DNA polymorphism, ploidy analysis, and the number of chromosomes.

(a) Microsatellite loci identified by SSR primers including (ⅰ) NAU1157, (ⅱ) NAU1355, (ⅲ) NAU1052, (ⅳ)J ESPR156, (ⅴ) BNL1679, and (ⅵ) NAU3093. The novel bands produced in F1 and S1 are indicated by red and blue arrows (1, G. herbaceum; 2, G. nelsonii; 3, the F1; 4, the S1). (b) G. herbaceum at 200 channels. (c) TM-1 at 400 channels, respectively. (d) F1 and S1 at 200 channels and 400 channels respectively. (e) 26 of G. herbaceum. (f) 26 of G. nelsonii. (g) 26 of the F1. (h) 52 of the S1. The root tip cells (red arrows) and the chromosomes (black arrows) stained with Carbol fuchsin solution under 40× microscope.

Tetraploid S1 generation and trait observations

After the growth of apical meristems of F1 hybrid underwent chromosome doubling, the first large red flower grew in the apex of the plant after 27 days (S1A Fig). The flower was full of pollen and a boll containing four seeds was formed through self-pollination (S1B and S1C Fig). In 2018, the four seeds were sown in a pot and all germinated after 5 days. After the first true leaves were level, the seedlings were transplanted to the field. Floral buds appeared after 45–50 days and flowering occurred after 70–75 days. Boll opening occurred after 107–115 days. In Sanya, the four S1 plants grew normally, with medium plant height and flowering that occurred throughout the year. The pollen formed was viable and many bolls were formed. The samples that were preserved were fertile. Chromosome doubling of the F1 hybrids restored their fertility. We hypothesized that the four S1 plants were all tetraploid hybrids and were assigned the code S1 (2n = 4x = 52, A1A1G3G3). The differences in the morphological characteristics between the four S1 plants were not large. Most plants developed large red flowers, with radiating purple patches, and significant separation was not observed. The leaves were large and tough, and the plants were tall and shrub-like (Fig 1D). The plants produced many flowers, released pollen, and produced fruit normally. The fruits formed were small bolls containing small seeds, and short, brown, high-strength fibers (Fig 3F). In particular, the S1 plants retained some characteristics of G. nelsonii Fryx. For example, at low temperatures, the buds on the lower branches were extremely small (0.50 cm length), milky white in color, did not open until wilting, and had closed pollination. In contrast, flowers in the middle and top branches were large (4.40 cm length), opened normally, and had open pollination. The red flowers contained large purple patches, the bracts were opened, and the plants contained a lot of glands, but not the seed embryo.

Pictures of cotton bolls and fibers.

(a) G. herbaceum had conical, smooth green and red bolls. (b) G. nelsonii had oval, green cotton bolls. (c) Green pear-shaped boll of S1. (d) G. herbaceum had 3-chambered bolls with gray-white spiral cotton fibers. (e) G. nelsonii had 3-chambered bolls with dark brown upright fibers. (f) The S1 had 3-chambered bolls with brown fibers. The most important differences in morphological characteristics between S1 and F1 plants, concerned to the size of leaves and viability of pollen. In general, S1 plants are shorter than F1 ones with larger and thicker leaves (Tables 1 and 3). Because of their viable pollen, formed bolls and seeds, a mean number of 50 bolls per plant (S2A Fig) were produced during 4 months of growth in the field. The samples were still fertile after preservation. Fertility was restored after the diploid F1 hybrids underwent chromosome doubling. However, other S1 traits were not different from the F1 plants, including leaf shape and color, number of lobes, bract shape, calyx teeth shape, number of bract teeth, anther and pollen color, stem and leaf trichomes, bract extension, and extrafloral nectary (Fig 1G and 1H).
Table 3

Comparison between S1 and S2 (G. herbaceum × G. nelsonii) generations based on morphological and fertility traits.

GenerationPlant height (cm)Colors of leafLeaf size (length×width, cm)No. of lobesNo. of nectaries on the back of leaf bladeCorolla colorCorolla length (cm)Color and size of spotAnther and Filaments colorsBract size (length×width, cm)Bract shape, No. of teeth (n)Flower nectaryBoll shape, No. of boll loculiBoll size (length×width, cm)Sterility
S1150.00Dark green5.10×5.400–31 on primary veinPink,Around 2.60RedYellow, Light pink1.20×0.60Sword-shaped, 1–3ExtrafloralPear-shaped, 4Generally, 3.00×2.50Many bolls formed
S275.00–170.00Light green, Dark green5.70×6.20–10.90×13.600–32, 3 at the primary vein and lateral veinPink, Light pink, Milky white, Red flower with white border2.40–4.40Red, Purple, Rose, NoneYellow, Light pink, Pink interspersed with milky white1.30×0.70–1.60×1.10Triangle, Dentate, Ensiform, 2–4None, extrafloral, intra-floralPear-shaped, sunken navel, oval, irregular round boll, 3–42.70×2.30–3.20×2.60Only 32 out of 145 plants had 1–7 bolls while no bolls were found in other plants
We determined that the S1 plants were similar to the F1 plants as their morphological traits showed classical hybrid characteristics (Fig 1). According to the 25-item investigation data analysis (Table 3), 10 items(Fig 1E–1H) were intermediate between the parents including leaf shape and color, number of lobes, bract shape, calyx teeth shape, number of bract teeth, corolla size, number of anthers, boll diameter (Fig 3A–3C), fiber color, and fiber length. Two items were greater than the parents, including the number of boll loculi and fiber tensile strength (Fig 3D–3F). Two items were similar to the female parent, including anther and pollen color (Fig 1E and 1H), and six items were similar to the male parent including stem and leaf trichomes (Fig 1B and 1D), flowering habit, bract extension, bract size (Fig 1F and 1H), flower opening, and extrafloral nectary. In addition, maternal traits expressed as dominant for the anthers, stamens, and stigmata's characteristics (Fig 1E and 1H), whereas paternal traits were expressed in the stem and leaf trichomes, boll shape, and trichomes (Fig 3E and 3F). SSR molecular marker determination showed that the six pairs of parental polymorphic primers(Fig 2A) amplified the complementary bands of the parents, as well as the characteristic bands of the hybrid itself (Figs 2A/ⅲ and 3A/ⅵ). This indicated that S1 is also a true hybrid. At the same time, this shows that the external genes were not introduced during the chromosome doubling of the F1 to obtain the S1. Flow cytometry showed that the peak value of the control sample of G. herbaceum was close to 200 channels (Fig 2B), the peak value of the TM-1 was close to 400 channels (Fig 2C), and the peak value of the S1 hybrid was close to 400 channels (Fig 2D), showing that the S1 hybrid was a tetraploid. Root tip staining and microscopy observations showed that the root tip chromosome number of the G. herbaceum and G. nelsonii control samples was 26 pairs (Fig 2E and 2F), whereas the root tip chromosome number of the S1 hybrid was 52 pairs (Fig 2H). These measurements confirmed that S1 hybrid was tetraploid.

