Literature DB >> 33226340

Systemic hypoxia inhibits T cell response by limiting mitobiogenesis via matrix substrate-level phosphorylation arrest.

Amijai Saragovi1, Ifat Abramovich2, Ibrahim Omar1, Eliran Arbib1, Ori Toker3, Eyal Gottlieb2, Michael Berger1.   

Abstract

Systemic oxygen restriction (SOR) is prevalent in numerous clinical conditions, including chronic obstructive pulmonary disease (COPD), and is associated with increased susceptibility to viral infections. However, the influence of SOR on T cell immunity remains uncharacterized. Here we show the detrimental effect of hypoxia on mitochondrial-biogenesis in activated mouse CD8+ T cells. We find that low oxygen level diminishes CD8+ T cell anti-viral response in vivo. We reveal that respiratory restriction inhibits ATP-dependent matrix processes that are critical for mitochondrial-biogenesis. This respiratory restriction-mediated effect could be rescued by TCA cycle re-stimulation, which yielded increased mitochondrial matrix-localized ATP via substrate-level phosphorylation. Finally, we demonstrate that the hypoxia-arrested CD8+ T cell anti-viral response could be rescued in vivo through brief exposure to atmospheric oxygen pressure. Overall, these findings elucidate the detrimental effect of hypoxia on mitochondrial-biogenesis in activated CD8+ T cells, and suggest a new approach for reducing viral infections in COPD.
© 2020, Saragovi et al.

Entities:  

Keywords:  CD8 T cells; hypoxia; immunology; inflammation; mitochondria; mouse

Year:  2020        PMID: 33226340      PMCID: PMC7728436          DOI: 10.7554/eLife.56612

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

It is presently unclear exactly how CD8+ T cell response is influenced by systemic oxygen restriction (SOR). This subject is difficult to investigate as it requires the identification of specific metabolic effects within the dynamic system of activated cells in a process of rapid transformation and rewiring (MacIver et al., 2013). This is important field of research, since hypoxemia, reduced blood oxygen saturation, and tissue hypoxia are associated with multiple respiratory and circulatory diseases, including chronic obstructive pulmonary disease (COPD) and congenital heart disease (Kent et al., 2011; Kaskinen et al., 2016; O'Brien and Smith, 1994). Reportedly, such patients also exhibit a higher prevalence of viral infections compared to healthy individuals (Chaw et al., 2020; Kherad et al., 2010). Previous studies have examined how hypoxia affects cell fate determination in fully activated effector T cells (Doedens et al., 2013). Some have found that hypoxic conditions contribute to the formation of long-lasting effector cells (Phan and Goldrath, 2015; Phan et al., 2016). Other studies have demonstrated that respiratory restriction, mediated by inhibition of mitochondrial ATP synthase, arrests T cell activation (Chang et al., 2013). This is particularly interesting because activated T cells undergo an early shift in cell metabolism, in parallel to activation stimuli, switching to aerobic glycolysis to support their expansion and cytotoxic function (Gubser et al., 2013; van der Windt et al., 2013). However, it remains unclear what mechanism underlies the inhibition of T cell activation under hypoxic conditions. In the present study, we explored the effects of chronic systemic hypoxia on CD8+ T cell response. To assess the possible effects of systemic hypoxia in vivo, we challenged mice with a lentivirus under conditions simulating COPD (Yu et al., 1999), and found that low oxygen availability diminished CD8+ T cell response. Similarly, in vitro hypoxic conditions led to complete arrest of CD8+ T cell response, but only marginally inhibited fully activated cells. To further characterize the metabolic mechanism underlying T cell arrest, we used the ATP synthase inhibitor oligomycin, which enables differentiation between indirect and direct effects of respiratory restriction. Incubation with oligomycin at different time-points post-stimuli revealed that after mitochondrial-biogenesis, at ~12 hr post-stimuli, activated CD8+ T cells become independent of oxidative phosphorylation (OXPHOS). Next, to elucidate why CD8+ T cells are sensitive to respiratory restriction prior to mitochondrial-biogenesis, we examined cytoplasmic response to respiratory restriction via metabolic profiling and p-AMPK analysis. This analysis revealed that respiratory restriction prior to mitochondrial-biogenesis had only a marginal effect on cytoplasmic function. Accordingly, the inhibition of mitochondrial ATP transport to the cytoplasm through genetic alteration or pharmacological treatment had little effect on CD8+ T cell activation. In contrast, respiratory restriction prior to T cell mitochondrial-biogenesis, yielded an energetic crisis within the mitochondrial matrix, manifested by dysfunctional mitochondrial RNA processing and protein import. Moreover, oligomycin-treated CD8+ T cells could be rescued using the proton ionophore FCCP, which uncouples the electron transport chain from ATP synthase. Finally, comparative metabolic profiling of oligomycin-treated activated T cells following uncoupler rescue, revealed significantly increased generation of mitochondrial matrix-localized ATP via mitochondria-localized substrate-level phosphorylation. Overall, these findings establish that during early activation, OXPHOS is required primarily to provide ATP for mitochondrial remodeling. By applying these insights to our in vivo model, we demonstrated that the detrimental effects of hypoxia may be alleviated by short oxygen resuscitation.

Results

Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response

Clinical chronic hypoxia is prevalent in multiple respiratory and circulatory diseases, and is associated with increased susceptibility to viral infections (Chaw et al., 2020; Kherad et al., 2010). Here we examined the effects of chronic hypoxia on CD8+ T cell viral response by using a murine chronic hypoxia model (Jain et al., 2016; Figure 1A). Mice were intradermally primed in the ear pinna with an OVA-expressing lentivirus (Lv-OVA) (Furmanov et al., 2013; Furmanov et al., 2010). Twenty-four hours after the viral challenge, the mice were exposed to normal (atmospheric) or low (8%) oxygen levels for an additional 6 days. To evaluate the influence of oxygen levels on CD8+ T cells’ anti-viral response, we assessed the activation and proliferation status of OVA-associated CD8+ T cells (TCR Vα2+) from the deep cervical lymph nodes of the two experimental groups and from naïve mice. We quantified the relative abundance and total numbers of OVA-associated CD8+ T cells presenting established in vivo activation markers, including elevation of hyaluronic acid receptor (CD44) and interleukin-2 receptor alpha chain (CD25), and reduction of L-selectin (CD62L). To evaluate the proliferation status of Ova-associated CD8+ T cells, we also performed intracellular staining for Ki67.
Figure 1.

Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response.

(A) Schematic of the experiment presented in panels B-H. C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 transduction units (TU) of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers for additional 6 days and kept under either 8% or 21% oxygen pressure. Extracted cells from the deep cervical lymph nodes were then analyzed by flow cytometry as follows: TCR Vα2+, CD8+ T cells from naïve mice (left/gray) or Lv-OVA challenged mice that were kept under either atmospheric oxygen pressure (21% O2) (middle/black) or 8% oxygen pressure (right/red). (naïve n = 3 biological replicates, activated n = 6 in each group). (B) Representative flow cytometry plots of CD44 vs. CD62L, numbers indicate the frequencies of CD44+ CD62L- cells. (C) Bar graph quantification of TCR Vα2+, CD8+, CD44+, CD62L- cells (P value * 0.0238, ** 0.0095). (D) Same as in B, focusing on CD25 vs. CD62L. (E) Same as in C focusing on TCR Vα2+, CD8+, CD62L- CD25+ cells. (P value * 0.0238, ** 0.0095). (F) Same as in C, focusing on TCR Vα2+, CD8+, CD62L- CD25+, CD44+ cells. (P value * 0.0238, ** 0.0095). (G) Representative flow cytometry plots of Ki67 vs. FSC gated on TCR Vα2+, CD8+, CD25+ T cells. (H) Bar graph quantification of TCR Vα2+, CD8+, CD25+, Ki67+ cells. (P value * 0.0357, * 0.0159). (I-L) CellTrace-labeled splenocytes were activated with anti-CD3/28 for 72 hr under either 1% or 21% of oxygen. (n = 5 biological replicates). (I) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (J) Bar graph summarizes results in I. (P value * 0.0022). (K) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (L) Bar graph summarizes results in K as Proliferation Index (P. Index). (P value * 0.0022). Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

(A–C) C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers and maintained under 8% or 21% oxygen pressure. Cells from the deep cervical lymph nodes were then extracted and analyzed by flow cytometric analysis. (naïve group n = 3, activated n = 6 in each group) (A) Bar graph of the numbers of TCR Vα2+, CD8+ and CD44+ cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (B) Bar graph of the numbers of TCR Vα2+, CD8+ and CD62L- cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (C) Bar graph of the numbers of TCR Vα2+, CD8+ and CD25+ cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (D-G) CellTrace-labeled PBMCs from human donors were activated with anti-CD3/28 for 72 hr under either 1% or 21% of oxygen pressure. (D) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (E) Bar graph summarizing the results in D. (P value ** 0.0079) (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (G) Bar graph summarizing the results in F as Proliferation Index (P. Index). (P value ** 0.0079). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response.

