Literature DB >> 33236144

miR‑18a‑5p promotes melanoma cell proliferation and inhibits apoptosis and autophagy by targeting EPHA7 signaling.

Yunlong Guo1, Wenli Shi1, Ruihua Fang1.   

Abstract

Micro (mi)RNAs serve crucial roles in cancer development although little is known about their cellular mechanisms in the pathogenesis of melanoma. The present study explored the regulatory roles of miR‑18a‑5p in melanoma cell proliferation, apoptosis and autophagy, in addition to its target gene in melanoma cells. miRNA and ephrin receptor A7 (EPHA7) mRNA were analyzed by reverse transcription‑quantitative PCR. Cell Counting Kit‑8 and colony formation assays were performed to examine the cell proliferation rate. Hoechst staining and flow cytometry were performed to investigate cell apoptosis. Western blotting was used to estimate the abundance of proteins. Dual-luciferase reporter assay verified the binding of miRNA with target gene sequences. Melanoma tissues and cell lines exhibited markedly elevated miR‑18a‑5p expression. miR‑18a‑5p inhibitor inhibited proliferation rates, and triggered apoptosis and autophagy marker protein expression in WM266‑4 and A375 cells. It also negatively regulated EPHA7 expression in WM266‑4 and A375 cells by directly binding at the 3'‑untranslated region of EPHA7. miR‑18a‑5p mimics reversed the EPHA7 overexpression‑induced suppression of proliferation, and the EPHA7 overexpression‑induced promotion of apoptosis and autophagy. miR‑18a‑5p triggered proliferation of melanoma cells and inhibited apoptosis and autophagy by directly targeting and inhibiting EPHA7 expression. Thus, the present study aided our understanding of miRNA‑mediated melanoma pathogenesis.

Entities:  

Year:  2020        PMID: 33236144      PMCID: PMC7716404          DOI: 10.3892/mmr.2020.11717

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Melanoma is a group of severe malignant tumors that develop from transformation of melanocytes and grow on human skin, in the mouth, eyes and intestinal tissues (1,2). Melanoma is the fifth and sixth most common of the human cancers affecting male and female patients respectively, according to recent epidemiological investigations. Globally new melanoma cases occur in >0.2 million individuals each year, an incidence that has been continuously on the rise during the past years (3,4). Patients with melanoma at advanced stages who are not suitable for surgery, chemotherapy nor immunotherapy are commonly treated with drugs such as temozolomide and dacarbazine, but the efficiency of this treatment is often impaired by drug resistance (5,6). The development of novel anti-melanoma drugs critically depends on the complete understanding of the molecular pathogenic mechanisms in melanoma. EPHA7 (ephrin receptor A7) is a member of the Eph family of receptor tyrosine kinases, which are expressed in erythropoietin-producing human hepatocellular carcinoma cells (7). They are commonly known to be involved in embryonic development, angiogenesis, development of nervous and vascular systems, and a number of human pathogenic conditions, including numerous types of tumor, inflammatory diseases and neurological diseases (8,9). Alteration of EPHA7 expression has been identified to be closely associated with the development of several types of human cancer over the past decade, such as colon and prostate cancer. For instance, high expression of EPHA7 is associated with adverse results among patients with primary and recurrent glioblastoma multiforme (10). By contrast, expression of the EPHA7 is markedly downregulated in colorectal cancer tissues, presumably caused by hypermethylation in the 5′CpG island of EPHA7 (9). EPHA7 is substantially mutated in patients with melanoma with frequent mutations recorded in tumor samples, as demonstrated by a meta-analysis of somatic mutations on the basis of next-generation sequencing (11). Nevertheless, the expressional state, regulating mechanism and functions of EPHA7 in melanoma remain to be elucidated. MicroRNAs (miRNAs/miRs) are a large group of non-coding RNA molecules, commonly with 22 nucleotides, which target expression levels of genes by directly binding with the 3′-untranslated region (UTR) of functional genes (12). The post-transcriptional gene expression regulation by miRNAs is extensively associated with various biological processes and human disorders including several types of cancer, such as gastric, liver and breast cancer (12–14). Certain miRNAs are also known to modulate the function of EPHA7. For instance, miR-944 targets EPHA7 to influence the progression of lung cancer cells (15). In addition, numerous miRNAs serve crucial roles in regulating the expression of key genes associated with melanoma pathogenesis and drug responses (16,17). miR-18a-5p acts has been demonstrated to be associated with cancer development and progression (18). The high levels of miR-18a-5p expression in non-small cell lung cancer (NSCLC) tissues promote proliferation and migration, and suppress apoptosis of cancerous cells by targeting interferon regulatory factor 2 gene expression (19). The expression of miR-18a-5p was reported to be markedly elevated in melanoma cell lines compared with normal human epidermal melanocytes, suggesting pathogenic roles for miR-18a-5p in the progression of melanoma (20). However, the pathogenic roles of high expression levels of miR-18a-5p in melanoma cells and the underlying molecular mechanisms, require further investigation. The present study performed extensive analysis of miR-18a-5p expression and its cellular functions associated with melanoma development and progression using both clinical tissues and cellular models. EPHA7 was confirmed to be a target gene of miR-18a-5p in melanoma cells. The findings of the present study revealed novel molecular mechanisms through which melanoma pathogenesis is promoted, which may support miRNA-based melanoma diagnosis and treatment.

