Literature DB >> 33230433

MicroRNA-410-3p Binds to TLR2 and Alleviates Myocardial Mitochondrial Dysfunction and Chemokine Production in LPS-Induced Sepsis.

Tongkun Zuo1, Qing Tang1, Xiangcheng Zhang1, Futai Shang1.   

Abstract

Mitochondrial dysfunction and chemokine production have been reported to be involved in the pathogenesis of sepsis. Our initial bioinformatics analysis identified differentially expressed TLR2 in sepsis and the upstream regulatory microRNA-410-3p (miR-410-3p). Hence, the current study was performed to characterize the potential mechanism by which miR-410-3p modulates mitochondrial dysfunction and chemokine production in lipopolysaccharide (LPS)-induced mice in vivo and cardiomyocytes in vitro. Next, we identified that miR-410-3p was downregulated, while TLR2 was upregulated in LPS-induced mice and cardiomyocytes. In addition, miR-410-3p was confirmed to target and inhibit the TLR2 expression. Thereafter, gain- or loss-of-function experiments were conducted to investigate the effect of miR-410-3p and TLR2 on mitochondrial function and chemokine production. TLR2 knockdown or miR-410-3p overexpression was found to alleviate mitochondrial membrane damage and mitochondrial swelling, in addition to augmenting the levels of adenosine triphosphate, mitochondrial membrane potential, and the expression levels of CCL7, CCL5, CXCL1, and CXCL9 in vivo and in vitro. In conclusion, miR-410-3p-mediated TLR2 inhibition alleviated mitochondrial dysfunction and reduced chemokine production in LPS-induced experimental sepsis. Therefore, the overexpression of miR-410-3p may represent a potential strategy for the treatment of sepsis-induced myocardial injury.
© 2020 The Authors.

Entities:  

Keywords:  TLR2; chemokine; lipopolysaccharide; microRNA-410-3p; mitochondrial dysfunction; sepsis

Year:  2020        PMID: 33230433      PMCID: PMC7516191          DOI: 10.1016/j.omtn.2020.07.031

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   8.886


Introduction

Sepsis is defined as the host inflammatory response brought on by life-threatening infections in the presence of organ dysfunction. Sepsis is most often attributed to infection, but up to 40% of cases occur during sterile tissue injury caused by noninfectious sources such as pancreatitis, ischemia reperfusion injury, cancer, and many other disorders. Sepsis is particularly common among the elderly and this trend is likely to become more apparent as the global population ages. Patients with sepsis accounts for a large proportion of critically ill patients in hospital and medical facilities. Although the prognosis of sepsis has improved over the last few decades, the mortality rate remains higher than 25%–30%, and even 40%–50% when accompanied by shock. Mitochondria are essential cellular organelles known as the powerhouse of the cell due to their ability to produce energy, while mitochondrial damage or dysfunction is often found in sepsis; this represents one of the main factors leading to poor prognoses in sepsis patients. Thus, it is important to further develop specific biomarkers and molecular diagnostic techniques in regard to participation of mitochondria in sepsis for the evaluation of the host response and detection of pathogen infection, which can promote drug development and enhance the clinical management of the highly prevalent disease. MicroRNAs (miRNAs) are novel biomarkers that have been reported to be potential markers of diagnosis and prediction for numerous pathologic conditions, including sepsis. Moreover, a number of miRNAs, as well as their target proteins, have been reported to be indicative of sepsis severity, signifying a key role in the disease. A recent report concluded that one particular miRNA, namely miR-410-3p, was involved in several processes such as inflammation, angiogenesis, and tumorigenesis. Meanwhile, Toll-like receptors (TLRs) are germline-encoded receptors that play crucial roles in both innate and adaptive immune responses. Accumulating evidence has also revealed that targeting TLRs might prove to be a beneficial strategy in the treatment of various conditions including sepsis, systemic lupus erythematosus, asthma, and rheumatoid arthritis. In addition, one such TLR, namely TLR2, has been linked to conditions such as deleterious systemic inflammation, cardiac dysfunction, and acute kidney injury mostly induced by severe sepsis. In the initial phases of the current study, we identified that TLR2 could be targeted and regulated by miR-410-3p. Hence, the current study set out to elucidate the regulatory role of miR-410-3p in mitochondrial dysfunction and chemokine production with the involvement of TLR2 in mouse models of lipopolysaccharide (LPS)-induced sepsis and cardiomyocyte models of LPS-induced myocardial damage.

Results

Knockdown of TLR2 Ameliorates LPS-Induced Myocardial Dysfunction in Septic Mice

First, the sepsis-related microarray dataset GSE53007 was downloaded to screen the differentially expressed genes, the results of which detected 101 differentially expressed genes, of which 91 genes were upregulated and 10 genes were downregulated (Table S1). In addition, Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed, which revealed that the differentially expressed genes were significantly enriched in chemokine-related pathways (p < 0.05; Figure S1). Among the screened differentially expressed genes, the TLR2 gene has been reported to regulate Staphylococcus aureus-induced myocardial dysfunction and cytokine production in the heart, and meanwhile, we documented high expressions of TLR2 in the myocardial tissue of the septic mice (Figure 1A). Thus, the TLR2 gene was adopted for subsequent experimentation. Next, we induced sepsis in mice with the help of LPS treatment. Subsequently, the serum levels of endotoxin in LPS-induced septic mice were found to be significantly higher than that in the normal mice, indicating the successful establishment of the sepsis models (Figure 1B). Western blot analysis revealed that the LPS-induced septic mice exhibited highly expressed levels of TLR2 (Figure 1C), which was largely consistent with our bioinformatic analysis findings. Meanwhile, the inhibition of TLR2 in septic mice led to a decrease in the TLR2 expression (Figure 1C). Furthermore, the septic mice presented with decreased ejection fraction (EF) and fractional shortening (FS) levels in addition to elevated serum levels of creatine kinase (CK) and creatine kinase-MB isoenzyme (CK-MB), which were all reversed following TLR2 inhibition (Figures 1D and 1E). In addition, hematoxylin and eosin (H&E) staining and terminal deoxyribonucleotidyl transferase (TdT)-mediated biotin-16-dUTP nick-end labeling (TUNEL) staining were performed, which revealed that in septic mice, the myocardial fibers were broken and the cross-sectional area of myocardial cells was increased, which led to the destruction of the myocardial structure, as well as an increased cell apoptosis rate, all of which were reversed by silencing TLR2 (Figures 1F and 1G). Moreover, western blot analysis demonstrated that LPS-induced septic mice exhibited increased levels of cleaved-caspase-3, which could be reduced by TLR2 knockdown (Figure 1H). Altogether, the aforementioned results indicated that knockdown of TLR2 ameliorated LPS-induced myocardial dysfunction in septic mice.
Figure 1

TLR2 Is Amplified in Myocardial Tissues of Septic Mice and Its Knockdown Improves LPS-Induced Myocardial Dysfunction