(A) Schematic of the experiment presented in panels B-H. C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 transduction units (TU) of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers for additional 6 days and kept under either 8% or 21% oxygen pressure. Extracted cells from the deep cervical lymph nodes were then analyzed by flow cytometry as follows: TCR Vα2+, CD8+ T cells from naïve mice (left/gray) or Lv-OVA challenged mice that were kept under either atmospheric oxygen pressure (21% O2) (middle/black) or 8% oxygen pressure (right/red). (naïve n = 3 biological replicates, activated n = 6 in each group). (B) Representative flow cytometry plots of CD44 vs. CD62L, numbers indicate the frequencies of CD44+ CD62L- cells. (C) Bar graph quantification of TCR Vα2+, CD8+, CD44+, CD62L- cells (P value * 0.0238, ** 0.0095). (D) Same as in B, focusing on CD25 vs. CD62L. (E) Same as in C focusing on TCR Vα2+, CD8+, CD62L- CD25+ cells. (P value * 0.0238, ** 0.0095). (F) Same as in C, focusing on TCR Vα2+, CD8+, CD62L- CD25+, CD44+ cells. (P value * 0.0238, ** 0.0095). (G) Representative flow cytometry plots of Ki67 vs. FSC gated on TCR Vα2+, CD8+, CD25+ T cells. (H) Bar graph quantification of TCR Vα2+, CD8+, CD25+, Ki67+ cells. (P value * 0.0357, * 0.0159). (I-L) CellTrace-labeled splenocytes were activated with anti-CD3/28 for 72 hr under either 1% or 21% of oxygen. (n = 5 biological replicates). (I) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (J) Bar graph summarizes results in I. (P value * 0.0022). (K) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (L) Bar graph summarizes results in K as Proliferation Index (P. Index). (P value * 0.0022). Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response.

(A–C) C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers and maintained under 8% or 21% oxygen pressure. Cells from the deep cervical lymph nodes were then extracted and analyzed by flow cytometric analysis. (naïve group n = 3, activated n = 6 in each group) (A) Bar graph of the numbers of TCR Vα2+, CD8+ and CD44+ cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (B) Bar graph of the numbers of TCR Vα2+, CD8+ and CD62L- cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (C) Bar graph of the numbers of TCR Vα2+, CD8+ and CD25+ cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (D-G) CellTrace-labeled PBMCs from human donors were activated with anti-CD3/28 for 72 hr under either 1% or 21% of oxygen pressure. (D) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (E) Bar graph summarizing the results in D. (P value ** 0.0079) (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (G) Bar graph summarizing the results in F as Proliferation Index (P. Index). (P value ** 0.0079). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m. Compared to the control group, the chronic hypoxia mice group showed a marked decrease in the ratios and the total numbers of CD62LCD44+ (Figure 1B–C and Figure 1—figure supplement 1A–B), CD62LCD25+ (Figure 1D–E and Figure 1—figure supplement 1C), and CD62LCD44+ CD25+ (Figure 1F) Ova-associated CD8+ T cells. Moreover, the phenotype of Ova-associated CD8+ T cells from mice challenged under chronic hypoxia was similar to the untreated control. Mice challenged under chronic hypoxia exhibited a 10-fold decrease in Ki67-positive OVA-associated CD8+ T cells compared to mice challenged under atmospheric oxygen levels (Figure 1G–H). These findings suggest that the induction of systemic chronic hypoxia in vivo disrupts the CD8+ T cell response to viral infection.
Figure 1—figure supplement 1.

Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response.

(A–C) C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers and maintained under 8% or 21% oxygen pressure. Cells from the deep cervical lymph nodes were then extracted and analyzed by flow cytometric analysis. (naïve group n = 3, activated n = 6 in each group) (A) Bar graph of the numbers of TCR Vα2+, CD8+ and CD44+ cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (B) Bar graph of the numbers of TCR Vα2+, CD8+ and CD62L- cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (C) Bar graph of the numbers of TCR Vα2+, CD8+ and CD25+ cells from naïve mice (gray) or Lv-OVA challenged mice that were kept under 21% oxygen (black) or 8% oxygen (red). (P value * 0.0238, ** 0.0095) (D-G) CellTrace-labeled PBMCs from human donors were activated with anti-CD3/28 for 72 hr under either 1% or 21% of oxygen pressure. (D) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (E) Bar graph summarizing the results in D. (P value ** 0.0079) (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (G) Bar graph summarizing the results in F as Proliferation Index (P. Index). (P value ** 0.0079). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

To investigate the direct effect of hypoxia on T cell response , we activated spleen-derived lymphocytes in vitro for 72 hr, using a combination of the agonistic antibodies anti-CD3ε and anti-CD28, in an oxygen-deficient (1% O2) environment. In accordance with our in vivo findings and previous reports (Chang et al., 2013), naïve CD8+ T cells (Tn) activated under hypoxic conditions exhibited reduced levels of the in vitro activation marker CD25 (Figure 1I–J) and diminished proliferative capacity (Figure 1K–L) compared to cells activated under atmospheric oxygen levels. Finally, to examine the relevance of our model system to human immunity, we activated human CD8+ T cells under either atmospheric oxygen levels or hypoxic conditions. As expected, and similar to the findings in mouse cells, human CD8+ T cells activated under hypoxic conditions exhibited a marked decrease in surface expression of CD25, and proliferative capacity (Figure 1—figure supplement 1D–G). Together, our findings demonstrate that CD8+ T cell activation is compromised during systemic chronic hypoxia.

Following mitochondrial remodeling, activated CD8+ T cells become tolerant to inhibition of OXPHOS

Next, we aimed to investigate the oxygen-dependent mechanisms governing T cell transition from the naïve to the activated state. It was previously demonstrated that although hypoxia negatively impacts naïve T cell proliferation after activation, it does not significantly impact the proliferation or function of effector T cells. Moreover, some reports show that hypoxia can actually improve effector T cell functions in vivo (Doedens et al., 2013; Gropper et al., 2017; Makino et al., 2003; Vuillefroy de Silly et al., 2016; Xu et al., 2016). These findings suggest that T cells acquire hypoxia tolerance during their activation. Thus, defining the metabolic alterations between hypoxia-sensitive and hypoxia-resistance T cells could elucidate the inhibitory effects of systemic hypoxia on CD8+ T cell activation. To characterize this metabolic transition, CD8+ T cells were activated in vitro and subjected to hypoxia at early (5 hr) and late (18 hr) time-points post-stimuli (Figure 2A). Notably, CD8+ T cells exposed to hypoxia at the early time-point following activation exhibited impaired elevation of CD25 expression and decreased proliferative capacity. These impairments were partially prevented in cells transferred to hypoxic conditions at the late time-point following activation (Figure 2B–E).
Figure 2.

Following mitochondrial remodeling, activated CD8+ T cell become tolerant to inhibition of OXPHOS.