Materials and methods

Tissue collection and cell culture

Melanoma and normal skin tissues were collected from 20 patients diagnosed with malignant melanoma who underwent surgical treatment at the Department of Dermatology of the Guangzhou First People's Hospital (Guangdong, China) between July 2018 and November 2018; information about the stage and clinical status of the patient are presented in Table I. All patients provided written consent prior to the surgery and the entire study was approved by the Medical Ethics Committee of the Guangzhou First People's Hospital (approval no. K-2019-135-01). The present study was performed in accordance with the Declaration of Helsinki (21). The American Type Culture Collection supplied the normal human epidermal melanocyte PIG1 and melanoma cell lines WM266-4, A375, VMM5A and A2058. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Thermo Fisher Scientific, Inc.) with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and 1% penicillin or streptomycin at 37°C in a humidified chamber with 5% CO2.
Table I.

Histological subtypes of cutaneous melanoma.

Sex (case no.)In situ or invasive (case no.)Localization of the primary lesion (case no.)



Histological SubtypePatients, n (%)Age of onset, median (years)MaleFemaleIn situInvasiveCourse of disease, median (months)Head and NeckTrunkLimbsHandsFeet
LMM3 (15.00)4221123621000
SSM2 (10.00)5211113011000
ALM13 (65.00)5676763600139
NM1 (5.00)901012400100
Metastatic MM1 (5.00)4510002801000
DM000000000000
Total20511199103433239

LMM, lentigo maligna melanoma; SSM, superficial spreading melanoma; ALM, acral lentiginous melanoma; NM, nodular melanoma; MM, maligna melanoma; DM, desmoplastic melanoma.

Reverse transcription-quantitative (RT-q) PCR

To examine the relative expression levels of miRNA and mRNAs, total RNA was extracted from the skin tissues or cultured cells with TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols. A NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc.) was used to record the concentration and quality of RNA. On assessing the RNA quality and concentration using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc.), equal volumes of RNA samples (3.0 µg) were collected from each group for cDNA library synthesis with the Bestar™ qPCR RT kit (cat. no. 2220; DBI Bioscience), according to the manufacturer's protocol, at 37°C for 1 min, 50°C for 60 min and 70°C for 15 min. Then, relative levels of miRNA or mRNA were measured by RT-qPCR using the Bestar™ qPCR MasterMix kit (cat. no. 2043; DBI Bioscience), according to the following procedure: Pre-denaturation at 95°C for 2 min, with 42 cycles of denaturation at 94°C for 20 sec; annealing at 58°C for 20 sec and extension at 72°C for 20 sec. The maximum cycle number considered for gene expression is 42. U6 and GAPDH were used as the internal standard for quantitation of miRNA and EPHA7 expression, respectively. Expression levels were assessed by the standard 2−ΔΔCq method (22). The experiment was repeated three times. The primers used for RT-qPCR are listed in Table II.
Table II.

Sequences of primers used for reverse transcription-quantitative PCR.

Gene IDPrimer sequence (5′→3′)Product length (bp)
GAPDHForward: TGTTCGTCATGGGTGTGAAC154
Reverse: ATGGCATGGACTGTGGTCAT
EPHA7Forward: GTGAAGATGGGTATTACAGGGC187
Reverse: CAACTGCACCGCTTACACAAT
U6Forward: CTCGCTTCGGCAGCACA96
Reverse: AACGCTTCACGAATTTGCGT
hsa-miR-18a-5pForward: ACACTCCAGCTGGGTAAGGTGCATCTAGTGCAG327
Reverse: CTCAACTGGTGTCGTGGA
Reverse transcription: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTATCTGC

H-/hsa, human; miR, microRNA.