Examination of tetraploid S2 segregation

The S2 plants were completely different from the S1 plants, and showed abnormal and intense segregation. Due to the complex genetic basis of interspecific hybrids, the segregation of F2 populations was diverse, from male parent to female parent types, including a series of intermediate types, as well as new types of plants that are not available in parents. In the F2 generation population, 10 representative plants were selected as observation objects, and morphological indexes were compared in the S2 descendants of S1 with their parental plants (Table 4). For example, the shortest plant (75.00 cm) was shorter than the female parent G. herbaceum L., whereas most shrubs were tall and thick with the tallest plant being 170.00 cm. Corolla color began to segregate as plants came to have not only red corollas, but also pink, red with white borders, and milky white flowers (Fig 4A–4H). However, yellow flowers were not observed on the female parent (Fig 1E). The leaves were generally large, with the longest leaf being 9.90 cm and the widest leaves being 11.00 cm. Nectaries at the back of the leaves were also unique, as they were different from normal leaves that had one nectary at the base of the primary vein, but both primary and lateral veins contained nectaries. Some leaves had two, whereas other leaves had three nectaries (Table 3), which are traits rarely observed in the Gossypium genus.
Table 4

Comparison of quantifiable parameters in the S2 descendants of S1 with their parental plants.

PlantsPlant height (cm)Internode of stem (cm)Vegetative branchesFruiting branchesLeaf size (length×width, cm)Bract size (length×width, cm)Boll size (length×width, cm)Corolla length (cm)Stigma length (cm)Length of fiber (mm)
S2-1156.685.185138.26×9.761.58×1.103.11×2.564.351.1412.86
S2-2170.005.217159.23×10.811.60×1.103.26×2.654.461.1511.12
S2-3146.235.065149.51×10.721.50×0.982.89×2.674.141.2210.46
S2-4138.174.896158.62×9.921.30×0.893.05×2.383.951.2112.98
S2-5129.285.075129.81×10.611.25×0.762.97×2.564.281.3610.56
S2-689.864.86496.33×7.501.38×0.722.84×2.802.511.289.78
S2-770.003.16475.71×6.201.3×0.722.78×2.362.460.958.23
S2-898.563.38488.21×9.801.35×0.722.75×2.582.670.897.46
S2-9158.464.785428.63×10.201.35×0.683.08×2.594.391.1610.95
S2-10169.764.865159.90×11.001.59×1.023.19×2.984.341.3510.96
G. nelsonii Fryx.80.003.45475.21×6.181.10×1.323.56×2.872.180.8517.70
G. herbaceum L.200.004.9671512.86×13.981.2×0.252.31×2.063.531.485.60
Fig 4

Flowers of the tetraploid S2.

(a) Pink, cylindrical flower with pink corolla, (b) funnel-shaped flower with light pink corolla, (c) funnel-shaped flower with white and pink alternating corolla, (d) white, closed flower, (e) bell-shaped flower with red corolla and a clear rose-colored spot on the petal base, (f) semi-closed flower with pink corolla, (g) bell-shaped flower with pale pink corolla. (h) small flower with white corolla and no spot on the petal base.

Flowers of the tetraploid S2.

(a) Pink, cylindrical flower with pink corolla, (b) funnel-shaped flower with light pink corolla, (c) funnel-shaped flower with white and pink alternating corolla, (d) white, closed flower, (e) bell-shaped flower with red corolla and a clear rose-colored spot on the petal base, (f) semi-closed flower with pink corolla, (g) bell-shaped flower with pale pink corolla. (h) small flower with white corolla and no spot on the petal base. Observations also showed that the S2 morphology was associated with fertility. Plants that resembled a pagoda like the female parent produced more bolls and seeds, with 5–10 seeds per boll. In contrast, plants that resembled the male parent were inclined to have a higher ratio of sterility and few fertile plants that produced fewer bolls, with each boll containing only a few seeds (1–5). Fertility was also found to be highly segregated, with some weaker plants growing slowly and flowering later with fewer flowers. They were still normally able to disperse pollen and fruit, even though the fruits were small and not upright. Other plants grew more readily, flowering earlier with more flowers and fruits, and the fruits were large and upright. Most fibers produced were brown, but some bolls contained fibers that were both brown and light green (S2B and S2D Fig). The above results indicate that the S2 generation underwent intense segregation in both morphological characteristics and fertility. This phenomenon exists in varying degrees in other interspecific hybrids [28] and is common in segregated generations [7]. However, it was particularly prominent in the S2 generation of this hybrid. Table 3 compares the observation data of the S2 and S1 plants. It should be mentioned that the S2 was used as an experimental material because it was a population with genetic segregation and with a rich genetic diversity. It is also an ideal population for the screening of disease-resistant varieties using conventional hybridization and breeding methods.