(A) Schematic of experiment presented in panels B-E. CellTrace-labeled splenocytes were activated with anti-CD3/28 and transferred to chambers containing 1% O2 for 5 (middle/red), or 18 hr (right/pink). Cells were then transferred to atmospheric oxygen pressure. Control cells were left in atmospheric oxygen pressure (21% O2), (left/gray). Seventy-two hours post activation, cells were analyzed by flow cytometry. (n = 5 biological replicates). (B) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (C) Bar graph summarizes results in B. (P value ** 0.0043, ** 0.0043). (D) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (E) Bar graph summarizes results in D as Proliferation Index. (P value ** 0.0043, * 0.0173). (F) Schematic of experiment presented in panels G-J. CellTrace-labeled splenocytes were stimulated using anti-CD3/28 and treated with 60 nM oligomycin at the indicated time points post activation. Seventy-two hours post activation cells were analyzed by flow cytometry. (n = 5 biological replicates). (G) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells of control cells (untreated with oligomycin) or cells that were treated with oligomycin at the indicated time points after activation. Numbers indicate the frequencies of CD25+ cells. (H) Bar graph summarizes results in G. (P value ** 0.0079 ** 0.0079 ** 0.0079 ** 0.0079). (I) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from either control cells (front) or cells that were treated with oligomycin at the indicated time after activation. (J) Bar graph summarizes results in I as Proliferation Index. (P value ** 0.0079 ** 0.0079 ** 0.0079 * 0.0317). (K) Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the CD8+ T cell population of naïve cells or cells that were stimulated using anti-CD3/CD28, for 9, 12, 16 or 24 hr from spleens of mito-Dendra2 mice. (L) Bar graph summarizes results in K. (n = 5 biological replicates). (P value * 0.0286). (M) Mouse splenocytes were stimulated using anti-CD3/CD28 for 9 (pink), 12 (red) hours or left untreated (Naïve- gray). CD8+ T cells were then isolated and assayed, by seahorse XF24, for Oxygen Consumption Rate (OCR) following consecutive injections of oligomycin, FCCP, and rotenone plus antimycin (R+A). (n = 5 biological replicates in each group). (N) Bar graph summarizes the spare respiratory capacity (SRC- maximal OCR after FCCP treatment) of the experiment present in M. (P value * 0.0197) Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

(A) Oxygen Consumption Rate (OCR) of isolated naïve CD8+ T cells treated with the indicated oligomycin, FCCP concentrations or left untreated. (n = 5 biological replicates). (B) Bar graph summarizing the results in A as a ratio between OCR pre and post treatment (Relative OCR). (P value ** 0.0072, **0.0018, ****>0.0001) (C) Bar graph summarizing TMRM fluorescence intensity, measured by flow cytometry, of naïve CD8+ T cells that were either treated with the indicated oligomycin concentrations or left untreated. (P value ** 0.0072) (D-G) CellTrace-labeled PBMCs from human donors were activated with anti-CD3/28 for 72 hr in the present or absent of indicated concentrations of oligomycin. (D) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from untreated cells or oligomycin treated cells. Numbers indicate the frequencies of CD25+ cells. (n = 5 biological replicates) (E) Bar graph summarizing the results in (D). (P value ** 0.0072, ** 0.0072). (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from untreated cells (Ctrl) or Oligomycin treated as indicated. (G) Bar graph summarizing the results in F as Proliferation Index. (P value ** 0.0072, * 0.0159) Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

(A) Extra Cellular Acidification Rate (ECAR), measured by seahorse, of Naïve CD8+ T cells (gray), T-Early (red) and T-Late (pink) under basal conditions (BASAL) or oligomycin treatment (Max). Dashed line indicates the time of oligomycin injection. (B) Bar graph summarizing basal ECAR illustrated in A. (n > 5 measurements, P value ****<0.0001) (C) Bar graph summarizing maximal ECAR (after oligomycin treatment) in A. (n > 5 measurements, P value ****<0.0001) (D) Histogram overlay of 2NBDG fluorescence intensity gated on naïve (gray) or activated CD8+ T cells for 9 (dark red-brown), 12 (dark pink), or 24 (light pink) hours. Cells were incubated with 2NBDG for 30 min before flow cytometry analysis. (E-F) Naïve, or 5 hr (T-Early), 24 hr (T-Late) activated (anti-CD3/CD28) CD8+ T cells were incubated for 5 hr and analyzed by LC-MS (n = 5 biological replicates) (E) Heatmap representing the relative amounts of key glycolysis-related metabolites (as indicated) in naïve, T-Early or T-Late. (F) Heatmap representing lactate in the media of naïve, T-Early o T-Late. Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Following mitochondrial remodeling, activated CD8+ T cell become tolerant to inhibition of OXPHOS.

(A) Schematic of experiment presented in panels B-E. CellTrace-labeled splenocytes were activated with anti-CD3/28 and transferred to chambers containing 1% O2 for 5 (middle/red), or 18 hr (right/pink). Cells were then transferred to atmospheric oxygen pressure. Control cells were left in atmospheric oxygen pressure (21% O2), (left/gray). Seventy-two hours post activation, cells were analyzed by flow cytometry. (n = 5 biological replicates). (B) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (C) Bar graph summarizes results in B. (P value ** 0.0043, ** 0.0043). (D) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells. (E) Bar graph summarizes results in D as Proliferation Index. (P value ** 0.0043, * 0.0173). (F) Schematic of experiment presented in panels G-J. CellTrace-labeled splenocytes were stimulated using anti-CD3/28 and treated with 60 nM oligomycin at the indicated time points post activation. Seventy-two hours post activation cells were analyzed by flow cytometry. (n = 5 biological replicates). (G) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells of control cells (untreated with oligomycin) or cells that were treated with oligomycin at the indicated time points after activation. Numbers indicate the frequencies of CD25+ cells. (H) Bar graph summarizes results in G. (P value ** 0.0079 ** 0.0079 ** 0.0079 ** 0.0079). (I) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from either control cells (front) or cells that were treated with oligomycin at the indicated time after activation. (J) Bar graph summarizes results in I as Proliferation Index. (P value ** 0.0079 ** 0.0079 ** 0.0079 * 0.0317). (K) Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the CD8+ T cell population of naïve cells or cells that were stimulated using anti-CD3/CD28, for 9, 12, 16 or 24 hr from spleens of mito-Dendra2 mice. (L) Bar graph summarizes results in K. (n = 5 biological replicates). (P value * 0.0286). (M) Mouse splenocytes were stimulated using anti-CD3/CD28 for 9 (pink), 12 (red) hours or left untreated (Naïve- gray). CD8+ T cells were then isolated and assayed, by seahorse XF24, for Oxygen Consumption Rate (OCR) following consecutive injections of oligomycin, FCCP, and rotenone plus antimycin (R+A). (n = 5 biological replicates in each group). (N) Bar graph summarizes the spare respiratory capacity (SRC- maximal OCR after FCCP treatment) of the experiment present in M. (P value * 0.0197) Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

Oligomycin inhibits CD8+ T cell respiration, activation, and proliferation.

(A) Oxygen Consumption Rate (OCR) of isolated naïve CD8+ T cells treated with the indicated oligomycin, FCCP concentrations or left untreated. (n = 5 biological replicates). (B) Bar graph summarizing the results in A as a ratio between OCR pre and post treatment (Relative OCR). (P value ** 0.0072, **0.0018, ****>0.0001) (C) Bar graph summarizing TMRM fluorescence intensity, measured by flow cytometry, of naïve CD8+ T cells that were either treated with the indicated oligomycin concentrations or left untreated. (P value ** 0.0072) (D-G) CellTrace-labeled PBMCs from human donors were activated with anti-CD3/28 for 72 hr in the present or absent of indicated concentrations of oligomycin. (D) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from untreated cells or oligomycin treated cells. Numbers indicate the frequencies of CD25+ cells. (n = 5 biological replicates) (E) Bar graph summarizing the results in (D). (P value ** 0.0072, ** 0.0072). (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from untreated cells (Ctrl) or Oligomycin treated as indicated. (G) Bar graph summarizing the results in F as Proliferation Index. (P value ** 0.0072, * 0.0159) Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Acquisition of respiratory restriction tolerance is not correlated with increased glycolytic activity.