(A) Expression patterns of TLR2 in the GSE53007 microarray dataset. (B) Serum levels of endotoxin in mice 24 h after LPS treatment. (C) mRNA and protein expression patterns of TLR2 in myocardial tissues of mice treated with LPS or in combination with sh-TLR2, measured by qRT-PCR and western blot analysis, normalized to β-actin. (D) Echocardiography and EF (%) and FS (%) of mice treated with LPS or in combination with sh-TLR2. (E) Determination of serum CK and CK-MB levels in mice treated with LPS or in combination with sh-TLR2 by automatic biochemical analyzer. (F) Observation of myocardial tissue structure of mice treated with LPS or in combination with sh-TLR2 by HE staining (200×) and the cross-sectional area of cardiomyocytes. (G) Detection of myocardial apoptosis in mice treated with LPS or in combination with sh-TLR2 by TUNEL staining (200×). (H) Measurement of protein expression of apoptosis-related proteins caspase-3 and cleaved-caspase-3 in myocardial tissues of mice treated with LPS or in combination with sh-TLR2 by western blot analysis, normalized to β-actin; ∗p < 0.05 versus the control group (normal mice treated with PBS); #p < 0.05 versus the LPS + sh-NC group (LPS-induced mice treated with lentivirus carrying sh-NC). Measurement data were expressed as mean ± standard deviation. In (B), comparison between two groups was conducted by paired t test; in the other panels, unpaired t test was performed. n = 12 for mice upon each treatment.

TLR2 Is Amplified in Myocardial Tissues of Septic Mice and Its Knockdown Improves LPS-Induced Myocardial Dysfunction (A) Expression patterns of TLR2 in the GSE53007 microarray dataset. (B) Serum levels of endotoxin in mice 24 h after LPS treatment. (C) mRNA and protein expression patterns of TLR2 in myocardial tissues of mice treated with LPS or in combination with sh-TLR2, measured by qRT-PCR and western blot analysis, normalized to β-actin. (D) Echocardiography and EF (%) and FS (%) of mice treated with LPS or in combination with sh-TLR2. (E) Determination of serum CK and CK-MB levels in mice treated with LPS or in combination with sh-TLR2 by automatic biochemical analyzer. (F) Observation of myocardial tissue structure of mice treated with LPS or in combination with sh-TLR2 by HE staining (200×) and the cross-sectional area of cardiomyocytes. (G) Detection of myocardial apoptosis in mice treated with LPS or in combination with sh-TLR2 by TUNEL staining (200×). (H) Measurement of protein expression of apoptosis-related proteins caspase-3 and cleaved-caspase-3 in myocardial tissues of mice treated with LPS or in combination with sh-TLR2 by western blot analysis, normalized to β-actin; ∗p < 0.05 versus the control group (normal mice treated with PBS); #p < 0.05 versus the LPS + sh-NC group (LPS-induced mice treated with lentivirus carrying sh-NC). Measurement data were expressed as mean ± standard deviation. In (B), comparison between two groups was conducted by paired t test; in the other panels, unpaired t test was performed. n = 12 for mice upon each treatment.

Knockdown of TLR2 Hinders Myocardial Mitochondrial Damage and Decreases Chemokine Production in LPS-Induced Septic Mice

Next, we set out to assess the roles of TLR2 in myocardial mitochondrial dysfunction and chemokine production in LPS-induced septic mice. Initially, the myocardial mitochondrial structure was observed using transmission electron microscope, which illustrated vacuoles with disordered crest tissues and damage to the mitochondrial outer membrane in the LPS-induced septic mice, which was alleviated following injection of lentivirus expressing short hairpin RNA (shRNA)-TLR2 (Figure 2A). Infection with lentivirus expressing sh-TLR2 was also found to diminish the degree of myocardial mitochondria swelling and elevate the adenosine triphosphate (ATP) levels and mitochondrial membrane potential (MMP) in LPS-induced septic mice (Figures 2B–2D). In addition, correlation analysis revealed that the degree of myocardial mitochondria swelling was positively correlated with the mRNA expression of TLR2 (r = 0.587), while the ATP level was negatively correlated with the expression of TLR2 (r = −0.651; Figures 2E and 2F).
Figure 2

Knockdown of TLR2 Improves Myocardial Mitochondrial Dysfunction in LPS-Induced Septic Mice

(A) Observation of myocardial mitochondrial structure under a transmission electron microscope in mice treated with LPS or in combination with sh-TLR2 (20,000×). (B) Measurement of the swelling degree of myocardial mitochondria in mice treated with LPS or in combination with sh-TLR2. (C) Measurement of mitochondrial ATP level in the supernatant upon treatment with LPS or in combination with sh-TLR2. (D) Detection of MMP by JC-1 assay in mice treated with LPS or in combination with sh-TLR2. (E and F) Correlation analysis of TLR2 expression with the myocardial mitochondrial swelling degree (E) and mitochondrial ATP level (F) in myocardial tissues of mice treated with LPS or in combination with sh-TLR2. ∗p < 0.05 versus the LPS + sh-NC group (LPS-induced mice treated with lentivirus carrying sh-NC). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment.

Knockdown of TLR2 Improves Myocardial Mitochondrial Dysfunction in LPS-Induced Septic Mice (A) Observation of myocardial mitochondrial structure under a transmission electron microscope in mice treated with LPS or in combination with sh-TLR2 (20,000×). (B) Measurement of the swelling degree of myocardial mitochondria in mice treated with LPS or in combination with sh-TLR2. (C) Measurement of mitochondrial ATP level in the supernatant upon treatment with LPS or in combination with sh-TLR2. (D) Detection of MMP by JC-1 assay in mice treated with LPS or in combination with sh-TLR2. (E and F) Correlation analysis of TLR2 expression with the myocardial mitochondrial swelling degree (E) and mitochondrial ATP level (F) in myocardial tissues of mice treated with LPS or in combination with sh-TLR2. ∗p < 0.05 versus the LPS + sh-NC group (LPS-induced mice treated with lentivirus carrying sh-NC). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment. Additionally, the string database (https://string-db.org/) was adopted for protein interaction analysis of the differentially expressed genes, and the PPI network illustrated that TLR2 could interact with the CC chemokine and CXC chemokine (Figure 3A). Subsequent enzyme-linked immunosorbent assay (ELISA) performed to determine the serum levels of chemokine ligand 7 (CCL7), CCL5, CXC chemokine ligand 9 (CXCL9), and CXCL1 in LPS-induced septic mice revealed that TLR2 inhibition diminished the serum levels of CCL7, CCL5, CXCL9, and CXCL1 in LPS-induced septic mice (Figures 3B–3E). Altogether, these findings suggested that TLR2 silencing suppressed the LPS-induced mitochondrial swelling and chemokine production.
Figure 3

Knockdown of TLR2 Decreases Chemokine Production in LPS-Induced Septic Mice

(A) PPI network of differentially expressed genes in the GSE53007 microarray dataset. Red indicates the core gene. (B) Determination of serum CXCL1 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. (C) Determination of serum CXCL9 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. (D) Determination of serum CCL5 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. (E) Determination of serum CCL7 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. ∗p < 0.05 versus the LPS + sh-NC group (LPS-induced mice treated with lentivirus carrying sh-NC). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was performed using unpaired t test. n = 12 for mice upon each treatment.