Cell transfection

To determine the effect of miR-18a-5p expression in melanoma cells, the miR-18a-5p mimics (5′-UAAGGUGCAUCUAGUGCAGAUAG-3′), miR-18a-5p inhibitors (5′-CCAGAAGGAGCACUUAGGGCAGU-3′) and negative control (NC; 5′-CAGUACUUUUGUGUAGUACAA-3′) were produced and supplied by Shanghai GenePharma Co., Ltd. To determine the overexpression of EPHA7 in melanoma cells, full-length genomic sequences of EPHA7 were amplified using EPHA7-F1 (5′-CGGATCCATGGTTTTTCAAACTCGGTACCCTTC-3′) and EPHA7-R1 (5′-CCCTCGAGTCACACTTGAATGCCAGTTCCATGT-3′), which were then ligated with the pcDNA3.0 plasmid (Vipotion Biotechnology Co., Ltd.). The miRNA mimics, inhibitors and recombinant plasmids were introduced into the cultured melanoma cells using Lipofectamine® 2000 transfection reagent (cat. no. 11668019; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols. The quantity of all mimics or inhibitors used was 100 nM. Alterations of miRNA and EPHA7 expression levels were confirmed by RT-qPCR following 48 h of transfection at 37°C.

Colony formation assay

Melanoma cell proliferation rate was evaluated by performing a colony formation assay. Following cell transfection, WM266 and A375 cells were resuspended in DMEM and seeded in 6-well plates (100 cells/well). These were cultured under normal conditions for another 2 weeks at 37°C. The cells were then fixed using 4% paraformaldehyde for 12 min at 37°C and stained using 0.1% crystal violet for 30 min at room temperature. Cell colonies were defined as >50 cells and counted under a fluorescent microscope (magnification, ×400) in three randomly selected fields of view for cell proliferation comparison. For statistical analysis, the experiments were performed in triplicate.

Cell counting Kit-8 (CCK-8) assay

The CCK-8 (Dojindo Molecular Technologies, Inc.) assay was performed to assess melanoma cell proliferation, according to the manufacturer's protocols. The cell suspensions (4,000 cells/well; 100 µl) were seeded in 96-well plates and maintained at 37°C in a humidified chamber under normal conditions for 24, 48 and 72 h. Thereafter, the cells were incubated using 10 µl CCK-8 solution for 4 h and absorbance measured at 450 nm (OD450) with a microplate reader. Cell proliferation was analyzed on the basis of OD450 values from ≥3 replicates.

Flow cytometry

Flow cytometry was performed to evaluate cell early apoptosis using the FITC Annexin V Apoptosis Detection kit (BioLegend, Inc.), according to the manufacturer's protocol. Melanoma cells cultured in 6-well plates were rinsed three times using cell staining buffer, resuspended in Annexin V Binding Buffer (5×106 cells/ml) and incubated using 5 µl FITC Annexin V and 7-AAD Viability Staining Solution for 15 min at room temperature in the dark. Finally, the cells were mixed with Annexin V Binding Buffer and analyzed with a FACScan flow cytometry system (BD Biosciences) and FlowJo software (version 10; FlowJo LLC). Flow cytometry analysis experiments were repeated ≥3 times.

Hoechst staining

Apoptosis of WM266 and A375 cells was also evaluated using Hoechst 33258 reagents (cat. no. C1011; Beyotime Institute of Biotechnology) according to the manufacturer's protocols. Melanoma cells (1×105 cells/well) grown on cell slides were mixed with the fixation solution at 4°C for 12 min, rinsed three times using PBS, stained with Hoechst 33258 for 5–8 min at 37°C with agitation, rinsed again with PBS for 3 min at room temperature and eventually observed in three randomly selected fields of view at a wavelength of 460 nm using fluorescence microscopy (magnification, ×400); ≥3 replicates of the experiments were performed.

Dual luciferase reporter assay

Dual-Luciferase reporter assay was performed to validate the binding of miRNA 18a-5p with the 3′-UTR region of EPHA7 in WM266 and A375 cells. The wild-type (WT) and mutated (MUT) 3′-UTR regions of EPHA7 were ligated separately with the Psi-CHECK2 plasmids (Promega Corporation), which were then transfected into WM266 and A375 cells (1×105 cells/well) using Lipofectamine 2000 as aforementioned, together with miRNA 18a-5p mimics or NC as designated. The cells were cultured under normal conditions at 37°C for 48 h, followed by rinsing three times with PBS and incubation with passive lysis buffer. A GloMax® Bioluminescence detector (Promega Corporation) was used to measure the luciferase activity of cell lysates. The luciferase activity was normalized to Renilla luciferase activity.