Determination of disease resistance in the tetraploid S2

For each plant, there were 108 nutrient pots, and each pot contained five seedlings. After the development of the first true leaf, cotton plants were inoculated with a fixed concentration of Verticillium dahliae Kleb. suspension (Fig 5A). After 20 days the percentage of infected plants in the control group was 80%. Results (Table 5) showed that when the inoculation was carried out indoors, the seedlings developed disease at the cotyledon stage. There were 456 plants from the susceptible strain cv. Jimian11 that developed disease, with an incidence of 84.44% and disease index of 44.00 (Fig 5B). The resistant grades in S2 descendants of S1 were considered to be immune or highly resistant (Fig 5C). The incidence and disease indexes of G. nelsonii were zero, and the resistance was classified as immune (Fig 5D). The disease index of G. herbaceum was 1.68 (Fig 5E). No disease occurred in any of the plants inoculated with sterile water. From this, it was preliminarily determined that the tetraploid S2 was germplasm material with potential disease resistance. In future studies, we will examine and validate the disease resistance in the S2 in specific plots in the field, to provide reliable intermediate materials for the cultivation of disease-resistant G. hirsutum L.
Fig 5

Identification of resistance to Verticillium dahliae Kleb.

(a) The pathogen of the conidia is indicated with the black arrow. (b) Disease-susceptible upland cotton Jimian11, with yellowing, necrosis, and leaf abscission indicated by red arrows. (c) The resistant S1. (d) Resistant G. nelsonii. (e) Resistant G. herbaceum.

Table 5

Identification of cotton Verticillium wilt resistance in the S2 descendants of S1 with their parental plants.

CultivarDisease indexRelative resistance indexClassification
Jimian1144.00±3.6222.00±1.81S
S2-10.000.00I
S2-20.000.00I
S2-30.28±0.680.14±0.34HR
S2-40.000.00I
S2-50.000.00I
S2-60.56±0.120.28±0.06HR
S2-70.000.00I
S2-80.000.00I
S2-90.16±2.860.8±1.43HR
S2-100.000.00I
G. nelsonii Fryx.0.000.00I
G. herbaceum L.1.68±1.640.84±0.82HR

Identification of resistance to Verticillium dahliae Kleb.

(a) The pathogen of the conidia is indicated with the black arrow. (b) Disease-susceptible upland cotton Jimian11, with yellowing, necrosis, and leaf abscission indicated by red arrows. (c) The resistant S1. (d) Resistant G. nelsonii. (e) Resistant G. herbaceum.

Description of the S1 synthetic tetraploid hybrid based on morphological and fertility traits

From an analysis of the effective boll number and boll-forming rate (Table 6), we determined that the tetraploid S1 showed some compatibility for hybridization with the TM-1. In 2018, the S1 was hybridized with the TM-1 plants and 16 effective bolls were obtained, but they were small and deformed (S3A–S3D Fig). These grew into seven three-way F1 plants, of which only two grew normally and were fertile (Fig 6A–6D). The remaining five plants did not grow normally; some of them grew until flowering stage and others stopped their growth having low fertility or sterility. This is an inevitable consequence of three-way species crossing between G. hirsutum L. × (G. herbaceum L. × G. nelsonii Fryx. S1). Hence, the five three-way F1 hybrids cannot be used for breeding.
Table 6

Hybridization characteristics of TM-1× (G. herbaceum × G. nelsonii S1).

No. of flowers pollinatedEffective boll numberBoll-forming rate (%)No. of normal embryosNo. of three-way F1 plantsNo. of three-way F1 low-fertility plants
278165.75972
Fig 6

The plants, leaves, flowers, corollas, basal patches, filaments, anthers, pollen, calyxes, bracts, and bolls about TM-1, S1 and their offprings.

TM-1(a, e), S1(b, f), F1-1(c, g), F1-2(d, h). (i) normal conical boll of cotton TM-1, (j) green pear-shaped boll of S1, (k) downy green boll of F1-1 that was deformed, indicated by the red arrow, and (l) normal conical boll of F1-2.

The plants, leaves, flowers, corollas, basal patches, filaments, anthers, pollen, calyxes, bracts, and bolls about TM-1, S1 and their offprings.

TM-1(a, e), S1(b, f), F1-1(c, g), F1-2(d, h). (i) normal conical boll of cotton TM-1, (j) green pear-shaped boll of S1, (k) downy green boll of F1-1 that was deformed, indicated by the red arrow, and (l) normal conical boll of F1-2. The plants described above, that grew normally and were fertile, were transplanted to fields and named F1-1 and F1-2 (Fig 6C and 6D). Field morphological observations found that the F1-1 plant retained significant wild cotton characteristics, which were mostly paternal traits(Fig 6F and 6G). The morphology of the F1-2 was an intermediate type, having the most important traits from G. hirsutum L. (Fig 6E and 6H). The significant differences between the two plants were the corolla color, presence of spots, bract characteristics, trichomes, and boll fertility. The F1-1 plant had a pink-colored corolla and red spots, bracts that were separate and not jointed (Fig 6G), and the stems, branches, leaves, and bolls had a large number of trichomes. The boll number was low, and the bolls were deformed (Fig 6K). Furthermore, the embryos tested from the seeds were very small and infertile. The F1-2 plant had a milky white corolla; no spots were present, and the bracts were jointed (Fig 6H). The surfaces of the stems, branches, leaves, and bolls were smooth and there were no trichomes. The bolls developed into a funnel shape and the seed embryos were large and fertile (Fig 6L). The S1 had some potential for breeding applications, but there was severe segregation in its progeny and its fertility was decreased. Notably, a limitation of our study is that we have only preliminarily assessed the authenticity of the F1 generation obtained from the crosses between the TM-1 and S1 through morphological characterization. Further studies using cytology and molecular genetics techniques are required for understanding the nature and usefulness of this new germplasm.