Knockdown of TLR2 Decreases Chemokine Production in LPS-Induced Septic Mice (A) PPI network of differentially expressed genes in the GSE53007 microarray dataset. Red indicates the core gene. (B) Determination of serum CXCL1 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. (C) Determination of serum CXCL9 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. (D) Determination of serum CCL5 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. (E) Determination of serum CCL7 levels by ELISA in mice treated with LPS or in combination with sh-TLR2. ∗p < 0.05 versus the LPS + sh-NC group (LPS-induced mice treated with lentivirus carrying sh-NC). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was performed using unpaired t test. n = 12 for mice upon each treatment.

TLR2 Is a Putative Target of miR-410-3p

The abovementioned results validated TLR2 to modulate myocardial mitochondrial dysfunction and chemokine release in LPS-induced septic mice; however, the upstream regulatory mechanism remained unclear. Thus, bioinformatic prediction tools DIANA TOOLS (http://diana.imis.athena-innovation.gr/DianaTools/index.php), RAID v2.0 (http://www.rna-society.org/raid/), and TargetScan (http://www.targetscan.org/vert_71/) were adopted to predict the upstream regulatory miRNAs. The predicted results revealed a putative binding relationship between miR-410-3p, miR-1970, and TLR2 (Figure 4A). Subsequently, to confirm which of the two aforementioned miRNAs was the regulatory miRNA of TLR2 in sepsis, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed, which revealed that LPS treatment triggered a marked decrease in the expression of miR-410-3p but failed to influence the expression of miR-1970 in mice (Figure 4B), indicating that miR-410-3p could be a potential regulatory miRNA of TLR2 in sepsis. Moreover, analysis of the bioinformatics database (TargetScan) revealed the presence of specific binding sites of miR-410-3p in the TLR2 3′ untranslated region (3′ UTR; Figure 4C). Luciferase reporter assay was then performed to validate the binding relationship between miR-410-3p and TLR2, the results of which illustrated that compared with the mimic-negative control (NC) group, the luciferase activity of TLR2-3′ UTR wild-type (WT) was significantly reduced by co-transfection of miR-410-3p; however, miR-410-3p brought about no effect on the luciferase activity of TLR2-3′ UTR mutant (MUT; Figure 4D). Additionally, myocardial damage was induced in cardiomyocytes through LPS treatment (2 μg/mL, 24 h), and qRT-PCR and western blot results demonstrated that the expression of miR-410-3p was markedly downregulated, while the mRNA and protein expressions of TLR2 were upregulated in the LPS-exposed cardiomyocytes (Figures 4E and 4F). LPS stimulation was also performed on the cardiomyocytes after miR-410-3p agomir transduction in order to investigate the regulatory effect of miR-410-3p on TLR2. The expression of miR-410-3p was found to be notably upregulated following miR-410-3p agomir injection in the LPS-exposed cardiomyocytes, while that of TLR2 was markedly downregulated (Figures 4G and 4H). Moreover, the expression patterns of miR-410-3p and TLR2 in cardiomyocytes of septic mice were examined during in vivo experimentation, the results of which revealed that the expressions of miR-410-3p and TLR2 were negatively correlated (r = −0.681; Figure 4I). In addition, western blot analysis illustrated that TLR2 protein expression was significantly upregulated in LPS-induced cardiomyocytes treated with miR-410-3p inhibitor (Figure 4J). The aforementioned results validated that TLR2 was indeed a target of miR-410-3p in sepsis.
Figure 4

TLR2 Is a Putative Target of miR-410-3p

(A) Prediction results of miRNAs targeting TLR2 gene by bioinformatics analysis. (B) Expression patterns of miR-410-3p and miR-1970 in myocardial tissues of LPS-treated mice, detected by qRT-PCR, normalized to U6. (C) Putative miR-410-3p binding sites in the 3′ UTR of TLR2 mRNA in the TargetScan website (http://www.targetscan.org/). (D) TLR2 binding to miR-410-3p verified by dual luciferase reporter gene assay in HEK293T cells, n = 3. (E) miR-410-3p expression and TLR2 mRNA expression patterns measured by qRT-PCR in LPS-exposed cardiomyocytes, normalized to U6 and β-actin, respectively. (F) TLR2 protein expression patterns in LPS-exposed cardiomyocytes measured by western blot analysis, normalized to β-actin. (G) miR-410-3p expression and TLR2 mRNA expression patterns measured by qRT-PCR in LPS-exposed cardiomyocytes treated with miR-410-3p agomir, normalized to U6 and β-actin, respectively. (H) Protein expression patterns of TLR2 in LPS-exposed cardiomyocytes after restoration of miR-410-3p, measured by western blot analysis, normalized to β-actin. (I) Correlation analysis of miR-410-3p expression with TLR2 expression in cardiomyocytes of septic mice. (J) TLR2 protein expression patterns in LPS-induced cardiomyocytes treated with miR-410-3p inhibitor measured by western blot analysis, normalized to β-actin. ∗p < 0.05 versus the control (normal mice treated with PBS), mimic-NC (HEK293T cells transfected with mimic NC) or the LPS + agomir-NC group (LPS-exposed cardiomyocytes infected with lentivirus carrying agomir-NC). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment.

TLR2 Is a Putative Target of miR-410-3p (A) Prediction results of miRNAs targeting TLR2 gene by bioinformatics analysis. (B) Expression patterns of miR-410-3p and miR-1970 in myocardial tissues of LPS-treated mice, detected by qRT-PCR, normalized to U6. (C) Putative miR-410-3p binding sites in the 3′ UTR of TLR2 mRNA in the TargetScan website (http://www.targetscan.org/). (D) TLR2 binding to miR-410-3p verified by dual luciferase reporter gene assay in HEK293T cells, n = 3. (E) miR-410-3p expression and TLR2 mRNA expression patterns measured by qRT-PCR in LPS-exposed cardiomyocytes, normalized to U6 and β-actin, respectively. (F) TLR2 protein expression patterns in LPS-exposed cardiomyocytes measured by western blot analysis, normalized to β-actin. (G) miR-410-3p expression and TLR2 mRNA expression patterns measured by qRT-PCR in LPS-exposed cardiomyocytes treated with miR-410-3p agomir, normalized to U6 and β-actin, respectively. (H) Protein expression patterns of TLR2 in LPS-exposed cardiomyocytes after restoration of miR-410-3p, measured by western blot analysis, normalized to β-actin. (I) Correlation analysis of miR-410-3p expression with TLR2 expression in cardiomyocytes of septic mice. (J) TLR2 protein expression patterns in LPS-induced cardiomyocytes treated with miR-410-3p inhibitor measured by western blot analysis, normalized to β-actin. ∗p < 0.05 versus the control (normal mice treated with PBS), mimic-NC (HEK293T cells transfected with mimic NC) or the LPS + agomir-NC group (LPS-exposed cardiomyocytes infected with lentivirus carrying agomir-NC). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment.