(A) Extra Cellular Acidification Rate (ECAR), measured by seahorse, of Naïve CD8+ T cells (gray), T-Early (red) and T-Late (pink) under basal conditions (BASAL) or oligomycin treatment (Max). Dashed line indicates the time of oligomycin injection. (B) Bar graph summarizing basal ECAR illustrated in A. (n > 5 measurements, P value ****<0.0001) (C) Bar graph summarizing maximal ECAR (after oligomycin treatment) in A. (n > 5 measurements, P value ****<0.0001) (D) Histogram overlay of 2NBDG fluorescence intensity gated on naïve (gray) or activated CD8+ T cells for 9 (dark red-brown), 12 (dark pink), or 24 (light pink) hours. Cells were incubated with 2NBDG for 30 min before flow cytometry analysis. (E-F) Naïve, or 5 hr (T-Early), 24 hr (T-Late) activated (anti-CD3/CD28) CD8+ T cells were incubated for 5 hr and analyzed by LC-MS (n = 5 biological replicates) (E) Heatmap representing the relative amounts of key glycolysis-related metabolites (as indicated) in naïve, T-Early or T-Late. (F) Heatmap representing lactate in the media of naïve, T-Early o T-Late. Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m. To investigate the hypoxia-mediated inhibitory effect, we used the ATP synthase-specific inhibitor oligomycin, which partially mimics the effect induced by hypoxia , imposing cellular respiratory restriction (Chang et al., 2013; Solaini et al., 2010; Sgarbi et al., 2018). We utilized oligomycin because it provides a simple experimental system to test the immediate effect of respiratory restriction under multiple conditions. Importantly, it enables differentiation between indirect effects mediated by inhibition of the electron transport chain and the TCA cycle (Martínez-Reyes et al., 2016) versus the direct effects caused by reduced mitochondrial ATP (Lee and O’Brien, 2010). Oligomycin titration assays confirmed that 60 nM oligomycin had stable and significant effect on CD8+ T cell respiration, activation, and proliferation (Figure 2—figure supplement 1A–G).
Figure 2—figure supplement 1.

Oligomycin inhibits CD8+ T cell respiration, activation, and proliferation.

(A) Oxygen Consumption Rate (OCR) of isolated naïve CD8+ T cells treated with the indicated oligomycin, FCCP concentrations or left untreated. (n = 5 biological replicates). (B) Bar graph summarizing the results in A as a ratio between OCR pre and post treatment (Relative OCR). (P value ** 0.0072, **0.0018, ****>0.0001) (C) Bar graph summarizing TMRM fluorescence intensity, measured by flow cytometry, of naïve CD8+ T cells that were either treated with the indicated oligomycin concentrations or left untreated. (P value ** 0.0072) (D-G) CellTrace-labeled PBMCs from human donors were activated with anti-CD3/28 for 72 hr in the present or absent of indicated concentrations of oligomycin. (D) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from untreated cells or oligomycin treated cells. Numbers indicate the frequencies of CD25+ cells. (n = 5 biological replicates) (E) Bar graph summarizing the results in (D). (P value ** 0.0072, ** 0.0072). (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from untreated cells (Ctrl) or Oligomycin treated as indicated. (G) Bar graph summarizing the results in F as Proliferation Index. (P value ** 0.0072, * 0.0159) Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

To pin-point the development of tolerance to respiratory restriction, we examined CD8+ T cell response following oligomycin treatment at multiple time-points post-stimuli (Figure 2F). Activated CD8+ T cells treated with oligomycin at time-points earlier than 9 hr post-stimuli (T-Early) showed decreased CD25 expression and proliferation. However, when oligomycin was added at time-points later than 12 hr post-stimuli (T-Late), we observed a significant increase of CD25 expression and proliferation (Figure 2G–J). Taken together, these observations suggest a gradual metabolic rewiring process that promotes the development of a metabolic bypass of respiratory restriction in T-Late. Glycolysis, the degradation of glucose to pyruvate/lactate, allows cellular ATP generation independent of oxygen concentrations (Lunt and Vander Heiden, 2011). Here we tested whether the cellular capacity to perform glycolysis is correlated with the acquisition of tolerance to respiratory restriction during CD8+ T cell activation. To account for variances in glycolysis (Gubser et al., 2013; van der Windt et al., 2013), we assessed the extracellular acidification rate (ECAR) of Tn, T-Early, and T-Late using the seahorse methodology. Interestingly, both basal ECAR (without oligomycin treatment) and maximal ECAR (with oligomycin treatment) were comparable between T-Early and T-Late, and these rates were elevated with respect to Tn (Figure 2—figure supplement 2A–C). To test whether the glucose-uptake rates differed between early and late activation, we incubated CD8+ T cells with the fluorescent glucose-uptake probe 2-deoxy-2-D-glucose (2-NBDG) at different time-points post-stimuli, and then used flow cytometry to analyze their glucose uptake. The glucose-uptake rate did not substantially differ between Tn and the CD8+ T cells activated for 6, 9, or 12 hr (Figure 2—figure supplement 2D). At a later stage of the activation, 24 hr post-stimuli, we observed a considerable increase in the amount of glucose uptake.
Figure 2—figure supplement 2.

Acquisition of respiratory restriction tolerance is not correlated with increased glycolytic activity.

(A) Extra Cellular Acidification Rate (ECAR), measured by seahorse, of Naïve CD8+ T cells (gray), T-Early (red) and T-Late (pink) under basal conditions (BASAL) or oligomycin treatment (Max). Dashed line indicates the time of oligomycin injection. (B) Bar graph summarizing basal ECAR illustrated in A. (n > 5 measurements, P value ****<0.0001) (C) Bar graph summarizing maximal ECAR (after oligomycin treatment) in A. (n > 5 measurements, P value ****<0.0001) (D) Histogram overlay of 2NBDG fluorescence intensity gated on naïve (gray) or activated CD8+ T cells for 9 (dark red-brown), 12 (dark pink), or 24 (light pink) hours. Cells were incubated with 2NBDG for 30 min before flow cytometry analysis. (E-F) Naïve, or 5 hr (T-Early), 24 hr (T-Late) activated (anti-CD3/CD28) CD8+ T cells were incubated for 5 hr and analyzed by LC-MS (n = 5 biological replicates) (E) Heatmap representing the relative amounts of key glycolysis-related metabolites (as indicated) in naïve, T-Early or T-Late. (F) Heatmap representing lactate in the media of naïve, T-Early o T-Late. Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Metabolic analysis of naïve, T-Early, and T-Late cells revealed significantly altered concentrations of key glycolysis-related metabolites in both T-Early and T-Late cells with respect to Tn (Figure 2—figure supplement 2E–F). Specifically, T-Early exhibited higher levels of intracellular glucose 6-phosphate (G6P), and reduced glucose levels (Figure 2—figure supplement 2E). Similarly, the secreted lactate concentration was substantially elevated in T-Early compared to Tn (Figure 2—figure supplement 2F). In contrast, glycolysis-related metabolites did not significantly differ between T-Late and T-Early cells (Figure 2—figure supplement 2E–F). Collectively, our observations demonstrate that stimulated CD8+ T cells exhibited a marked increase of glycolytic metabolism at least 9 hr before they acquired tolerance to respiratory restriction. These findings indicate that the development of tolerance to respiratory restriction is not correlated with increased glycolytic activity. Previous reports show that mitochondria undergo robust biogenesis and extensive metabolic rewiring at ~12 hr after T cell activation (Rambold and Pearce, 2018; Ron-Harel et al., 2016). To determine whether mitochondrial-biogenesis correlates with the acquisition of tolerance to respiratory restriction, we measured the kinetics of mitochondrial-biogenesis during CD8+ T cell activation in our model system. Stimulated CD8+ T cells derived from mitochondria-labeled mtDendra2 mice (Pham et al., 2012) showed a substantial increase of mitochondrial mass at 12 hr post-stimuli, correlating with CD8+ T cell acquisition of tolerance to respiratory restriction (Figure 2K–L). Likewise T-Late cells exhibited a significant increase in spare respiratory capacity in comparison to T-Early (Figure 2M–N). Thus, upon CD8+ T cell activation, the development of tolerance to respiratory restriction is correlated with a gain of mitochondrial biomass linked to mitochondrial rewiring (Ron-Harel et al., 2016).

Respiratory restriction has only a marginal effect on cytoplasmic function during early activation

The inhibitory effect mediated by respiratory restriction during CD8+ T cell activation could be caused by reduced mitochondrial ATP (Lee and O’Brien, 2010) and increased AMP-related signaling (Araki et al., 2009; Pearce et al., 2009; Araki et al., 2009; Pearce et al., 2009). Therefore, we next investigated whether respiratory-restriction results in increased AMP-related signaling. To assess how respiratory restriction influences the levels of different phospho-nucleotides, we examined the metabolic profiles of oligomycin-treated T-Early and T-Late cells compared to untreated controls. As expected, oligomycin treatment yielded a marked increase of mono/di-phospho-nucleotides at the expense of tri-phospho-nucleotides in T-Early cells (Figure 3A). A similar effect was observed in hypoxia-resilient T-Late cells exposed to oligomycin (Figure 3B), suggesting that activated CD8+ T cells may function under increased AMP levels.
Figure 3.