Discussion

Wild cotton varieties have undergone long-term natural selection to accumulate rich genetic diversity conferring adaptability to adverse conditions and resistance to environmental onslaughts and diseases. They provide a great treasury of traits that could be utilized to improve commercial cultivars [5]. Despite continuous improvements in yield and fiber quality of commercial cotton cultivars, disease resistance has weakened. Resistance breeding programs are now being conducted to transfer the disease resistance genes from wild cotton to cultivated cotton, and to re-diversify the genetic makeup of cultivated cotton. The superior quality of cotton fiber and the disease resistance of wild cotton have been successfully transferred to cultivated cotton [29, 30]; However, diploid wild cotton and tetraploid cultivated cotton are biologically isolated. They are often genetically incompatible, forming a barrier to the full utilization of wild diploid cotton varieties [31-33]. We have already obtained an interspecific hybrid F1 of G. herbaceum and G. raimondii. The F1 plants are sterile in the field, leading to various methods being attempted to double their chromosome but without success [21]. In the present study, we successfully obtained an infertile interspecific F1 hybrid and managed to overcome the genetic incompatibility barriers between two distantly related species. Furthermore, we doubled the chromosomal content of this F1 hybrid through colchicine immersion, overcoming the considerable challenges of interspecific hybrid sterility, to successfully synthesize a new S1 tetraploid cotton species. Our results support the hypothesis that distant hybridization is an important driver of new mutations and species in plant evolution [34, 35]. Since the discovery that microsatellite markers are uniformly distributed on cotton chromosomes, SSR markers have been used to monitor the infiltration of heterologous chromosome fragments in the offspring of interspecific hybrids [36, 37]. In the present study, SSR detection revealed the presence of new specific bands in the hybrids that were not detected in the parents, indicating that new combinations or mutations of chromosomes are present in the interspecific progeny (Genomic A and genomic C). This result might be due to chromosomal rearrangements in this newly formed hybrid [38] which was consistent with those reported in previous studies on trispecific hybrids [20]. There is potential for genes from the new synthetic allotetraploids to fuse with favorable genes from G. herbaceum and G. nelsonii, including genes that encode good fiber quality, or resistance to diseases. The number of bolls per S1 plant reached 50 (S2A Fig), an important characteristic for high yield breeding applications. We found that a variety of colored fibers developed in S2 cotton bolls, including brown fibers in a 4-chambered boll and light green and brown cotton fibers in a 3-chambered boll (S2B and S2D Fig). The preliminary examination showed that the disease resistance of the tetraploid S2 was better than G. herbaceum and the same level as G. nelsonii. Increased disease resistance also occurs in interspecific hybrids between G. hirsutum × G. arboretum [19]. This important agronomic characteristic provided a new and important resource for cotton disease resistance breeding programs. At the same time, there is a need to control segregation in hybrids and establish new genetic isolates. We found that the S1 progeny in the field showed a phenomenon of gradual decline in growth. The morphological traits of the S1 plants were generally consistent, with normal growth, flowering, and fruiting. However, the S2 plants showed dramatic segregation and resulted in different types of plant and corolla shapes, and huge differences in the flowering and fruiting characteristics. The growth of many plants in the S3 to S5 generations was suppressed and only a few plants could flower. In severe cases, the plants could not flower and only a small number of plants could bear fruit. This shows that S1 was genetically unstable germplasm and there is still a risk of natural segregation. The decline in growth potential for hybrid offspring is a common phenomenon in cotton distant hybridization [7, 15]. To determine the breeding potential of the S1 population, the hybridization of S1 with the TM-1 upland cotton germline yielded two different types of hybrid F1, namely F1-1 with red flowers and F1-2 with white flowers, indicating that the different genotypes of parents lead to the diversity and complexity of their hybrid offspring in the process of genetic recombination. The F1-1 plants died at the onset of anthesis, indicating that this plant type could not be utilized in crossbreeding. The sterility of F1-1 hybrid plants was consistent with the results of interspecific hybrids of G. hirsutum L. and G. tomentosum Nutt. [39], which may be caused by the incoordination of physiological processes in the hybrid offspring. The F1-2 plants grew normally until flowering and fruiting, but their seeds could not germinate normally. This phenomenon of unsuccessful germination of F1-2 seeds and root tip wilting had previously been observed during the early generations of the amphiploid G. arboretum L. hybridized with G. bickii Prokh. [12]. Additional research is required to overcome the key difficulties in promoting seed germination in each generation. The variation in hybrid phenotypes may be related to gene overlap, new genetic variation, chromosome rearrangement, or a variety of other factors [40, 41]. The tetraploid S1 is a new germplasm obtained by chromosome doubling of the diploid F1 hybrid and is a polyploidy event in cotton. This restored fertility to sterile diploid F1 hybrids, and the tetraploid S1 generation obtained showed segregation, which increases the phenotypic mutations in the species, enabling breeders to select for required traits. After the polyploid was generated, not only did its stress resistance not decrease, but biotic stress resistance was maintained. In addition, the fiber quality of the tetraploid S2 exceeded that of both parents. The S2 generation had high potential for breeding owing to its boll-forming properties, diversity of fiber colors, and fiber quality. These traits are also of great value for breeding programs. From this we can see that diploid F1 hybrid polyploidy has important significance for cotton evolution; as the genome structure changed, the species genetic diversity was enriched, and species adaptability and fiber quality was improved. Thus far, we have only performed preliminary characterizations of the newly synthesized allotetraploid cotton S1. It was suggested a more detailed in-depth and comprehensive research to extract the valuable information from this new cotton tetraploid S1, so as to provide a more accurate theoretical basis for cotton breeding and genetic evolution.