Overexpression of miR-410-3p Alleviates Myocardial Mitochondrial Damage and Decreases Chemokine Production in LPS-Induced Septic Mice by Regulating TLR2

Additionally, the regulatory role of miR-410-3p in myocardial mitochondrial dysfunction and chemokine production in LPS-induced septic mice was assessed. qRT-PCR and western blot analysis findings revealed that the overexpression of miR-410-3p in septic mice brought about significant elevations in the miR-410-3p levels, while downregulating the expression of TLR2 (Figures 5A and 5B). H&E staining results further illustrated that the overexpression of miR-410-3p in LPS-induced septic mice led to a reduction in cross-sectional area of myocardial cells and structural damage, which could be counteracted by overexpression of TLR2 together (Figure 5C). In addition, apoptosis of the myocardial cells was evaluated with TUNEL staining and western blot analysis, the results of which revealed that the overexpression of miR-410-3p led to reduced cell apoptosis rates, as well as diminished expressions of caspase-3 and cleaved-caspase-3 in septic mice; which were reversed by overexpressing TLR2 at the same time (Figures 5D and 5E). Transmission electron microscope was employed to visualize the myocardial mitochondria structure, and the results suggested that in LPS-induced mice, overexpression of miR-410-3p decreased the number of vacuoles with disordered crest tissues and alleviated the damage to mitochondrial outer membrane in myocardial mitochondria, while TLR2 overexpression brought about the opposite results (Figure 5F). In the LPS-induced mice, miR-410-3p overexpression led to a reduction in the degree of mitochondrial swelling and increased ATP levels and MMP, which could be abrogated by overexpression of TLR2 (Figures 5G–5I). Moreover, ELISA was conducted to measure the serum levels of CCL7, CCL5, CXCL9, and CXCL1 in LPS-induced mice, and the results obtained indicated that overexpressed miR-410-3p decreased the serum levels of CCL7, CCL5, CXCL9, and CXCL1, whereas opposite trends were noted following overexpression of TLR2 (Figure 6). Altogether, these findings indicated that overexpression of miR-410-3p alleviated LPS-induced myocardial mitochondrial damage and reduced chemokine production by regulating TLR2.
Figure 5

Overexpression of miR-410-3p Alleviates Myocardial Mitochondrial Dysfunction in LPS-Induced Septic Mice by Regulating TLR2

(A) Detection of miR-410-3p and TLR2 expression patterns by qRT-PCR in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2, normalized to U6 and β-actin, respectively. (B) Detection of TLR2 protein expression patterns by western blot analysis in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2, normalized to β-actin. (C) Observation of myocardial tissue structure of mice treated with miR-410-3p agomir or combined with TLR2 by H&E staining (200×). (D) Detection of myocardial apoptosis in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2 by TUNEL staining (200×). (E) Detection of expression patterns of apoptosis-related proteins caspase-3 and cleaved-caspase-3 by western blot analysis in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2, normalized to β-actin. (F) Observation of myocardial mitochondrial structure by a transmission electron microscope in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2 (20,000×). (G) Measurement of the swelling degree of myocardial mitochondria in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2. (H) Measurement of mitochondrial ATP levels in the supernatant in LPS mice treated with miR-410-3p agomir or combined with TLR2. (I) Detection of MMP by JC-1 assay in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2; ∗p < 0.05 versus the LPS + agomir-NC group (LPS-induced mice treated with agomir-NC); #p < 0.05 versus the LPS + miR-410-3p agomir + pcDNA3.1 group (LPS-induced mice treated with both miR-410-3p agomir and pcDNA3.1). Measurement data were expressed as mean ± standard deviation. In (A), (B), (D), (G), (H), and (I), comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment.

Figure 6

Overexpression of miR-410-3p Decreases Chemokine Production in LPS-Induced Septic Mice by Regulating TLR2

(A) Determination of serum CXCL1 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2. (B) Determination of serum CXCL9 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2. (C) Determination of serum CCL5 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2. (D) Determination of serum CCL7 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2; ∗p < 0.05 versus the LPS + agomir-NC group (LPS-induced mice treated with agomir-NC); #p < 0.05 versus the LPS + miR-410-3p agomir + pcDNA3.1 group (LPS-induced mice treated with both miR-410-3p agomir and pcDNA3.1). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment.

Overexpression of miR-410-3p Alleviates Myocardial Mitochondrial Dysfunction in LPS-Induced Septic Mice by Regulating TLR2 (A) Detection of miR-410-3p and TLR2 expression patterns by qRT-PCR in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2, normalized to U6 and β-actin, respectively. (B) Detection of TLR2 protein expression patterns by western blot analysis in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2, normalized to β-actin. (C) Observation of myocardial tissue structure of mice treated with miR-410-3p agomir or combined with TLR2 by H&E staining (200×). (D) Detection of myocardial apoptosis in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2 by TUNEL staining (200×). (E) Detection of expression patterns of apoptosis-related proteins caspase-3 and cleaved-caspase-3 by western blot analysis in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2, normalized to β-actin. (F) Observation of myocardial mitochondrial structure by a transmission electron microscope in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2 (20,000×). (G) Measurement of the swelling degree of myocardial mitochondria in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2. (H) Measurement of mitochondrial ATP levels in the supernatant in LPS mice treated with miR-410-3p agomir or combined with TLR2. (I) Detection of MMP by JC-1 assay in myocardial tissues of LPS mice treated with miR-410-3p agomir or combined with TLR2; ∗p < 0.05 versus the LPS + agomir-NC group (LPS-induced mice treated with agomir-NC); #p < 0.05 versus the LPS + miR-410-3p agomir + pcDNA3.1 group (LPS-induced mice treated with both miR-410-3p agomir and pcDNA3.1). Measurement data were expressed as mean ± standard deviation. In (A), (B), (D), (G), (H), and (I), comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment. Overexpression of miR-410-3p Decreases Chemokine Production in LPS-Induced Septic Mice by Regulating TLR2 (A) Determination of serum CXCL1 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2. (B) Determination of serum CXCL9 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2. (C) Determination of serum CCL5 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2. (D) Determination of serum CCL7 levels by ELISA in LPS mice treated with miR-410-3p agomir or combined with TLR2; ∗p < 0.05 versus the LPS + agomir-NC group (LPS-induced mice treated with agomir-NC); #p < 0.05 versus the LPS + miR-410-3p agomir + pcDNA3.1 group (LPS-induced mice treated with both miR-410-3p agomir and pcDNA3.1). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. n = 12 for mice upon each treatment.