Respiratory restriction has only marginal effect on cytoplasmic function during early activation.

(A) Heatmap showing relative amounts of key energy-related metabolites (as indicated in the figure) extracted from CD8+ T cells activated for 5 hr using anti-CD3/28 (T-Early) oligomycin treated or untreated (Ctrl). (B) Same as in A, extracted from CD8+ T cells activated for 24 hr using anti-CD3/28 (T-Late). (C) Splenocytes were stimulated using anti-CD3/28 for 9 hr (T-Early), 12 hr (T-Late) or left untreated (Naïve- gray). Cells were then treated with 300 nM oligomycin or left untreated for 1 hr. Protein extract from isolated CD8+ T cells from all samples were then subjected for immunoblot analysis using anti p-AMPKα or anti AMPKα. (n = 3 experiments). (D-G) CellTrace-labeled splenocytes from WT or LCK-cre/Slc25a5floxp (ANT2ko) mice were stimulated using anti-CD3/CD28, with or without 60 nM oligomycin. Seventy-two hours post activation cells were analyzed by flow cytometry (n = 5 biological replicates). (D) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from wild-type mice (WT- left) or ANT2ko mice untreated or treated with 60 nM oligomycin (middle and right panels respectively). Numbers indicate the frequencies of CD25+ cells. (E) Bar graph summarizes results in D. (P value ** 0.0079). (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from either WT cells (front) or ANTko cells that were untreated (middle) or treated with oligomycin (back). (G) Bar graph summarizing the results in F as proliferation index. (P value ** 0.0079). (H-K) CellTrace-labeled splenocytes from WT mice were stimulated using anti-CD3/CD28, in the presence of the indicated concentrations of the pan-ANT inhibitor, bongkrekic acid. Seventy-two hours post activation cells were analyzed by flow cytometry analysis. (n = 5 biological replicates). (H) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from WT splenocytes untreated or treated with the indicated concentrations of bongkrekic acid. Numbers indicate the frequencies of CD25+ cells. (I) Bar graph summarizing the results in H. (J) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells that were either untreated or treated with the indicated concentrations of bongkrekic acid. (K) Bar graph summarizing the results in J as proliferation index. Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

(A) Label-free quantification (LFQ) of ANT1 relatively to the LFQ of ANT2 in naïve CD8+ T cells measured by MS analysis.(n = 5 mice grouped into six replicates, P value ****<0.0001). (B) Flow cytometry overlay histogram of TMRM intensity in CD8+ T cells from wt or LCK-cre/ANT2floxp (ANT2ko) mice (n = 3 biological replicates). (C) Flow cytometry overlay histogram of TMRM intensity in CD8+ T cells from WT mice that were either untreated or treated with 1 µM Bongkrekic acid for 3 hr (n = 5 biological replicates). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Respiratory restriction has only marginal effect on cytoplasmic function during early activation.

(A) Heatmap showing relative amounts of key energy-related metabolites (as indicated in the figure) extracted from CD8+ T cells activated for 5 hr using anti-CD3/28 (T-Early) oligomycin treated or untreated (Ctrl). (B) Same as in A, extracted from CD8+ T cells activated for 24 hr using anti-CD3/28 (T-Late). (C) Splenocytes were stimulated using anti-CD3/28 for 9 hr (T-Early), 12 hr (T-Late) or left untreated (Naïve- gray). Cells were then treated with 300 nM oligomycin or left untreated for 1 hr. Protein extract from isolated CD8+ T cells from all samples were then subjected for immunoblot analysis using anti p-AMPKα or anti AMPKα. (n = 3 experiments). (D-G) CellTrace-labeled splenocytes from WT or LCK-cre/Slc25a5floxp (ANT2ko) mice were stimulated using anti-CD3/CD28, with or without 60 nM oligomycin. Seventy-two hours post activation cells were analyzed by flow cytometry (n = 5 biological replicates). (D) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from wild-type mice (WT- left) or ANT2ko mice untreated or treated with 60 nM oligomycin (middle and right panels respectively). Numbers indicate the frequencies of CD25+ cells. (E) Bar graph summarizes results in D. (P value ** 0.0079). (F) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from either WT cells (front) or ANTko cells that were untreated (middle) or treated with oligomycin (back). (G) Bar graph summarizing the results in F as proliferation index. (P value ** 0.0079). (H-K) CellTrace-labeled splenocytes from WT mice were stimulated using anti-CD3/CD28, in the presence of the indicated concentrations of the pan-ANT inhibitor, bongkrekic acid. Seventy-two hours post activation cells were analyzed by flow cytometry analysis. (n = 5 biological replicates). (H) Representative Flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from WT splenocytes untreated or treated with the indicated concentrations of bongkrekic acid. Numbers indicate the frequencies of CD25+ cells. (I) Bar graph summarizing the results in H. (J) Representative Flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells that were either untreated or treated with the indicated concentrations of bongkrekic acid. (K) Bar graph summarizing the results in J as proliferation index. Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

Inhibition of ANT2 leads to increased mitochondrial membrane polarization in CD8+ T cells.

(A) Label-free quantification (LFQ) of ANT1 relatively to the LFQ of ANT2 in naïve CD8+ T cells measured by MS analysis.(n = 5 mice grouped into six replicates, P value ****<0.0001). (B) Flow cytometry overlay histogram of TMRM intensity in CD8+ T cells from wt or LCK-cre/ANT2floxp (ANT2ko) mice (n = 3 biological replicates). (C) Flow cytometry overlay histogram of TMRM intensity in CD8+ T cells from WT mice that were either untreated or treated with 1 µM Bongkrekic acid for 3 hr (n = 5 biological replicates). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m. We further evaluated the levels at which oligomycin-induced changes in the phospho-nucleotide profile affects cellular energy sensing, by examining the activation levels of AMP-related signaling. To this end, we measured the level of phosphorylated AMP-activated protein kinase (p-AMPK) as a marker for AMPK activation, which is a cytoplasmic sensor for energy homeostasis, in both T-Early and T-Late cells. Treatment with oligomycin, which is the typical positive control for AMPK activation, markedly increased the p-AMPK levels in treated naïve T cells. Interestingly following activation oligomycin only marginally increased the level of p-AMPK in respect to untreated activated control. Importantly, the response to oligomycin was comparable between T-Early and T-Late cells (Figure 3C). Together, these results suggest that despite the important role of AMPK signaling in T cell metabolic adaptation (Blagih et al., 2015), it is not correlated with the inhibitory effects mediated by respiratory restriction in early activation. Further, the respiratory dependence during early T cell activation is not caused by an altered cellular response to reduced AMP levels in the cytoplasm. Our findings to this point imply that activated CD8+ T cells have a unique capacity to avoid p-AMPK signaling in the presence of elevated AMP levels. To support these findings, we tested how depleting mitochondrial ATP from CD8+ T cells’ cytoplasmic compartment affects their activation. To investigate this possibility, we generated T cell-specific adenine nucleotide translocator 2 (ANT2 is encoded by the Slc25a5 gene) knockout mice (refer to as ANT2ko) (Cho et al., 2017; Cho et al., 2015). ANT2 is the dominant ADP/ATP translocator in murine CD8+ T cells, constituting approximately 90% of the total ANT protein (Figure 3—figure supplement 1A). Importantly, ANT2ko CD8+ T cells displayed substantially increased mitochondrial membrane polarization (Figure 3—figure supplement 1B), indicating a decreased matrix ADP concentration.
Figure 3—figure supplement 1.

Inhibition of ANT2 leads to increased mitochondrial membrane polarization in CD8+ T cells.