Growth and formation of the tetraploid S1.

(a) Tetraploid plants with a large pink flower accompanied by yellow pollen. (b) The growth process of the oval boll. (c) Four seeds with brown fibers. (TIF) Click here for additional data file.

Fruits and Fibers of the S1.

(a) Multiple bolls of S1 on multiple fruit branches with the sunken navel of the boll tip showing an ergonomic shape with strong bolls. (b) Four-chambered boll with brown fibers. (c) The brown fibers with fiber length of 13 mm. (d) Three-chambered boll with light green and brown cotton fibers. (TIF) Click here for additional data file.

Cotton bolls of the TM-1 and F1 hybrid (TM-1 × S1).

(a)The normal conical boll of TM-1 shown by the red arrow. The abnormally conical boll of F1 on the right (b) and on the left (c). (d) The deformed hybrid boll of F1 indicated by yellow arrows. (TIF) Click here for additional data file. 1 Apr 2020 PONE-D-20-02970 Morphological and genetic description of a novel synthetic allotetraploid of Gossypium herbaceum L. and Gossypium nelsonii Fryx. PLOS ONE Dear Mrs. Yin, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by May 16 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Paulo Eduardo Teodoro, Dr. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. In your Methods section, please provide additional details regarding the cotton varieties used in your study and ensure you have described the source. For more information regarding PLOS' policy on materials sharing and reporting, see https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-materials. 3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. Additional Editor Comments (if provided): Dear authors, your manuscript was reviewed by three experts and all of them pointed out important changes to be made in the manuscript. I ask that you respond to all comments made in a letter-by-point response letter and mark corrections in red in the text. The English in this manuscript is also not acceptable. Please look for a specialized company (I suggest Editage or AJE) for English review and send the review certificate as supplementary material. If the manuscript is not in proper English, it will not be returned to the reviewers for the next round of evaluation and this will delay your evaluation process. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript “Morphological and genetic description of a novel synthetic allotetraploid of Gossypium herbaceum L. and Gossypium nelsonii Fryx” created a new germplasm of cotton through remote hybridisation for a resistant source of wild cotton. G. herbaceum L. crossed with G. nelsonii Fryx. to produce an interspecies F1 hybrid cotton. Colchicine was used to double its chromosomal content, leading to the successful generation of a synthetic S1 tetraploid. The newly created S1 tetraploid showed morphological variations in its flowers, cotton bolls, and fibres and was partially resistant to Verticillium dahliae Kleb . The S1 tetraploid was hybridised with upland cotton to produce two types of cotton with different characteristics. This newly synthesised tetraploid cotton species is a valuable resource for cotton resistance breeding and for the enrichment of cotton genetic resources. The results are informative, but there are some major concerns need to be addressed. 1. The description of phenotypic morphological analysis of the diploid F1 hybrid and the synthetic S1 tetraploid is poorly organized. The author's investigation of morphological in materials and methods has not been described in detail. Even with reference to the methods of previous reference, no specific survey data and criteria are given. In the survey results, the key traits such as the germinating stage and the flowering stage are unclear. Moreover, wild cotton is mostly perennial wild material, and its germinating stage and flowering stage belongs to agronomic traits. It is not suitable for investigation and comparative analysis of wild materials. 2. Statistical analysis of leaf shape, plant height, boll shape and other traits is not appropriate. Because the leaf shape will change according to the different growth stages of the plant, the plant height will vary greatly due to changes in the growth environment, and the boll shape will also vary in different positions of the plant. The number of bolls per plant is also strongly related to nutritional status and planting density, so the author's description of these traits seems meaningless. 3. When statistically analysis the differences in phenotypic traits, it is necessary to distinguish between qualitative and quantitative traits. For F1, in the case of a limited single plant, it cannot be compared with a tetraploid with a larger number of offspring. As for the results of the investigation against Verticillium wilt, as it is a quantitative trait, it is recommended to compare and analyze the resistance differences of different isolated plants of S1. 4. For the identification and analysis of F1 true or false hybrids, when doing cytological analysis, the chromosomes of both parents and the chromosome of F1 should be observed. 5. When conducting a flow cytometer test, both parents, F1, S1, and the TM-1 materials, should be tested and investigated to increase the scientificity and credibility of the test. 6. At present, according to the taxonomic standards of the cotton genus, it has been recognized that Gossypium nelsonii Fryxell has been classified as the G3 species. So the newly synthesized double cotton germplasm should be A1A1G3G3. 7. According to the cotton genus classification and distribution research, 53-54 cotton species have been discovered and named, instead of 55. Reviewer #2: The manuscript has potential for publication, i the authors have achieved good results, the discussion needs to be improved, with mention to other works, in the discussion it is necessary to mention other results found in the difference of ploidy, the use of colchicine, as well as resistance to Verticillium dahliae, which is one of the main objectives, however, the work has all merit for publication. Reviewer #3: WHAT THE AUTHORS NEED TO DO FOR IMPROVE THEIR PAPER • I THEORIZED THAT YOU MUST FOLLOW A LANGUGE EDITING FIRSTLY AND AFTERWARDS WE COULD CAPABLE TO FOLLOW DETAILED CORRECTIONS AND SUGGESTIONS. • I AM SORRY BUT THERE MAINY TERMS AND SENTENCES THAT MUST BE REWRITE USING BETTER TERMINOLOGY. ALL THE SENTENCES, TERMS AND WORDS UNDERLINED INTO THE TEXT BY YELLOW COLOUR SHOULD BE CHANGED. • PLEASE FOLLOW A LANGUAGE EDITIND FROM A PERSON WHO HAS ENGLISH AS NATIVE LANGUAGE BECAUSE YOU LOOSE MUCH OF THE VALUE OF YOUR WORK . PLEASE SEE CAREFULLY OUR ADVICES INTO THE FILE COMMENTS & SUGGESTIONS (1) ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE-D-20-02970_reviewer (1) -1.pdf Click here for additional data file. Submitted filename: REVIEWER 1 - SUGGESTIONS.docx Click here for additional data file. 29 May 2020 1. The description of phenotypic morphological analysis of the diploid F1 hybrid and the synthetic S1 tetraploid is poorly organized. The author's investigation of morphological in materials and