Western blot analysis

Cell lysis buffer (cat. no. P0013; Beyotime Institute of Biotechnology) was used to extract total proteins from cultured cells for western blotting and immunoprecipitation according to the manufacturer's protocols. The concentration of protein was measured by a spectrophotometer at 280 nm using the BCA method. Total protein (~25 µg) collected from each group was boiled at 100°C for 5 min, separated by 10% SDS-PAGE and blotted onto polyvinylidene difluoride membranes. Thereafter, the membranes were blocked with 5% lipid-free liquid milk for 1–2 h at room temperature, and then incubated with primary antibodies overnight at 4°C and secondary antibodies for 2 h each at room temperature, and eventually developed with the Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, Inc.), and analyzed using ImageJ software (v1.8.0; National Institutes of Health). The following antibodies were used: anti-pro caspase-3 (1:800; cat. no. MA1-41163; Invitrogen; Thermo Fisher Scientific, Inc.), anti-pro caspase-9 (1:1,000; cat. no. MA5-32,431; Invitrogen; Thermo Fisher Scientific, Inc.), anti-cleaved caspase-3 (1:500; cat. no. ab2302; Abcam), anti-cleaved caspase-9 (1:500; cat. no. ab219590; Abcam), anti-autophagy marker light chain 3-I/II (LC3I/II; cat. no. 8899; CST Biological Reagents Co., Ltd.), anti-p62 (1:1,000; cat. no. ab109012; Abcam), anti-GAPDH antibodies (1:1,000; cat. no. ab9484; Abcam), goat anti-rabbit IgG (1:800; cat. no. ab205718; Abcam) and goat anti-mouse IgG (1:800; cat. no. ab205719; Abcam).

Statistical analysis

Data from ≥3 replicates of all experiments are presented as the mean ± standard deviation, and were analyzed using SPSS 20.0 (IBM Corp.). Differences between 2 groups were assessed by an unpaired Student's t-test, while differences between ≥2 groups were analyzed using a one-way analysis of variance, with a Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference. Pearson's correlation analysis was used to analyze the correlation between miR-18a-5p and EPHA7 expression levels.

Results

Elevated miR-18a-5p expression in melanoma tissues and cells

The alterations of miR-18a-5p expression in melanoma tissues and established cell lines were identified to investigate the potential involvement of miR-18a-5p in melanoma pathogenesis. miR-18a-5p expression levels in melanoma tissues collected from 20 patients were identified to be significantly higher compared with that in the corresponding adjacent normal skin tissues (Fig. 1A). The miR-18a-5p expression levels in four human melanoma cell lines WM266-4, A375, VMM5A and A2058 were observed to be significantly elevated compared with those in the normal skin cell line PIG1 (Fig. 1B). miR-18a-5p expression levels were increased most significantly in the WM266-4 and A375 cell lines compared with the other two melanoma cell lines, so these cells were used as cellular models for the following assays. Increased miR-18a-5p expression in melanoma tissues and cell lines suggested the potential roles of miR-18a-5p during melanoma pathogenesis.
Figure 1.

miR-18a-5p expression is increased in melanoma tissues and cell lines. (A) miR-18a-5p expression in melanoma tissues and adjacent normal skin tissues collected from 20 patients with melanoma. Relative expression of miR-18a-5p was determined by RT-qPCR. U6 expression was used as the internal standard. (B) Relative miR-18a-5p expression in melanoma cell lines and normal skin cells. miR-18a-5p expression in melanoma cell lines WM266-4, A375, VMM5A and A2058, in addition to normal human skin cell line PIG1, were measured by RT-qPCR. *P<0.05, **P<0.01 vs. control. miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR.

miR-18a-5p promotes proliferation and induces apoptosis and autophagy in melanoma cells

The expression of miR-18a-5p in two melanoma cell lines, WM266-4 and A375, was knocked down through transfection using specific inhibitors targeting miR-18a-5p (Fig. 2A) to investigate the cellular function of elevated miR-18a-5p expression in melanoma development. The proliferation rates of WM266-4 and A375 cells were revealed to be markedly decreased by miR-18a-5p inhibitors, compared with the NC groups, as evidenced by the CCK-8 assay (Fig. 2B). The colony formation assay showed a significant reduction in colony formation efficiency of WM266-4 and A375 cells induced by miR-18a-5p inhibitors (Fig. 2C). The percentages of apoptotic WM266-4 and A375 cells were significantly increased through transfection with miR-18a-5p inhibitors in the flow cytometry assay (Fig. 2D). The Hoechst staining assay also revealed a marked elevation of apoptotic WM266-4 and A375 cells following miR-18a-5p inhibitor treatment compared with the NC groups (Fig. 2E). The results of western blot analysis revealed cleaved-caspase-3 and cleaved-caspase-9, the two apoptosis marker proteins, to be markedly upregulated in both WM266-4 and A375 cells following miR-18a-5p knockdown, whereas the expression levels of pro-caspase-3 and pro-caspase-9 were notably decreased (Fig. 2F). The LC3-II protein levels in WM266-4 and A375 cells were notably elevated by transfection with miR-18a-5p inhibitors, whereas autophagy target protein p62 levels were markedly reduced (Fig. 2F). The aforementioned findings indicated the roles miR-18a-5p served in regulating apoptosis and autophagy during melanoma development.
Figure 2.