(A) Label-free quantification (LFQ) of ANT1 relatively to the LFQ of ANT2 in naïve CD8+ T cells measured by MS analysis.(n = 5 mice grouped into six replicates, P value ****<0.0001). (B) Flow cytometry overlay histogram of TMRM intensity in CD8+ T cells from wt or LCK-cre/ANT2floxp (ANT2ko) mice (n = 3 biological replicates). (C) Flow cytometry overlay histogram of TMRM intensity in CD8+ T cells from WT mice that were either untreated or treated with 1 µM Bongkrekic acid for 3 hr (n = 5 biological replicates). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

To determine whether T cell-specific ANT2 deletion affected T cell activation, we examined the ANT2ko-derived CD8+ T cells' response to stimuli. Surprisingly, ANT2-deficient T cells exhibited intact activation-induced CD25 expression (Figure 3D–E) and robust proliferative capacity (Figure 3F–G). Notably, the ANT2ko-derived CD8+ T cells were still sensitive to respiratory restriction during early activation (Figure 3D–G). T cell-specific ANT2 deletion provides a model of chronic restriction of mitochondrial ATP in the cytoplasm. To account for any compensatory effects that may have developed in these mice over time, and to observe the influence of acute mitochondrial ATP restriction to the cytoplasm, we treated activated CD8+ T cells with increasing doses of the pan-ANT inhibitor bongkrekic acid (Anwar et al., 2017). CD8+ T cells stimulated in the presence of bongkrekic acid, at concentrations that increase mitochondrial membrane polarization (Figure 3—figure supplement 1C), exhibited an increase of CD25 surface expression (Figure 3H–I) and proliferation patterns (Figure 3J–K) that were similar to the untreated control group. These key observations illustrate that ATP generated by mitochondrial respiration is not required for cytoplasmic function of activated CD8+ T cell. Furthermore, our results suggest that an upstream respiratory-restriction-coupled effect is a limiting factor underlying CD8+ T cells’ sensitivity to respiratory restriction during early activation.

Respiratory restriction leads to energetic crisis within the matrix compartment in early activated CD8+ T cells

Mitochondrial-biogenesis and rewiring are critical checkpoints in T cell activation (Ron-Harel et al., 2016; Rambold and Pearce, 2018). These cellular processes rely on the availability of matrix-bond ATP, which is generated by substrate-level phosphorylation, the metabolism of succinyl-CoA to succinate in the TCA cycle (Schwimmer et al., 2005; Chinopoulos et al., 2010; Bochud-Allemann and Schneider, 2002). Therefore, we next examined whether respiratory restriction affects mitochondrial-biogenesis via an upstream effect. As expected, mtDendra2-derived T-Early cells transferred to a hypoxic chamber exhibited reduced CD25 expression (Figure 4A–B). Importantly, T-Early cells from the hypoxia group showed significantly reduced mtDendra2 expression (Figure 4C–D). Similarly, oligomycin treatment during early activation of CD8+ T cells abrogated activation (Figure 4E–F) and inhibited the increase of mitochondrial mass that was observed in control mtDendra2-derived CD8+ T cells (Figure 4G–H). Interestingly, we observed substantially higher mtDendra2 expression in proliferating T-Late cells compared to undivided T-Late cells (Figure 4I), suggesting that respiratory restriction inhibits activation by disrupting mitochondrial-biogenesis.
Figure 4.

Respiratory restriction leads to energetic crisis within the matrix compartment in early activated CD8+ T cell.

(A-D) Splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 for 5 hr and then transferred to a chamber containing 1% O2 or left in atmospheric oxygen pressure (21% O2). Twenty-four hours post activation cells were analyzed by flow cytometry. (A) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (B) Bar graph summarizing the results in A. (P value ** 0.0079 ** 0.0079). (C) Representative Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the CD8+ T cells from Naïve (front), activated in 21% O2 (middle), or activated in 1% O2 (back) cells. (D) Bar graph summarizing the results in C, Dendra2 mean fluorescence intensity (MFI). (P value ** 0.0079 ** 0.0079). (E-H) Splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 and treated with 60 nM oligomycin at 9 hr (T-Early) or 12 hr (T-Late) following activation. Twenty-four hours post activation cells were analyzed by flow cytometry. (E) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (F) Bar graph summarizing the results in E. (P value ** 0.0079 ** 0.0079). (G) Representative Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the CD8+ T cells from either oligomycin untreated (front), oligomycin treated T-Early (middle) or oligomycin treated T-Late (back). (P value ** 0.0079 ** 0.0079). (H) Bar graph summarizing the results in G, Dendra2 mean fluorescence intensity (MFI). (P value ** 0.0079 ** 0.0079). (I) CellTrace-labeled splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 and treated with 60 nM oligomycin 12 hr (T-Late) after activation. Seventy-four hours post activation cells were analyzed by flow cytometry. Figure shows Representative Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the undivided (highest CellTrace intensity- front) and divided (low CellTrace intensity) CD8+ T cell populations. (J) Schematic of typical mitochondrial transcription, describing the transcription of ribosomal polycistronic mitochondrial RNA (unpmt-Rnr, dark red line) from the mitochondrial DNA heavy strand (H, red dotted line), and its processing to mt-Rnr1 (bold black line) and mt-Rnr2 (bold orange line). (K-L) Splenocytes were stimulated using anti CD3/CD28 for 9, 12 and 24 hr. Cells were then treated with oligomycin for one hour or left untreated. Total RNA was extracted from isolated CD8+ T cells and assayed using qRT-PCR. Primers were designed to amplify either the unprocessed mt-Rnr transcript (unpmt-Rnr) or its two processed products, mt-Rnr1 and mt-Rnr2. (K) Relative expression of the unpmt-Rnr. (P value ** 0.0022 ** 0.0095). (L) Ratio between the relative expression of unpmt-Rnr and mt-Rnr1. (n = 6 biological replicates). (P value ** 0.0043 ** 0.0079 ** 0.0087). (M-N) Splenocytes were stimulated using anti-CD3/CD28 for 9 or 12 hr. One hour prior to CD8+ T cells isolation, cells were treated with oligomycin or left untreated. Protein extracts from isolated CD8+ T cells were then subjected to immunoprecipitation (IP) using anti-ubiquitin antibody. IP extracts were analyzed by MS focusing on mitochondrial proteins and mitochondrial leader peptides. (n = 3 biological replicates). (M) Volcano plot of precipitated proteins detected by the MS analysis in oligomycin treated and untreated samples (9 hr, T-Early). (N) Volcano plot of precipitated proteins detected by the MS analysis in oligomycin treated and untreated samples (12 hr, T-Late). Statistical method, (A-L) non-parametric Mann–Whitney test, mean ± s.e.m, (M-N) False Discovery Rate (FDR) P value < 0.05.

A) Splenocytes were stimulated using anti CD3/CD28 for 9, 12 and 24 hr. Cells were then treated with oligomycin for one hour or left untreated. Isolated CD8+ T cells were then analyzed using qRT-PCR for unprocessed mt-Rnr transcript (unpmt-Rnr) and its two processed products, mt-Rnr1 and mt-Rnr2. Figure shows ratio between the relative expression of unpmt-Rnr and mt-Rnr1. (n = 6 biological replicates, P value ** 0.0022 ** 0.0043 ** 0.0095). (B) Schematic describing the way matrix ATP deficiency leads to accumulation of ubiquitinated mitochondrial matrix-localized proteins and pre-proteins. (C-D) Splenocytes were stimulated using anti CD3/CD28 for 9 or 12 hr (T-Early and T-Late respectively). One hour prior to CD8+ T cells isolation, cells were treated with oligomycin or left untreated. Protein extracts from isolated CD8+ T cells were then subjected to immunoprecipitation using anti-ubiquitin antibody. Sample analysis was performed by MS focusing on leader peptides. (C) Table shows sequences of leader peptides and their corresponding proteins identified in T-Early and T-Late in respect to untreated samples. (D) Comparison of the presence of leader peptides identified in T-Early and T-Late. Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Respiratory restriction leads to energetic crisis within the matrix compartment in early activated CD8+ T cell.