methods has not been described in detail. Even with reference to the methods of previous reference, no specific survey data and criteria are given. In the survey results, the key traits such as the germinating stage and the flowering stage are unclear. Moreover, wild cotton is mostly perennial wild material, and its germinating stage and flowering stage belongs to agronomic traits. It is not suitable for investigation and comparative analysis of wild materials. __Answer:We have added the key traits such as germination and flowering of new germplasm cotton.The F1 hybrid were sown in a pot and all germinated after 5 days. After the first true leaves were level, the seedlings were transplanted to the field. Floral buds appeared after 43-45 days and flowering occurred after 68-70 days. The S1 were sown in a pot and all germinated after 5 days. After the first true leaves were level, the seedlings were transplanted to the field. Floral buds appeared after 45-50 days and flowering occurred after 70-75 days. Boll opening occurred after 107-115 days. The new cotton germplasm was created by using wild cotton through distant hybridization and is the descendant of wild cotton.When investigating and analyzing it, it involves genetic problems.To explain the genetic problems of new germplasm, the source needs to be traced back. Therefore, it is necessary to list wild cotton parents as a reference in the study in order to analyze and explain.The reviewer mentioned that wild cotton is mostly perennial wild material, this statement is correct. In fact, all cotton is a perennial plant in tropical regions, including wild cotton and cultivated cotton (such as G. hirsutum L. G. barbadense L.G. herbaceum L.G. arboreum L. ). The morphological traits of various cotton species grown in the same environment difference. 2. Statistical analysis of leaf shape, plant height, boll shape and other traits is not appropriate. Because the leaf shape will change according to the different growth stages of the plant, the plant height will vary greatly due to changes in the growth environment, and the boll shape will also vary in different positions of the plant. The number of bolls per plant is also strongly related to nutritional status and planting density, so the author's description of these traits seems meaningless. __Answer:Plant morphology is a characteristic expression of a species, mainly including plant morphology traits such as plant type, stem, leaf, flower and cotton boll.Regarding the color of the floral organs of the plant, the presence or absence of the floral basal spot, the characteristics of the bracts, the amount of plant hairs, and the boll fertility is a trait that can be stably inherited and does not change with the external environment.In a limited time, these descriptions of the new germplasm we created, please dear editors and review experts to understand.We describe morphology and only want to show the new cotton germplasm as much as possible. If we talk about its significance, the birth event of new cotton germplasm is meaningful in itself. 3. When statistically analysis the differences in phenotypic traits, it is necessary to distinguish between qualitative and quantitative traits. For F1, in the case of a limited single plant, it cannot be compared with a tetraploid with a larger number of offspring. As for the results of the investigation against Verticillium wilt, as it is a quantitative trait, it is recommended to compare and analyze the resistance differences of different isolated plants of S1. __Answer:Due to the low number of diploid F1 hybrids and tetraploid S1 plants, these two materials cannot be used for cotton Verticillium wilt resistance experiments.In fact, in this study, we used the descendant material S2 of S1 to carry out disease resistance identification of seedlings in indoor nutrition bowls(Fig.5), because S2 material is not only a large number, but also an ideal separation group with rich morphological diversity .In the next step, we will plant S2 in a specific field nursery, and analyze and compare the differences in disease resistance of different S2 isolated plants. 4. For the identification and analysis of F1 true or false hybrids, when doing cytological analysis, the chromosomes of both parents and the chromosome of F1 should be observed. __Answer:We have shown the cytological observations of both parents, F1 and S1 in the article. 5. When conducting a flow cytometer test, both parents, F1, S1, and the TM-1 materials, should be tested and investigated to increase the scientificity and credibility of the test. __Answer:We have shown the results of flow cytometer test of female parent, F1, S1 and TM-1 in this article. 6. At present, according to the taxonomic standards of the cotton genus, it has been recognized that Gossypium nelsonii Fryxell has been classified as the G3 species. So the newly synthesized double cotton germplasm should be A1A1G3G3. __Answer:We have changed to A1A1G3G3 in the article. 7. According to the cotton genus classification and distribution research, 53-54 cotton species have been discovered and named, instead of 55. __Answer:We have changed to 54 kinds in the article. Reviewer #2: The manuscript has potential for publication, i the authors have achieved good results, the discussion needs to be improved, with mention to other works, in the discussion it is necessary to mention other results found in the difference of ploidy, the use of colchicine, as well as resistance to Verticillium dahliae, which is one of the main objectives, however, the work has all merit for publication. __Answer:We have added relevant content to the discussion of the article. The tetraploid S1 is a new germplasm obtained by chromosome doubling of the diploid F1 hybrid and is a polyploidy event in cotton. This not only restores fertility to sterile diploid F1 hybrids and the tetraploid S1 generation obtained showed segregation, which increases the phenotypic mutations in the species, enabling breeders to select for required traits. After the polyploid was generated, its stress resistance not only did not decrease but biotic stress resistance was maintained. For example, the preliminary examination showed that the disease resistance of the tetraploid S2 was 1 grade better than the female parent (G. herbaceum) and the same level as the male parent (G. nelsonii), and its disease resistance inheritance was closer to the male parent. In addition, the fiber quality of the tetraploid S2 exceeded that of both parents. From this we can see that diploid F1 hybrid polyploidy has important significance for cotton evolution, as the genome structure changed and the species genetic diversity enriched as well as the species adaptability and fiber quality were improved. Reviewer #3: WHAT THE AUTHORS NEED TO DO FOR IMPROVE THEIR PAPER• I THEORIZED THAT YOU MUST FOLLOW A LANGUGE EDITING FIRSTLY AND AFTERWARDS WE COULD CAPABLE TO FOLLOW DETAILED CORRECTIONS AND SUGGESTIONS.• I AM SORRY BUT THERE MAINY TERMS AND SENTENCES THAT MUST BE REWRITE USING BETTER TERMINOLOGY.ALL THE SENTENCES, TERMS AND WORDS UNDERLINED INTO THE TEXT BY YELLOW COLOUR SHOULD BE CHANGED.