miR-18a-5p knockdown suppresses proliferation and promotes apoptosis and autophagy in melanoma cells. (A) miR-18a-5p expression in WM266-4 and A375 cells with specific inhibitors. miR-18a-5p expression was evaluated by RT-qPCR 36 h following transfection. (B and C) Decreased proliferation rates in WM266-4 and A375 cells following miR-18a-5p knockdown. Cell proliferation rates were detected by (B) Cell Counting Kit-8 and (C) colony formation assays. (D and E) Enhanced apoptosis in WM266-4 and A375 cells transfected with miR-18a-5p inhibitors. Cell apoptosis was analyzed by (D) flow cytometry and (E) Hoechst staining (magnification, ×400). (F) Altered levels of apoptosis and autophagy marker proteins in WM266-4 and A375 cells following miR-18a-5p knockdown. Protein expression was measured by western blotting. GAPDH was used as the internal standard. **P<0.01 vs. NC group. miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; NC, negative control; LC3-I/II, Light chain 3-I/II.

miR-18a-5p suppresses EPHA7 expression by binding with its 3′-UTR region in melanoma cells

The expression of EPHA7 was further studied in melanoma cells with alterations in miR-18a-5p expression to investigate the correlation between miR-18a-5p and EPHA7 expression during melanoma pathogenesis. The expression of miR-18a-5p was significantly overexpressed following transfection with miR-18a-5p mimics (Fig. 3A). EPHA7 expression levels in WM266-4 and A375 cells were observed to be significantly suppressed by transfection with miR-18a-5p mimics, but were significantly elevated by transfection with miR-18a-5p inhibitors compared with the NC groups (Fig. 3B). Western blotting results were consistent with RT-qPCR (Fig. 3C). The expression of EPHA7 in clinical melanoma tissues was also significantly lower compared with normal skin tissues (Fig. 3D). The expression of EPHA7 exhibited a significantly negative correlation with the miR-18a-5p expression in clinical melanoma tissues and normal skin tissues (Fig. 3E). In addition, EPHA7 expression levels were observed to be significantly lower in WM266-4, A375, VMM5A and A2058 cells compared with PIG1 cells (Fig. 3F). miR-18a-5p mimics were observed to cause a marked decrease in the luciferase activity of WM266-4 and A375 cells expressing the WT EPHA7 3′-UTR sequences, but not in WM266-4 and A375 cells expressing the MUT EPHA7 3′-UTR sequences (Fig. 3G and H). These findings suggested that miR-18a-5p may inhibit EPHA7 expression by directly binding with EPHA7 3′-UTR sequences in melanoma cells.
Figure 3.

miR-18a-5p suppresses EPHA7 expression by binding to its 3′-UTR region in melanoma cells. (A) Relative miR-18a-5p expression levels in WM266-4 and A375 cells transfected with miR-18a-5p mimics. Gene expression was measured by RT-qPCR. (B) Relative EPHA7 expression levels in WM266-4 and A375 cells transfected with miR-18a-5p mimics or inhibitors. Gene expression was measured by RT-qPCR. (C) EPHA7 protein expression in WM266-4 and A375 cells following transfection with miR-18a-5p mimics or inhibitors. Protein expression was analyzed by western blotting, with GAPDH as the internal standard. (D) Relative EPHA7 expression in melanoma tissues and adjacent normal skin tissues collected from 20 patients. EPHA7 expression was measured by RT-qPCR. (E) Negative correlation between miR-18a-5p and EPHA7 expression in melanoma tissues and adjacent normal skin tissues. (F) Expression of EPHA7 in the indicated cell lines was examined by RT-qPCR. (G and H) Binding of miR-18a-5p with EPHA7 3′-UTR sequences in WM266-4 and A375 cells was confirmed by a Dual-Luciferase reporter assay. miR-18a-5p mimics significantly repressed luciferase activity in cells expressing WT EPHA7 3′-UTR sequences, but not in cells expressing the MUT EPHA7 3′-UTR sequences. *P<0.05, **P<0.01, ***P<0.001 vs. control group. miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; NC, negative control; EPHA7, ephrin receptor A7; UTR, untranslated region; WT, wild-type; MUT, mutant.

miR-18a-5p promotes melanoma cell proliferation and inhibits apoptosis and autophagy by suppressing EPHA7 expression