(A-D) Splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 for 5 hr and then transferred to a chamber containing 1% O2 or left in atmospheric oxygen pressure (21% O2). Twenty-four hours post activation cells were analyzed by flow cytometry. (A) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (B) Bar graph summarizing the results in A. (P value ** 0.0079 ** 0.0079). (C) Representative Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the CD8+ T cells from Naïve (front), activated in 21% O2 (middle), or activated in 1% O2 (back) cells. (D) Bar graph summarizing the results in C, Dendra2 mean fluorescence intensity (MFI). (P value ** 0.0079 ** 0.0079). (E-H) Splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 and treated with 60 nM oligomycin at 9 hr (T-Early) or 12 hr (T-Late) following activation. Twenty-four hours post activation cells were analyzed by flow cytometry. (E) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (F) Bar graph summarizing the results in E. (P value ** 0.0079 ** 0.0079). (G) Representative Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the CD8+ T cells from either oligomycin untreated (front), oligomycin treated T-Early (middle) or oligomycin treated T-Late (back). (P value ** 0.0079 ** 0.0079). (H) Bar graph summarizing the results in G, Dendra2 mean fluorescence intensity (MFI). (P value ** 0.0079 ** 0.0079). (I) CellTrace-labeled splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 and treated with 60 nM oligomycin 12 hr (T-Late) after activation. Seventy-four hours post activation cells were analyzed by flow cytometry. Figure shows Representative Flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the undivided (highest CellTrace intensity- front) and divided (low CellTrace intensity) CD8+ T cell populations. (J) Schematic of typical mitochondrial transcription, describing the transcription of ribosomal polycistronic mitochondrial RNA (unpmt-Rnr, dark red line) from the mitochondrial DNA heavy strand (H, red dotted line), and its processing to mt-Rnr1 (bold black line) and mt-Rnr2 (bold orange line). (K-L) Splenocytes were stimulated using anti CD3/CD28 for 9, 12 and 24 hr. Cells were then treated with oligomycin for one hour or left untreated. Total RNA was extracted from isolated CD8+ T cells and assayed using qRT-PCR. Primers were designed to amplify either the unprocessed mt-Rnr transcript (unpmt-Rnr) or its two processed products, mt-Rnr1 and mt-Rnr2. (K) Relative expression of the unpmt-Rnr. (P value ** 0.0022 ** 0.0095). (L) Ratio between the relative expression of unpmt-Rnr and mt-Rnr1. (n = 6 biological replicates). (P value ** 0.0043 ** 0.0079 ** 0.0087). (M-N) Splenocytes were stimulated using anti-CD3/CD28 for 9 or 12 hr. One hour prior to CD8+ T cells isolation, cells were treated with oligomycin or left untreated. Protein extracts from isolated CD8+ T cells were then subjected to immunoprecipitation (IP) using anti-ubiquitin antibody. IP extracts were analyzed by MS focusing on mitochondrial proteins and mitochondrial leader peptides. (n = 3 biological replicates). (M) Volcano plot of precipitated proteins detected by the MS analysis in oligomycin treated and untreated samples (9 hr, T-Early). (N) Volcano plot of precipitated proteins detected by the MS analysis in oligomycin treated and untreated samples (12 hr, T-Late). Statistical method, (A-L) non-parametric Mann–Whitney test, mean ± s.e.m, (M-N) False Discovery Rate (FDR) P value < 0.05.

Respiratory restriction induces an energetic crisis within the matrix compartment in early activated CD8+ T Cell.

A) Splenocytes were stimulated using anti CD3/CD28 for 9, 12 and 24 hr. Cells were then treated with oligomycin for one hour or left untreated. Isolated CD8+ T cells were then analyzed using qRT-PCR for unprocessed mt-Rnr transcript (unpmt-Rnr) and its two processed products, mt-Rnr1 and mt-Rnr2. Figure shows ratio between the relative expression of unpmt-Rnr and mt-Rnr1. (n = 6 biological replicates, P value ** 0.0022 ** 0.0043 ** 0.0095). (B) Schematic describing the way matrix ATP deficiency leads to accumulation of ubiquitinated mitochondrial matrix-localized proteins and pre-proteins. (C-D) Splenocytes were stimulated using anti CD3/CD28 for 9 or 12 hr (T-Early and T-Late respectively). One hour prior to CD8+ T cells isolation, cells were treated with oligomycin or left untreated. Protein extracts from isolated CD8+ T cells were then subjected to immunoprecipitation using anti-ubiquitin antibody. Sample analysis was performed by MS focusing on leader peptides. (C) Table shows sequences of leader peptides and their corresponding proteins identified in T-Early and T-Late in respect to untreated samples. (D) Comparison of the presence of leader peptides identified in T-Early and T-Late. Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m. Next, we investigated whether respiratory restriction leads to an energetic crisis within the mitochondrial matrix. We applied a functional approach to determine whether acute respiratory restriction disturbs ATP-dependent processes within the matrix (Supplementary file 1). We focused on two processes; (1) protein import, in which mitochondria-localized pre-proteins contain a leader sequence that is cleaved and removed upon matrix entry (Pfanner et al., 2019; Wiedemann and Pfanner, 2017; Chacinska et al., 2009-), and (2) processing of the polycistronic mitochondrial RNA that encodes the 12S and 16S ribosomal RNAs (Rnr1 and Rnr2) (Tu and Barrientos, 2015; Wang et al., 2010; Buck et al., 2016). To evaluate whether respiratory restriction promotes disturbance in matrix-localized RNA processing, we quantified the relative expression levels of unprocessed Rnr polycistronic mitochondrial RNA (unpmt-Rnr), as well as the ratio between unpmt-Rnr and its processed products, Rnr1 and Rnr2 (Figure 4J; Rackham et al., 2016). Oligomycin treatment yielded markedly increased unpmt-Rnr levels in T-Early cells but not in T-Late cells (Figure 4K). Accordingly, we found that the ratios between unpmt-Rnr and its cleaved products, Rnr1 or Rnr2, were further increased in oligomycin-treated T-Early cells compared to T-Late cells (Figure 4L and Figure 4—figure supplement 1A).
Figure 4—figure supplement 1.

Respiratory restriction induces an energetic crisis within the matrix compartment in early activated CD8+ T Cell.

A) Splenocytes were stimulated using anti CD3/CD28 for 9, 12 and 24 hr. Cells were then treated with oligomycin for one hour or left untreated. Isolated CD8+ T cells were then analyzed using qRT-PCR for unprocessed mt-Rnr transcript (unpmt-Rnr) and its two processed products, mt-Rnr1 and mt-Rnr2. Figure shows ratio between the relative expression of unpmt-Rnr and mt-Rnr1. (n = 6 biological replicates, P value ** 0.0022 ** 0.0043 ** 0.0095). (B) Schematic describing the way matrix ATP deficiency leads to accumulation of ubiquitinated mitochondrial matrix-localized proteins and pre-proteins. (C-D) Splenocytes were stimulated using anti CD3/CD28 for 9 or 12 hr (T-Early and T-Late respectively). One hour prior to CD8+ T cells isolation, cells were treated with oligomycin or left untreated. Protein extracts from isolated CD8+ T cells were then subjected to immunoprecipitation using anti-ubiquitin antibody. Sample analysis was performed by MS focusing on leader peptides. (C) Table shows sequences of leader peptides and their corresponding proteins identified in T-Early and T-Late in respect to untreated samples. (D) Comparison of the presence of leader peptides identified in T-Early and T-Late. Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

During matrix ATP deficiency, the protein import machinery cannot pull nuclear-encoded matrix proteins. This protein import disturbance causes matrix proteins to misfold in the cytoplasm, leading to their degradation via the ubiquitin-proteasome pathway (Chacinska et al., 2009; Figure 4—figure supplement 1B). Therefore, we next assessed whether respiratory restriction also resulted in the accumulation of ubiquitinated mitochondrial matrix proteins and, specifically, ubiquitinated matrix pre-proteins. T-Late and T-Early cells were treated with oligomycin or left untreated for 1 hr. Then protein extracts from all samples were subjected to immunoprecipitation using anti-ubiquitin antibody, and assayed using mass spectrometry. As expected, in T-Early cells, acute oligomycin treatment significantly increased the amounts of at least two central matrix proteins when compared to controls without oligomycin treatment. Specifically, T-Early cells exhibited increased abundances of ubiquitinated mitochondrial transcription factor A (TFAM) and the CH60 chaperone, which plays a role in the folding and assembly of newly imported proteins in the mitochondria. In line with the partial tolerance to oligomycin observed during late activation, oligomycin-treated T-Late cells showed no substantial increase in ubiquitinated matrix proteins compared to untreated controls (Figure 4M-N and its source data). Importantly, in all groups, the oligomycin-treated samples and controls did not significantly differ in the amounts of the mitochondrial inner-membrane proteins ANT2, ANT1, and CYC1, which do not require matrix ATP for mitochondrial localization. Furthermore, in samples from oligomycin-treated T-Early cells, we detected leader peptides of several mitochondrial proteins whose mitochondrial import depends on matrix ATP (Figure 4—figure supplement 1C-D). In contrast, no relevant leader peptides were detected in any of the untreated samples or in the oligomycin-treated T-Late samples (Figure 4—figure supplement 1C-D). Taken together, these results reveal a matrix-specific energetic crisis following oligomycin mediated respiratory restriction during early CD8+ T cell activation, and suggest that inhibition of TCA cycle and substrate-level phosphorylation may be the central inhibitory mechanism of respiratory restriction.