• PLEASE FOLLOW A LANGUAGE EDITIND FROM A PERSON WHO HAS ENGLISH AS NATIVE LANGUAGE BECAUSE YOU LOOSE MUCH OF THE VALUE OF YOUR WORK . PLEASE SEE CAREFULLY OUR ADVICES INTO THE FILE COMMENTS & SUGGESTIONS (1) __Answer:We have made changes to the questions raised by the review experts. Submitted filename: renamed_26032.doc Click here for additional data file. 26 Jun 2020 PONE-D-20-02970R1 Morphological and genetic description of a novel synthetic allotetraploid of Gossypium herbaceum L. and Gossypium nelsonii Fryx. PLOS ONE Dear Dr. Chen, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== Dear authors, your manuscript has been revised again by the same reviewers of round 1. One of them refused the article, as several suggested changes were not made. I agree with this reviewer. The other reviewer made a detailed review of the text and pointed out several excerpts that must be modified. The English in this manuscript remains poor and very difficult to read. I strongly suggest that the authors do an English review for the next round of evaluation. I suggest EDITAGE or AJE. Please attach the English revision certificate as a supplementary document. Without this review, it will be difficult to proceed with the evaluation of this manuscript. ============================== Please submit your revised manuscript by Aug 10 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Paulo Eduardo Teodoro, Dr. Academic Editor PLOS ONE Additional Editor Comments (if provided): Dear authors, your manuscript has been revised again by the same reviewers of round 1. One of them refused the article, as several suggested changes were not made. I agree with this reviewer. The other reviewer made a detailed review of the text and pointed out several excerpts that must be modified. The English in this manuscript remains poor and very difficult to read. I strongly suggest that the authors do an English review for the next round of evaluation. I suggest EDITAGE or AJE. Please attach the English revision certificate as a supplementary document. Without this review, it will be difficult to proceed with the evaluation of this manuscript. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) Reviewer #2: All comments have been addressed Reviewer #3: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: No Reviewer #2: Yes Reviewer #3: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes Reviewer #3: No ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes Reviewer #3: No ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The author's concept of the distinction between wild cotton and cultivated cotton is vague. The content of the survey on qualitative and quantitative traits is unclear. The author is confused about the genomic properties of Gossypium. No substantial changes were given to all amendment proposals. Reviewer #2: (No Response) Reviewer #3: GENERAL COMMENT Although the authors incorporated the suggestions from the reviewers, I feel that this paper must be improved, by English Editing and a careful extension of discussion with mention to other research works and results found in international references. I propose some differentiation in the subtitles and in titles of the tables (please find STIKCY NOTES in the manuscript). (e.g p.p. 173 A title : Root tip chromosome observations changed as KARYOTYPE ANALYSIS) All new suggestions and corrections are indicated by Highlight Notes in the Manuscript (please change all the proposed words or terms or terminology as proposed in the NOTE BOX). NOTICE : Micronaire value up to 6, is not a desirable trait for fiber quality. Please not confuse the reader. THE RESULTS FROM THIS RESEARCH ARE VERY IMPORTANT. The researchers offer lot of work onto these experiments but is important to clarify the useful data and give the most significant conclusions in a clear way. PLEASE WRITE THE CONCLUSIONS ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE-D-20-02970_R1 (2).pdf Click here for additional data file. 20 Sep 2020 The concerns raised by the reviewers have been addressed in our revised manuscript. We carefully checked the language of the manuscript according to the comments of Reviewer 3 and the sticky notes in the pdf file to ensure a high level of readability in English. Please see below for our point-by-point response. Submitted filename: Response to Reviewers.doc Click here for additional data file. 28 Oct 2020 PONE-D-20-02970R2 Morphological description of a novel synthetic allotetraploid  (A1A1G3G3) of Gossypium herbaceum L. and G. nelsonii Fryx. suitable for disease-resistant breeding applications PLOS ONE Dear Dr. Chen, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Dec 12 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Paulo Eduardo Teodoro, Dr. Academic Editor PLOS ONE Additional Editor Comments (if provided): Dear authors, one of the reviewers also pointed out the need for Minor Revision in his manuscript. Therefore, I ask you to carefully review the manuscript according to this reviewer's suggestions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #3: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #3: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #3: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #3: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #3: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #3: ALL CORRECTIONS AND SUGGESTIONS INCLUDED IN THE ATTACHED FILES (I) (Full Text with Suggestions ) AND (II) (Reviewer Comments) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE-D-20-02970_R3.pdf Click here for additional data file. Submitted filename: REVIEWER (3).pdf Click here for additional data file. 3 Nov 2020 We carefully checked the language of the manuscript according to the comments of Reviewer 3 and the sticky notes in the pdf file to ensure the rationality of the article structure.The concerns raised by the reviewers have been addressed and added the related references in our revised manuscript. In the process of revising the article, thank you for your patient review again and again in line with the realistic attitude, respecting the originality of science. Let us deeply feel the precision of your words in place, and increase our knowledge. These valuable experiences will be remembered for us forever. Submitted filename: Response to Reviewers.doc Click here for additional data file. 6 Nov 2020 Morphological description of a novel synthetic allotetraploid  (A1A1G3G3) of Gossypium herbaceum L. and G. nelsonii Fryx. suitable for disease-resistant breeding applications PONE-D-20-02970R3 Dear Dr. Chen, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Paulo Eduardo Teodoro, Dr. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 18 Nov 2020 PONE-D-20-02970R3 Morphological description of a novel synthetic allotetraploid(A1A1G3G3) of Gossypium herbaceum L.and G.nelsonii Fryx. suitable for disease-resistant breeding applications Dear Dr. Chen: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Professor Paulo Eduardo Teodoro Academic Editor PLOS ONE
  18 in total