Overexpression of miR-410-3p Alleviates LPS-Induced Mitochondrial Damage and Decreases Chemokine Production in Cardiomyocytes by Targeting TLR2 In Vitro

miR-410-3p and TLR2 were stably overexpressed or inhibited in mouse cardiomyocytes in vitro (Figure 7A). It was found that the degree of mitochondrial swelling was decreased, while ATP levels and MMP were markedly elevated upon miR-410-3p overexpression or TLR2 silencing. The restoration of TLR2 was noted to reverse the regulatory effects of miR-410-3p on mitochondrial swelling, ATP levels, and MMP (Figures 7B–7D). In addition, the chemokines in the culture medium of LPS-exposed cardiomyocytes were detected by ELISA, and the levels of CCL7, CCL5, CXCL9, and CXCL1 were found to be reduced following miR-410-3p overexpression or TLR2 silencing, all of which were rescued by restoration of TLR2 (Figures 7E–7H). Altogether, the results suggested that miR-410-3p conferred protection against mitochondrial dysfunction and chemokine production in vitro by regulating TLR2.
Figure 7

Overexpression of miR-410-3p Represses LPS-Induced Mitochondrial Dysfunction and Chemokine Production in Cardiomyocytes by Regulating TLR2 In Vitro

(A) Detection of miR-410-3p and TLR2 expression patterns by qRT-PCR in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2, normalized to U6 and β-actin, respectively. (B) Measurement of the swelling degree of myocardial mitochondria. (C) Measurement of mitochondrial ATP levels in the supernatant in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2. (D) Detection of MMP by JC-1 assay in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2, normalized to LPS-exposed cardiomyocytes treated with sh-NC. (E–H) Determination of serum CXCL1 (E), CXCL9 (F), CCL5 (G), and CCL7 (H) levels by ELISA in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2; ∗p < 0.05 versus the LPS + agomir-NC group (cardiomyocytes transduced with agomir-NC and treated with LPS); #p < 0.05 versus the LPS + miR-410-3p agomir group (cardiomyocytes transduced with miR-410-3p agomir and treated with LPS). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. Cell experiments were repeated independently three times.

Overexpression of miR-410-3p Represses LPS-Induced Mitochondrial Dysfunction and Chemokine Production in Cardiomyocytes by Regulating TLR2 In Vitro (A) Detection of miR-410-3p and TLR2 expression patterns by qRT-PCR in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2, normalized to U6 and β-actin, respectively. (B) Measurement of the swelling degree of myocardial mitochondria. (C) Measurement of mitochondrial ATP levels in the supernatant in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2. (D) Detection of MMP by JC-1 assay in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2, normalized to LPS-exposed cardiomyocytes treated with sh-NC. (E–H) Determination of serum CXCL1 (E), CXCL9 (F), CCL5 (G), and CCL7 (H) levels by ELISA in LPS-exposed cardiomyocytes treated with sh-TLR2, miR-410-3p agomir, or both miR-410-3p agomir and TLR2; ∗p < 0.05 versus the LPS + agomir-NC group (cardiomyocytes transduced with agomir-NC and treated with LPS); #p < 0.05 versus the LPS + miR-410-3p agomir group (cardiomyocytes transduced with miR-410-3p agomir and treated with LPS). Measurement data were expressed as mean ± standard deviation. Comparison between two groups was conducted by unpaired t test. Cell experiments were repeated independently three times.

Discussion

Although numerous studies have extensively explored deregulated miRNA expression patterns in inflammatory responses, the pathophysiological roles of these molecules in sepsis are yet to be fully elucidated. In the current study, our results provided compelling evidence illustrating the regulatory role of miR-410-3p and TLR2 in mouse models of LPS-induced sepsis and cardiomyocyte models of LPS-induced myocardial damage. Our findings provide evidence confirming that the overexpression of miR-410-3p alleviated mitochondrial dysfunction and reduced chemokine production by knockdown of TLR2 in sepsis, highlighting the protective role of miR-410-3p in LPS-induced myocardial injury. First, the current study established sepsis mouse models by administering LPS intraperitoneal injections to the mice. After model establishment, we detected elevated serum levels of endotoxin, CK and CK-MB, decreased EF and FS, destruction of myocardial structure, and augmented cell apoptosis rates in LPS-induced septic mice. Consistent with our results, a previous study documented elevated levels of CK and CK-MB in LPS-induced sepsis. Moreover, LPS-induced sepsis is often characterized by systemic inflammation associated with several cardiac diseases, metabolic changes, dysregulation of autonomic nerves, dysfunction of mitochondrial function, cell apoptosis, and inflammation, all of which validated the successful establishment of sepsis mice models in the current study.15, 16, 17 Additionally, our findings revealed that LPS treatment brought about increased levels of TLR2 expression in mice, whereas the downregulation of TLR2 was observed to ameliorate myocardial dysfunction and myocardial mitochondrial dysfunction, as evidenced by elevated ATP levels and MMP, as well as decreased chemokine production in LPS-induced septic mice. A previous study noted that increased ATP production in myocardial tissues was correlated with improved functioning of the mitochondrial respiratory chain. Similarly, amplified secretion of chemokine has also been was observed at the site of infection in polymicrobial sepsis, while TLR2 silencing brought about a decrease in chemokine production in our findings. Interestingly, a previously conducted report has indicated that LPS treatment at certain doses brings about marked elevations in the expression of TLR2 at both mRNA and protein levels in rat kidney epithelial cells. Existing literature further highlights that stimulation of TLRs leads to immune activation, including the production of chemokines capable of promoting the recruitment of additional immune cells, which are subsequently activated by the proinflammatory environment at the site of infection and further stimulating the inflammatory response. Furthermore, the TLR2 signaling pathway also plays a crucial role in systemic inflammation, which has been demonstrated in mice with Staphylococcus aureus sepsis, suggesting that TLR2 may be an attractive candidate gene for determining the risk of sepsis. Further mechanistic investigations in the current study provided evidence highlighting TLR2 as a potential target gene of miR-410-3p. More importantly, we uncovered that overexpression of miR-410-3p could improve mitochondrial dysfunction and diminish chemokine production by knockdown of TLR2 in LPS-induced sepsis mouse models. An increasing number of studies have demonstrated abnormally expressed levels of miR-410-3p in a wide variety of disorders, including inflammatory and autoimmune diseases in addition to being implicated in numerous different biological processes, such as proliferation, apoptosis, and differentiation.23, 24, 25 Moreover, miR-410-3p has been proven to alleviate renal fibrosis in lupus nephritis mice via targeting interleukin-6 (IL-6), adding to its influential role in inflammation. This is critical as the blockade of IL-6 has been previously shown to prevent dysfunction of major organs and improve survival in experimental sepsis. In addition, studies have also highlighted overexpression of miR-410-3p as an inflammatory suppressor in rheumatoid arthritis by suppressing the nuclear factor-κB (NF-κB) signaling pathway. Moreover, Ni et al. concluded that the interception of NF-κB nuclear translocation and phosphorylation confers anti-inflammatory and immunosuppressive effects in LPS-induced sepsis. The overall influence of miR-410-3p on sepsis may also involve IL-6 and NF-κB to some extent, but the underlying mechanism in connection with TLR2 requires further investigation and should be addressed in the future. In conclusion, the current study uncovered that LPS-induced septic mice exhibited reduced miR-410-3p expressions and elevated TLR2 expressions, further identifying TLR2 as a putative target of miR-410-3p. In addition, our findings revealed that overexpression of miR-410-3p could alleviate mitochondrial dysfunction and prevent chemokine production by silencing TLR2 in LPS-induced sepsis mouse models (Figure 8). Ultimately, our study highlights the overexpression of miR-410-3p as a potential therapeutic strategy for sepsis. However, translating these ideas into therapies for human patients will be investigated in future studies, in addition to evaluating other genes or miRNAs that may play a role in sepsis.
Figure 8