WM266-4 and A375 cells that overexpressed EPHA7 were established and treated with miR-18a-5p mimics to investigate the regulatory roles of EPHA7 in miR-18a-5p-promoted melanoma cell functions. EPHA7 expression in WM266-4 and A375 cells was observed to be significantly increased by transfection with EPHA7-overexpressing vector in the present study, but the effect of overexpression was partially inhibited by the addition of miR-18a-5p mimics (Fig. 4A). The level of miR-18a was significantly suppressed by transfection with EPHA7-overexpressing vector and this could be reversed with the addition of miR-18a-5p mimics (Fig. 4B). Overexpression of EPHA7 significantly decreased the proliferation rates of WM266-4 and A375 cells compared with the NC groups, as assessed by a CCK-8 assay (Fig. 4C). Nevertheless, the lowered cell proliferation rates in WM266-4 and A375 cells due to EPHA7 overexpression were significantly reversed by transfection with miR-18a-5p mimics (Fig. 4C and D). The colony formation assay revealed that EPHA7 overexpression led to significantly reduced numbers of WM266-4 and A375 colonies, which was significantly recovered by transfection with miR-18a-5p mimics (Fig. 4E). EPHA7 overexpression markedly increased apoptotic WM266-4 and A375 cells compared with the untransfected or empty vector-transfected cells (Fig. 5A). miR-18a-5p mimics transfection notably reduced the number of apoptotic cells (Fig. 5A). The apoptotic rates in WM266-4 and A375 cells were identified to be significantly elevated by EPHA7 overexpression (Fig. 5B and C). Transfection with miR-18a-5p mimics significantly eliminated the increase in apoptotic cells triggered by overexpression of EPHA7 (Fig. 5B and C). The expression levels of apoptosis marker proteins cleaved-caspase-3 and cleaved-caspase-9 in WM266-4 and A375 cells, in addition to autophagy-related protein LC3-II, were upregulated by overexpression of EPHA7 and were inhibited by simultaneous transfection with miR-18a-5p mimics (Fig. 5D). Targets that indicate excessive autophagy degradation, p62 and LC3-I, and pro-caspase-3 and pro-caspase-9 proteins, exhibited completely opposite changes (Fig. 5D). These results indicated that miR-18a-5p could induce melanoma cell proliferation and suppress apoptosis and autophagy by inhibiting EPHA7 expression.
Figure 4.

miR-18a-5p promotes melanoma cell proliferation by repressing EPHA7 expression. (A) Relative EPHA7 expression in WM266-4 and A375 cells transfected with EPHA7-overexpression vectors and miR-18a-5p mimics. (B) Relative miR-18a expression in WM266-4 and A375 cells transfected with EPHA7-overexpression vectors and miR-18a-5p mimics. (C) Proliferation rates of WM266-4 cells transfected with EPHA7-overexpression vectors and miR-18a-5p mimics. Cell proliferation was measured via CCK-8. (D) Proliferation rates of A375 cells transfected with EPHA7-overexpression vectors and miR-18a-5p mimics. Cell proliferation was assessed via CCK-8. (E) Evaluation of WM266-4 and A375 cell proliferation rates following transfection with EPHA7-overexpression vectors and miR-18a-5p mimics, as measured by a colony formation assay. ***P<0.001 vs. vector; #P<0.05, ##P<0.01, ###P<0.01 vs. the EPHA7+NC group. miR, microRNA; NC, negative control; EPHA7, ephrin receptor A7; CCK-8, Cell Counting Kit-8.

Figure 5.

miR-18a-5p represses melanoma cell proliferation and autophagy by inhibiting EPHA7 expression. (A) Apoptosis of WM266-4 and A375 cells following transfection with EPHA7-overexpression vectors and miR-18a-5p mimics (magnification, ×400). Cell apoptosis was detected by Hoechst staining. (B) Apoptosis of WM266-4 and A375 cells following transfection with EPHA7-overexpression vectors and miR-18a-5p mimics. Flow cytometry was used to evaluate cell apoptosis. (C) Quantitation of apoptotic WM266-4 and A375 cells following transfection with EPHA7-overexpression vectors and miR-18a-5p mimics. (D) Effects of EPHA7 overexpression and miR-18a-5p mimics on apoptosis and autophagy marker proteins in WM266-4 and A375 cells. Protein expression was determined by western blotting. GAPDH was applied as the internal standard. **P<0.01 vs. Vector group; ##P<0.01 vs. EPHA7+NC group. miR, microRNA; NC, negative control; LC3-I/II, Light chain 3-I/II; EPHA7, ephrin receptor A7.