1.  Gene loss, silencing and activation in a newly synthesized wheat allotetraploid.

Authors:  Khalil Kashkush; Moshe Feldman; Avraham A Levy
Journal:  Genetics       Date:  2002-04       Impact factor: 4.562

2.  Sequence elimination and cytosine methylation are rapid and reproducible responses of the genome to wide hybridization and allopolyploidy in wheat.

Authors:  H Shaked; K Kashkush; H Ozkan; M Feldman; A A Levy
Journal:  Plant Cell       Date:  2001-08       Impact factor: 11.277

3.  Characteristics of fertile somatic hybrids of G. hirsutum L. and G. trilobum generated via protoplast fusion.

Authors:  X S Yu; B J Chu; R E Liu; J Sun; Joseph Jones Brian; H Z Wang; Zhu Shuijin; Y Q Sun
Journal:  Theor Appl Genet       Date:  2012-07-10       Impact factor: 5.699

Review 4.  Evolution: replacing genes and traits through hybridization.

Authors:  Loren H Rieseberg
Journal:  Curr Biol       Date:  2009-02-10       Impact factor: 10.834

5.  Rapid flow cytometric analysis of the cell cycle in intact plant tissues.

Authors:  D W Galbraith; K R Harkins; J M Maddox; N M Ayres; D P Sharma; E Firoozabady
Journal:  Science       Date:  1983-06-03       Impact factor: 47.728

6.  Development and characterization of genomic and expressed SSRs for levant cotton (Gossypium herbaceum L.).

Authors:  Satya Narayan Jena; Anukool Srivastava; Krishan Mohan Rai; Alok Ranjan; Sunil K Singh; Tarannum Nisar; Meenal Srivastava; Sumit K Bag; Shrikant Mantri; Mehar Hasan Asif; Hemant Kumar Yadav; Rakesh Tuli; Samir V Sawant
Journal:  Theor Appl Genet       Date:  2011-10-30       Impact factor: 5.699

7.  Molecular linkage map of allotetraploid cotton ( Gossypium hirsutum L. x Gossypium barbadense L.) with a haploid population.

Authors:  J. Zhang; W. Guo; T. Zhang
Journal:  Theor Appl Genet       Date:  2002-10-30       Impact factor: 5.699

8.  Production and characterization of somatic hybrids between upland cotton (Gossypium hirsutum) and wild cotton (G. klotzschianum Anderss) via electrofusion.

Authors:  Yuqiang Sun; Xianlong Zhang; Yichun Nie; Xiaoping Guo; Shuangxia Jin; Shaoguang Liang
Journal:  Theor Appl Genet       Date:  2004-04-28       Impact factor: 5.699

9.  Analysis of [Gossypium capitis-viridis × (G.hirsutum × G.australe)2] Trispecific Hybrid and Selected Characteristics.

Authors:  Di Chen; Yuxiang Wu; Xiling Zhang; Fuguang Li
Journal:  PLoS One       Date:  2015-06-02       Impact factor: 3.240

10.  A New Sythetic Hybrid (A1D5) between Gossypium herbaceum and G. raimondii and Its Morphological, Cytogenetic, Molecular Characterization.

Authors:  Yuxiang Wu; Di Chen; Shuijin Zhu; Lufei Zhang; Lingjiao Li
Journal:  PLoS One       Date:  2017-02-10       Impact factor: 3.240

View more
  1 in total

Review 1.  Mechanism of cotton resistance to abiotic stress, and recent research advances in the osmoregulation related genes.

Authors:  Shah Saud; Lichen Wang
Journal:  Front Plant Sci       Date:  2022-08-17       Impact factor: 6.627

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.