The Regulatory Mechanism of miR-410-3p Associated with TLR2 in LPS-Induced Septic Mice

miR-410-3p targets and inhibits TLR2 expression. TLR2 accelerates mitochondrial swelling and chemokine production, while reducing ATP levels and MMP in LPS-induced septic mice. Therefore, overexpression of miR-410-3p could alleviate myocardium injury by downregulating TLR2.

The Regulatory Mechanism of miR-410-3p Associated with TLR2 in LPS-Induced Septic Mice miR-410-3p targets and inhibits TLR2 expression. TLR2 accelerates mitochondrial swelling and chemokine production, while reducing ATP levels and MMP in LPS-induced septic mice. Therefore, overexpression of miR-410-3p could alleviate myocardium injury by downregulating TLR2.

Materials and Methods

Ethics Statement

All animal experiments and procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health and approved by the Laboratory Animal Ethics Committee of The Affiliated Huai’an No.1 People’s Hospital of Nanjing Medical University. Extensive efforts were made to minimize the use and suffering of the included animals.

Microarray-Based Gene-Expression Analysis

First, the sepsis-related microarray dataset GSE53007 was obtained from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). R language “limma” package was applied for differential analysis with |log fold change (FC)| >2 and p value <0.05 set as the threshold to screen the differentially expressed genes. The R package “clusterprofiler” was adopted for GO enrichment and KEGG pathway analysis. GO terms or KEGG pathway with adjusted p value <0.05 were considered to be indicative of statistical significance. In addition, the protein interaction analysis was performed using the string database (https://string-db.org/) to obtain the target gene.

LPS-Induced Sepsis Model Establishment

A total of 120 clean male C57BL/6 mice (aged 8–10 weeks, weighing 25–29 g) purchased from Beijing HFK Bioscience (Beijing, P.R. China) were included in the current study. After adaptive feeding for 1 week, the mice were injected with PBS and regarded as the controls, while the remaining mice were treated with LPS (15 mg/kg, Sigma-Aldrich, St. Louis, USA, cat. no. L2880) to simulate the pathological changes associated with sepsis in vivo. 1 h after LPS injection, the LPS-exposed mice were further injected with 100 μL lentivirus expressing shRNA against TLR2 (sh-TLR2; 108 PFU; Merck, Darmstadt, Germany), 100 μL lentivirus overexpressing TLR2 (108 PFU; Merck, Darmstadt, Germany), 0.4 pmol/μL miR-410-3p agomir (0.5 mL/10 g; Merck, Darmstadt, Germany), as well as their corresponding NCs (pcDNA3.1, sh-NC and agomir-NC) via the tail vein. 24 h later, the serum and heart of mice were collected for follow-up analysis. The serum endotoxin levels were determined by dynamic turbidimetry using a limulus test kit to verify whether the sepsis model had been successfully established. A total of 12 successful modeled mice were selected per treatment regimen.

Cardiomyocyte Isolation and Transfection

Ventricular tissues were obtained from neonatal mice aged 1 day and sliced into cubes of 1 mm3. The cubes were then detached using digestion solution containing 0.08% collagenase and 0.1% trypsin 12 times at 37°C (5 min per detachment). The supernatant was collected and added with serum-containing medium to terminate detachment. The collected supernatant was centrifuged at 800 rpm for 5 min, and the cells were suspended in Dulbecco’s modified Eagle’s medium/Ham’s F-12 (DMEM/F12) medium containing 10% fetal calf serum. The cells were then passed through a 100-mesh filter. After the fibroblasts were removed using a 90-min differential velocity adherent technique, the cardiomyocytes were infected with lentivirus expressing sh-TLR2, lentivirus overexpressing TLR2, miR-410-3p agomir, or corresponding negative controls. The infected cardiomyocytes were then seeded in a 6-well plate. Next, 48 h after cardiomyocytes were observed to have adhered to the wells, the culture medium was replaced with serum-free medium. Sepsis cell models were established using LPS treatment (2 μg/mL, 24 h) for sepsis-induced myocardial damage.

Echocardiography

The cardiac function of mice was assessed 24 h after LPS treatment. First, the mice were anesthetized with 3% pentobarbital sodium (150 mg/kg body weight) and fixed in the supine position. Echocardiographic images were obtained using the Acuson S3000 imaging system (Siemens, Germany) equipped with a 17-MHz linear transducer. The cardiac function parameters were measured using M-mode images, which were obtained from the parasternal short axis view at the papillary muscle level. In addition, left ventricular end-diastolic and end-systolic diameters were also measured. EF and FS were calculated in order to evaluate cardiac function.

Measurement of CK and CK-MB Levels

The mice were anesthetized with 3% pentobarbital sodium (150 mg/kg body weight) 24 h post LPS treatment. Blood samples were collected via orbital sinus puncture and stored at room temperature for 1 h, followed by centrifugation at 3,000 rpm for 10 min for serum collection. The serum levels of CK and CK-MB were analyzed using a Beckman LX-20 Fully Automated Biochemistry Analyzer (Beckman, CA, USA).

Histological Analysis

The collected myocardial tissues were immediately fixed with 4% paraformaldehyde at room temperature for 48 h, paraffin-embedded, sliced into 4 μm sections, and dewaxed with xylene. The sections were then stained with H&E and observed under a light microscope for histological analysis. The cross-sectional area of cardiomyocytes was calculated by measuring the circumferential length of cardiomyocytes using the ImageJ software.

TUNEL Staining

Myocardial apoptosis was detected by TUNEL staining according to the manufacturer’s instructions. Myocardial tissues of each group were fixed with 4% paraformaldehyde, paraffin-embedded and sliced into 4 μm sections. The sections were subsequently incubated with Proteinase K at room temperature for 30 min and then incubated with 50 μL TUNEL reaction mixture (C1090, Beyotime Biotechnology, Shanghai, P.R. China) in dark conditions at 37°C for 60 min. Following three PBS rinses, the sections were incubated with 4’, 6-diamidino-2-phenylindole (DAPI) at room temperature for 10 min and observed under fluorescence microscope. Green fluorescence was indicative of TUNEL-positive cells and blue fluorescence exhibited DAPI-positive cells. The apoptosis rate was calculated based on the ratio of TUNEL-positive cells to DAPI-positive cells.