Discussion

Non-coding RNAs, including miRNA, long non-coding RNA and circular RNA, have been identified as crucial epigenetic regulators of various biological processes and pathogenic conditions (23,24). miRNAs have also been associated with melanoma in previous studies (16,17), but the precise roles and molecular mechanisms of miRNAs in the initiation and development of melanoma requires further study. miR-18a-5p promotes proliferation and migration, and suppresses apoptosis of lung cancer cells, and is also significantly increased in malignant melanoma tissues (17,19); however, its pathogenic roles and mechanisms in melanoma cells remains to be elucidated. In the present study, significantly increased miR-18a-5p expression levels were recorded in clinical melanoma tissues and cell lines. By eliminating miR-18a-5p expression in melanoma cells, miR-18a-5p was demonstrated to promote melanoma cell proliferation and suppress apoptosis and autophagy in melanoma cells. miR-18a-5p was also shown to directly bind with the 3′-UTR region of the EPHA7 gene and suppress its expression in melanoma cells, which mediated the effects of miR-18a-5p expression on melanoma cell proliferation, apoptosis and autophagy. These results revealed a novel miRNA-target network underlying the pathogenesis of melanoma, which may be explored further for non-coding RNA-based melanoma diagnosis and treatment. On the basis of previous studies, miR-18a-5p has been demonstrated to serve as a significant epigenetic regulator in various types of human cancer, including NSCLC (19), and breast (25,26) and prostate cancers (27). The regulatory functions of miR-18a-5p in melanoma cancer cell proliferation and apoptosis were demonstrated in the present study by transfection with miR-18a-5p inhibitors. miR-18a-5p knockdown also led to a notable elevation of the two apoptosis marker proteins caspase-3 and caspase-9, which serve as crucial components of the mitochondria-cytochrome c-caspase cascade of apoptosis processes (28). For the first time, to the best of our knowledge, the present study linked the cellular functions of miR-18a-5p to melanoma development and progression, which further established the widespread roles of miR-18a-5p in tumorigenesis and broadened the existing knowledge on melanoma molecular pathogenic mechanisms in terms of non-coding RNAs. The pathogenic functions of miR-18a-5p in different types of cancer may be mediated by regulating distinct target genes (27). The suppressive effects of miR-18a-5p on EPHA7 expression was further validated in two melanoma cell lines in the present study. The Dual-Luciferase reporter assay also confirmed the direct binding of miR-18a-5p with the 3′-UTR region of the EPHA7 gene. The effects of EPHA7 on melanoma cell proliferation and apoptosis processes were reversed by transfection with miR-18a-5p mimics. These findings revealed EPHA7 as a target gene of miR-18a-5p in melanoma pathogenesis. Notably, the alteration of EPHA7 expression is also associated with the development of other types of human cancer, including glioblastoma multiforme, and colorectal, prostate and gastric cancers (9,10,29–31). The miR-18a-5p/EPHA7 axis may also mediate the pathogenesis of the types of human cancer mentioned above as indicated by the involvement of miR-18a-5p in melanoma; this requires further investigation. In addition, the miR-18a-5p/EPHA7 axis was established to alter the expression of two autophagy-related proteins LC3-I/II and p62 in melanoma cells. LC3II is one of the most specific autophagy biomarkers induced by autophagy-associated genes, including autophagy-related protein 3 (ATG3) and ATG7, and is known to closely bind with autophagosome membranes (32). By contrast, p62 protein is a commonly known degradation target of autophagy and the selective p62 degradation by autophagy has been observed to mediate the inhibitory roles of autophagy in tumorigenesis (33,34). In the present study, LC3-II activation was demonstrated to be elevated by miR-18a-5p inhibitors, but p62 protein expression was suppressed by miR-18a-5p knockdown in melanoma cells. Similar LC3-II activation and alterations in p62 protein expression were also observed to be caused by EPHA7 overexpression. Molecular evidence suggested that the miR-18a-5p/EPHA7 axis modulated autophagy in melanoma cells, which may also be involved in miR-18a-5p-regulated melanoma development and progression. Autophagy has as established role in melanoma development and as a common response to antitumor therapies (35,36). The pathogenic roles of autophagy alteration by miR-18a-5p in melanoma pathogenesis requires further investigations involving cellular and animal models. A limitation of the present study remains that the role of miR-18a-5p in melanoma needs to be validated through a xenograft tumor model. Furthermore, the therapeutic potential of miR-18a-5p inhibitors against melanoma remains to be further determined in clinical practice. To conclude, miR-18a-5p was demonstrated to be highly expressed in melanoma tissues and cell lines, promoting proliferation, and suppressing apoptosis and autophagy of melanoma cells by directly targeting and inhibiting the expression of EPHA7. These findings clarified the development and progression of non-coding RNA-mediated melanoma, which may be explored further to design novel diagnostic methods and therapies for patients with melanoma.
  36 in total

Review 1.  Cancer epigenetics: from mechanism to therapy.

Authors:  Mark A Dawson; Tony Kouzarides
Journal:  Cell       Date:  2012-07-06       Impact factor: 41.582

2.  Cancer statistics, 2018.

Authors:  Rebecca L Siegel; Kimberly D Miller; Ahmedin Jemal
Journal:  CA Cancer J Clin       Date:  2018-01-04       Impact factor: 508.702

Review 3.  Physiological significance of selective degradation of p62 by autophagy.