Transmission Electron Microscope Observation

Myocardial tissues were cut into a square (about 1 mm3), fixed with glutaraldehyde and osmium chloride and then dehydrated with gradient acetone solution, paraffin-embedded, and sliced into semi-thin sections. The sections were subsequently stained with a compound dye containing 0.25% sodium borate and 0.25% basic fuchsin. After observation under a microscope, the sections were sliced into ultrathin sections. The obtained ultrathin sections were then placed on a film treated with 0.45% Fonnvar solution via a copper wire mesh. The ultrathin sections were then stained with uranyl acetate and lead staining fluids at room temperature, dried using a filter paper, and observed under a transmission electron microscope.

Isolation of Mitochondria

The mitochondria were isolated using a Mitochondria Fractionation Kit (Beyotime Biotech, Shanghai, P.R. China) based on a previously reported method. The extracted heart tissues were swiftly placed in mannitol/sucrose/HEPES/EGTA (MSHE) buffer containing 0.22 M mannitol, 70 mM sucrose, 0.5 mM ethylene glycol-bis (β-aminoethyl ether)-N, N-tetraacetic acid (EGTA), and 2 mM K-N-(2-hydroxyethyl) piperazine-N’-(2-ethanesulfonic) acid (HEPES), at 4°C. The myocardium samples were subsequently minced into homogenates, which were then centrifuged at 700 rpm for 10 min to remove the debris. Next, the collected supernatant was centrifuged at 1,000 rpm for 10 min. Finally, the mitochondrial pellets were collected for follow-up experimentation.

Evaluation of Myocardial Mitochondrial Injury

The degree of myocardial mitochondria swelling was measured using a tube luminometer and expressed in optical density (OD). Isolated mitochondria were homogenized in protein extract (Pierce, Rockford, IL, USA), centrifuged at 10,000 × g for 10 min with the supernatant subsequently collected. The ATP levels in myocardial mitochondria were then detected using an ATP kit (BioVision, USA).

Detection of MMP

MMP was detected using a fluorescence probe 5,5′,6,6’-tetrachloro-1,1’,3,3′-tetraethyl-imidacarbocyanine iodide (JC-1; Sigma-Aldrich, St. Louis, MO, USA), which was primarily located in the depolarized mitochondria in the form of monomers and exhibited green fluorescence. Meanwhile, polarized mitochondria mainly contain aggregated JC-1, and exhibited red fluorescence. The isolated mitochondria were incubated with 2 μm JC-1 for 15 min. After staining, the red fluorescence signals were detected at 630 nm using an excitation wavelength of 530 nm, while the green fluorescence signals were detected at 530 nm using an excitation wavelength of 488 nm with a Synergy fluorescence plate reader. Mitochondrial damage was expressed as the ratio of red fluorescence to green fluorescence. In addition, the mitochondria were treated with carbonyl cyanide p-(trifluoromethoxy) phenylhydrazone (FCCP; 10 μM) for 20 min to remove MMP as control. The contents of chemokine CXCL1, CXCL9, CCL5, and CCL7 in cell culture medium or serum were measured according to the instructions of the mouse CXCL1/KC Quantikine ELISA kit (catalog #MKC00B, R&D Systems), Mouse CXCL9/MIG Quantikine ELISA kit (catalog #MCX900, R&D Systems), Mouse/Rat CCL5/RANTES Quantikine ELISA kit (catalog #MMR00, R&D Systems), and MCP3 ELISA kit (ab205571, Abcam, Cambridge, MA, USA).

Western Blot Analysis

Total protein content was extracted from the myocardial tissues or cells using radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Scientific, Rockford, IL, USA) containing phenylmethylsulfonyl fluoride (PMSF). Protein concentration was then determined using a bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, P.R. China). The protein was subsequently separated with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). The membrane was blocked with 5% skim milk at room temperature for 1 h and then incubated at 4°C overnight with the following primary antibodies: rabbit anti-TLR2 (dilution ratio of 1:1,000, ab209217, Abcam, Cambridge, MA, USA), rabbit anti-caspase-3 (dilution ratio of 1:500, ab13847, Abcam, Cambridge, MA, USA), rabbit anti-cleaved-caspase-3 (dilution ratio of 1:500, ab49822, Abcam, Cambridge, MA, USA), and β-actin (Proteintech, Rosemont, USA; cat. no. 20536-1-AP). After three Tris-buffered saline-Tween 20 (TBST) rinses, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody goat anti-rabbit immunoglobulin G (IgG; dilution ratio of 1:2,000, ab6721, Abcam, Cambridge, MA, USA) for 1 h. Following incubation, the protein signal was detected using an enhanced chemiluminescence (ECL) kit (Advansta, CA, USA; cat. no. K-12045-D10) and quantified with the Image Quant software (Molecular Dynamics, Sunnyvale, CA, USA).

Dual Luciferase Reporter Gene Assay

The synthetic TLR2 3′ UTR gene fragment was introduced into the pmirGLO (E1330; Promega, Madison, WI, USA) luciferase vector. The complementary sequence MUT site of the seed sequence was designed on TLR2 WT and inserted into the pmirGLO luciferase vector. The thymidine kinase promoter-Renilla luciferase reporter plasmid (pRL-TK) vector expressing Renilla luciferase (E2241; Promega, Madison, WI, USA) was regarded as the internal reference. The plasmid TLR2-3′ UTR WT or TLR2-3′ UTR MUT were co-transfected with miR-410-3p into the HEK293T cells, which were then collected and lysed 48 h after transfection. Luciferase activity was detected using a Glomax20/20 luminometer fluorescence detector (Promega, Madison, WI, USA) with a luciferase assay kit (RG005, Beyotime Biotechnology, Shanghai, P.R. China). The experiment was repeated three times to obtain the mean value. The targeting relationship between miR-1970 and TLR2 was verified using the aforementioned method.

qRT-PCR

Total RNA content was extracted from the myocardial tissues and cells using the Trizol reagent (15596-026; Thermo Fisher Scientific, Rockford, IL, USA). The obtained RNA was reverse transcribed into complementary DNA (cDNA) based on the instructions of the cDNA kit (K1622; Fermentas, Ontario, CA, USA). The expression patterns of miR-410-3p and miR-1970 was determined by TaqMan miRNA assay (Ambion, Austin, TX, USA) with U6 serving as the internal reference. The expression patterns of TLR2 were determined by PrimeScript RT-PCR kits (Takara, Shiga, Japan) with β-actin serving as the internal reference. Real time-PCR was performed on the ABI7500 quantitative PCR instrument (7500, ABI Company, Oyster Bay, NY, USA). The primers were designed and synthesized by Shanghai Genechem (Shanghai, P.R. China; Table 1). The fold changes of gene expression were calculated by means of relative quantification (2-ΔΔCt method).
Table 1

Primer Sequences

GeneForward Sequence (5′-3′)Reverse Sequence (5′-3′)
miR-410-3pGGTACCTGAGAAGAGGTTGTCTGGGTACTGAAAACAGGCCATCTG
TLR2GGAGTCAGACGTAGTGAGCGAAATGCTGGGAGAACGAGCA
U6CCAGATCATGTTTGAGACCTTCAACCAGAGGCGTACAGGGATAGC
β-actinTTGATGCTTGGTGGGTGGTTRCGATCCACACGGAGTACTTG

miR-410-3p, microRNA-410-3p; TLR2, toll-like receptor 2.

Primer Sequences miR-410-3p, microRNA-410-3p; TLR2, toll-like receptor 2.

Statistical Analysis

Data analyses were performed using the SPSS 21.0 software (IBM, Armonk, NY, USA). Measurement data were expressed as mean ± standard deviation. Comparison of paired design between two groups following normal distribution and homogeneity of variance was conducted by paired t test, while unpaired data was analyzed with unpaired t test. Values of p < 0.05 were considered to be indicative of statistical significance.

Author Contributions

T.Z. and Q.T. designed the research. X.Z. performed the experiments and collected and analyzed the data. F.S. and T.Z. validated the results. F.S. wrote the manuscript text and prepared the figures. K.Z., Q.T., and X.Z. have read critically and edited the manuscript. All authors reviewed and approved the final version of the manuscript.

Conflicts of Interest

The authors declare no competing interests.
  32 in total

1.  MiR-410 Down-Regulates the Expression of Interleukin-10 by Targeting STAT3 in the Pathogenesis of Systemic Lupus Erythematosus.

Authors:  Dongmei Liu; Na Zhang; Xiaomei Zhang; Muting Qin; Youdan Dong; Lei Jin
Journal:  Cell Physiol Biochem       Date:  2016-06-29

Review 2.  Sepsis: a roadmap for future research.

Authors:  Jonathan Cohen; Jean-Louis Vincent; Neill K J Adhikari; Flavia R Machado; Derek C Angus; Thierry Calandra; Katia Jaton; Stefano Giulieri; Julie Delaloye; Steven Opal; Kevin Tracey; Tom van der Poll; Eric Pelfrene
Journal:  Lancet Infect Dis       Date:  2015-04-19       Impact factor: 25.071

Review 3.  Sepsis-induced immunosuppression: from cellular dysfunctions to immunotherapy.

Authors:  Richard S Hotchkiss; Guillaume Monneret; Didier Payen
Journal:  Nat Rev Immunol       Date:  2013-11-15       Impact factor: 53.106

4.  miR-410 suppresses the expression of interleukin-6 as well as renal fibrosis in the pathogenesis of lupus nephritis.

Authors:  Dongmei Liu; Na Zhang; Jing Zhang; Haiyan Zhao; Xiaofei Wang
Journal:  Clin Exp Pharmacol Physiol       Date:  2016-06       Impact factor: 2.557

5.  Interleukin-34 Ameliorates Survival and Bacterial Clearance in Polymicrobial Sepsis.

Authors:  Xue Lin; Hongchun Luo; Xingxing Yan; Zhixin Song; Xun Gao; Yun Xia; Liping Zhang; Yibing Yin; Ju Cao
Journal:  Crit Care Med       Date:  2018-06       Impact factor: 7.598

6.  CBS and CSE are critical for maintenance of mitochondrial function and glucocorticoid production in adrenal cortex.

Authors:  Chang-Nan Wang; Yu-Jian Liu; Guo-Li Duan; Wei Zhao; Xiao-Han Li; Xiao-Yan Zhu; Xin Ni
Journal:  Antioxid Redox Signal       Date:  2014-05-27       Impact factor: 8.401

Review 7.  Potential therapy strategy: targeting mitochondrial dysfunction in sepsis.

Authors:  Hui Zhang; Yong-Wen Feng; Yong-Ming Yao
Journal:  Mil Med Res       Date:  2018-11-26

Review 8.  Cellular and viral microRNAs in sepsis: mechanisms of action and clinical applications.

Authors:  Dana Elena Giza; Enrique Fuentes-Mattei; Marc David Bullock; Stefan Tudor; Matthew Joseph Goblirsch; Muller Fabbri; Florea Lupu; Sai-Ching Jim Yeung; Catalin Vasilescu; George Adrian Calin
Journal:  Cell Death Differ       Date:  2016-10-14       Impact factor: 15.828

9.  Dihydromyricetin Attenuates Myocardial Hypertrophy Induced by Transverse Aortic Constriction via Oxidative Stress Inhibition and SIRT3 Pathway Enhancement.

Authors:  Yun Chen; Hui-Qin Luo; Lin-Lin Sun; Meng-Ting Xu; Jin Yu; Lu-Lu Liu; Jing-Yao Zhang; Yu-Qin Wang; Hong-Xia Wang; Xiao-Feng Bao; Guo-Liang Meng
Journal:  Int J Mol Sci       Date:  2018-08-31       Impact factor: 5.923

Review 10.  Recent clinical trends in Toll-like receptor targeting therapeutics.

Authors:  Muhammad Ayaz Anwar; Masaud Shah; Jason Kim; Sangdun Choi
Journal:  Med Res Rev       Date:  2018-11-18       Impact factor: 12.944

View more
  5 in total

1.  Clinical Significance of the Serum lncRNA NORAD Expression in Patients with Neonatal Sepsis and Its Association with miR-410-3p.

Authors:  Hong Zhang; Lihong Li; Leijie Xu; Yanyan Zheng
Journal:  J Inflamm Res       Date:  2021-08-26

2.  miR-294 and miR-410 Negatively Regulate Tnfa, Arginine Transporter Cat1/2, and Nos2 mRNAs in Murine Macrophages Infected with Leishmania amazonensis.

Authors:  Stephanie Maia Acuña; Jonathan Miguel Zanatta; Camilla de Almeida Bento; Lucile Maria Floeter-Winter; Sandra Marcia Muxel
Journal:  Noncoding RNA       Date:  2022-02-06

Review 3.  The Role of Mitochondrial miRNAs in the Development of Radon-Induced Lung Cancer.

Authors:  Assiya Kussainova; Olga Bulgakova; Akmaral Aripova; Zumama Khalid; Rakhmetkazhi Bersimbaev; Alberto Izzotti
Journal:  Biomedicines       Date:  2022-02-11

Review 4.  Research Progress on the Mechanism of Sepsis Induced Myocardial Injury.

Authors:  Cheng-Fei Bi; Jia Liu; Li-Shan Yang; Jun-Fei Zhang
Journal:  J Inflamm Res       Date:  2022-07-26

5.  MiR-410-3p facilitates Angiotensin II-induced cardiac hypertrophy by targeting Smad7.

Authors:  Guizhi Jia; Chunguang Liang; Wenhui Li; Hongliang Dai
Journal:  Bioengineered       Date:  2022-01       Impact factor: 3.269

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.