Authors:  Masaaki Komatsu; Yoshinobu Ichimura
Journal:  FEBS Lett       Date:  2010-02-12       Impact factor: 4.124

4.  Downregulation of EphA7 by hypermethylation in colorectal cancer.

Authors:  Jiandong Wang; Hideki Kataoka; Masaya Suzuki; Naomi Sato; Ritsuko Nakamura; Hong Tao; Keiji Maruyama; Jun Isogaki; Shigeru Kanaoka; Megumi Ihara; Masamitsu Tanaka; Masao Kanamori; Toshio Nakamura; Kazuya Shinmura; Haruhiko Sugimura
Journal:  Oncogene       Date:  2005-08-25       Impact factor: 9.867

5.  Long non-coding RNA FENDRR reduces prostate cancer malignancy by competitively binding miR-18a-5p with RUNX1.

Authors:  Guanying Zhang; Guangye Han; Xinjun Zhang; Quanfeng Yu; Zeyu Li; Zhenhui Li; Jianchang Li
Journal:  Biomarkers       Date:  2018-03-21       Impact factor: 2.658

Review 6.  Review of diagnostic, prognostic, and predictive biomarkers in melanoma.

Authors:  Jacob S Ankeny; Brian Labadie; Jason Luke; Eddy Hsueh; Jane Messina; Jonathan S Zager
Journal:  Clin Exp Metastasis       Date:  2018-05-02       Impact factor: 5.150

7.  MicroRNA-18a-5p functions as an oncogene by directly targeting IRF2 in lung cancer.

Authors:  Chen Liang; Xing Zhang; Hui-Min Wang; Xiao-Min Liu; Xin-Ju Zhang; Bo Zheng; Guang-Ren Qian; Zhong-Liang Ma
Journal:  Cell Death Dis       Date:  2017-05-04       Impact factor: 8.469

8.  Activation and cleavage of SASH1 by caspase-3 mediates an apoptotic response.

Authors:  Joshua T Burgess; Emma Bolderson; Mark N Adams; Anne-Marie Baird; Shu-Dong Zhang; Kathy A Gately; Kazuo Umezawa; Kenneth J O'Byrne; Derek J Richard
Journal:  Cell Death Dis       Date:  2016-11-10       Impact factor: 8.469

9.  The Prognostic and Predictive Value of Melanoma-related MicroRNAs Using Tissue and Serum: A MicroRNA Expression Analysis.

Authors:  Mitchell S Stark; Kerenaftali Klein; Benjamin Weide; Lauren E Haydu; Annette Pflugfelder; Yue Hang Tang; Jane M Palmer; David C Whiteman; Richard A Scolyer; Graham J Mann; John F Thompson; Georgina V Long; Andrew P Barbour; H Peter Soyer; Claus Garbe; Adrian Herington; Pamela M Pollock; Nicholas K Hayward
Journal:  EBioMedicine       Date:  2015-05-12       Impact factor: 8.143

10.  Radiosensitizing effects of miR-18a-5p on lung cancer stem-like cells via downregulating both ATM and HIF-1α.

Authors:  Xu Chen; Lei Wu; Dezhi Li; Yanmei Xu; Luping Zhang; Kai Niu; Rui Kong; Jiaoyang Gu; Zihan Xu; Zhengtang Chen; Jianguo Sun
Journal:  Cancer Med       Date:  2018-06-02       Impact factor: 4.452

View more
  5 in total

1.  Identification of potential key molecules and signaling pathways for psoriasis based on weighted gene co-expression network analysis.

Authors:  Xin Shu; Xiao-Xia Chen; Xin-Dan Kang; Min Ran; You-Lin Wang; Zhen-Kai Zhao; Cheng-Xin Li
Journal:  World J Clin Cases       Date:  2022-06-26       Impact factor: 1.534

2.  Identification of a novel circular RNA circZNF652/miR-486-5p/SERPINE1 signaling cascade that regulates cancer aggressiveness in glioblastoma (GBM).

Authors:  Liang Liu; Shan Xiao; Yan Wang; Zifeng Zhu; Yiyao Cao; Sen Yang; Rongkang Mai; Yong Zheng
Journal:  Bioengineered       Date:  2022-01       Impact factor: 3.269

Review 3.  Non-Coding RNAs and Oral Cancer: Small Molecules With Big Functions.

Authors:  Leila Erfanparast; Mohammad Taghizadieh; Ali Akbar Shekarchi
Journal:  Front Oncol       Date:  2022-07-11       Impact factor: 5.738

Review 4.  Xmrks the Spot: Fish Models for Investigating Epidermal Growth Factor Receptor Signaling in Cancer Research.

Authors:  Jerry D Monroe; Faiza Basheer; Yann Gibert
Journal:  Cells       Date:  2021-05-07       Impact factor: 6.600

5.  The Effect of RBP4 on microRNA Expression Profiles in Porcine Granulosa Cells.

Authors:  Yun Zhao; Jiahui Rao; Tong Qiu; Chunjin Li; Xu Zhou
Journal:  Animals (Basel)       Date:  2021-05-13       Impact factor: 2.752

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.