FCCP treatment rescues respiratory-restricted CD8+ T cells by stimulating matrix-localized substrate-level phosphorylation, elevating ATP, and reducing AMP/GMP concentrations

TCA-linked substrate-level phosphorylation is thought to fuel mitochondrial matrix activity, while ATP synthase-derived ATP is exported to the cytoplasm (Schwimmer et al., 2005; Bochud-Allemann and Schneider, 2002). Oligomycin may indirectly lead to TCA cycle congestion, accumulation of intermediate metabolites, and blockade of matrix-based substrate-level phosphorylation. In this case, the addition of uncouplers to respiratory ATP-deprived T-Early cells could rescue the activation phenotype via TCA cycle stimulation (Figure 5—figure supplement 1). Therefore, we first attempted to rescue oligomycin-treated CD8+ T cells by uncoupling the respiratory chain using an effective concentration of trifluoromethoxy carbonylcyanide phenylhydrazone (FCCP), which is a potent uncoupler of oxidative phosphorylation in mitochondria. T-Early cells were treated with oligomycin, FCCP, both oligomycin and FCCP, or were left untreated. As expected, oligomycin treatment during early activation arrested CD8+ T cell proliferation. FCCP treatment alone slightly inhibited CD8+ T cell proliferation compared to control. Strikingly, treatment of stimulated CD8+ T cells with both oligomycin and FCCP led to an almost complete rescue of CD25 expression (Figure 5A-B) and proliferation (Figure 5C-D) compared to the cells treated with only oligomycin. These key observations demonstrate that uncoupling the respiratory chain from ATP synthase rescues the respiratory-restricted T-Early cells, suggesting that the inhibitory mechanism that follows respiratory restriction is linked to a decrease in ATP concentration in the matrix compartment.
Figure 5—figure supplement 1.

Schematic of the suggested model; respiratory restriction through inhibition of complex V by oligomycin leads to increase in mitochondrial membrane potential and decreased electron flow.

(Top) Decreased electron flow leads to inhibition of TCA cycle and substrate-level phosphorylation since that these processes are coupled. (Bottom) Schematic of the suggested model for rescuing respiration restricted primed CD8+ T cells. FCCP treatment decreases mitochondrial membrane potential which allows both electrons and the TCA cycle to reflow, restores GTP/ATP production in the matrix by the substrate-level phosphorylation.

Figure 5.

FCCP treatment rescues respiratory-restricted CD8+ T cells by stimulating matrix-localized substrate-level phosphorylation, elevating ATP, and reducing AMP/GMP concentrations.

(A-D) CellTrace-labeled splenocytes were stimulated using anti-CD3/28. Nine hours post activation cells were left untreated or treated with 1 μM FCCP, 60 nM oligomycin or with a combination of FCCP and oligomycin. Seventy-two hours post activation cells were analyzed by flow cytometry. (n = 5 biological replicates). (A) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from untreated cells (left), FCCP treated (second from left), Oligomycin treated (third from left), or Oligomycin and FCCP treated (left). Numbers indicate the frequencies of CD25+ cells. (B) Bar graph summarizing the results in B. (P value ** 0.0079 ** 0.0079 ** 0.0079). (C) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from untreated cells (black), FCCP treated (blue), oligomycin treated (dark red-brown), or oligomycin and FCCP treated (red stripes). (D) Bar graph summarizing the results in DC as proliferation index. (P value ** 0.0079 ** 0.0079 ** 0.0079). (E-G) CD8+ T cells were activated with anti-CD3/CD28. Five hours post activation (T-Early), cells were treated for 3 hr with media containing 13C-glutamine only, 13C-glutamine with oligomycin, or 13C-glutamine with oligomycin plus FCCP. Cell extracts were then subjected for metabolome analysis. (n = 7 biological replicates). (E) Heatmap showing relative amounts of key energy-related metabolites (as indicated in the figure) measured in T-Early cells that were treated with oligomycin or oligomycin plus FCCP. (F) Volcano plot of all analyzed metabolites measured in T-Early cells treated with oligomycin or oligomycin plus FCCP. (G) 13C-glutamine LC-MS tracing analysis of CD8+ T cells that either were untreated or treated with oligomycin, or oligomycin plus FCCP. Heatmaps summarizing intracellular isotopomers of; Citrate, Glutamate, Glutamine, Succinate, Malate and Aspartate. Statistical method, (A-E) non-parametric Mann–Whitney test, mean ± s.e.m, (F) False Discovery Rate (FDR) P value < 0.05.

(Top) Decreased electron flow leads to inhibition of TCA cycle and substrate-level phosphorylation since that these processes are coupled. (Bottom) Schematic of the suggested model for rescuing respiration restricted primed CD8+ T cells. FCCP treatment decreases mitochondrial membrane potential which allows both electrons and the TCA cycle to reflow, restores GTP/ATP production in the matrix by the substrate-level phosphorylation.

FCCP treatment rescues respiratory-restricted CD8+ T cells by stimulating matrix-localized substrate-level phosphorylation, elevating ATP, and reducing AMP/GMP concentrations.

(A-D) CellTrace-labeled splenocytes were stimulated using anti-CD3/28. Nine hours post activation cells were left untreated or treated with 1 μM FCCP, 60 nM oligomycin or with a combination of FCCP and oligomycin. Seventy-two hours post activation cells were analyzed by flow cytometry. (n = 5 biological replicates). (A) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells from untreated cells (left), FCCP treated (second from left), Oligomycin treated (third from left), or Oligomycin and FCCP treated (left). Numbers indicate the frequencies of CD25+ cells. (B) Bar graph summarizing the results in B. (P value ** 0.0079 ** 0.0079 ** 0.0079). (C) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from untreated cells (black), FCCP treated (blue), oligomycin treated (dark red-brown), or oligomycin and FCCP treated (red stripes). (D) Bar graph summarizing the results in DC as proliferation index. (P value ** 0.0079 ** 0.0079 ** 0.0079). (E-G) CD8+ T cells were activated with anti-CD3/CD28. Five hours post activation (T-Early), cells were treated for 3 hr with media containing 13C-glutamine only, 13C-glutamine with oligomycin, or 13C-glutamine with oligomycin plus FCCP. Cell extracts were then subjected for metabolome analysis. (n = 7 biological replicates). (E) Heatmap showing relative amounts of key energy-related metabolites (as indicated in the figure) measured in T-Early cells that were treated with oligomycin or oligomycin plus FCCP. (F) Volcano plot of all analyzed metabolites measured in T-Early cells treated with oligomycin or oligomycin plus FCCP. (G) 13C-glutamine LC-MS tracing analysis of CD8+ T cells that either were untreated or treated with oligomycin, or oligomycin plus FCCP. Heatmaps summarizing intracellular isotopomers of; Citrate, Glutamate, Glutamine, Succinate, Malate and Aspartate. Statistical method, (A-E) non-parametric Mann–Whitney test, mean ± s.e.m, (F) False Discovery Rate (FDR) P value < 0.05.

Schematic of the suggested model; respiratory restriction through inhibition of complex V by oligomycin leads to increase in mitochondrial membrane potential and decreased electron flow.

(Top) Decreased electron flow leads to inhibition of TCA cycle and substrate-level phosphorylation since that these processes are coupled. (Bottom) Schematic of the suggested model for rescuing respiration restricted primed CD8+ T cells. FCCP treatment decreases mitochondrial membrane potential which allows both electrons and the TCA cycle to reflow, restores GTP/ATP production in the matrix by the substrate-level phosphorylation. The release of TCA cycle inhibition may allow respiratory-restricted cells to recover their matrix ATP via substrate-level phosphorylation, specifically through the conversion of succinyl-CoA to succinate. Accordingly, it would be expected that FCCP treatment would allow respiratory-restricted T-Early cells to replenish their mitochondria with ATP, thus rescuing their matrix energy levels despite the inhibition of ATP synthase. We investigated this possibility by examining the levels of mono/di/tri-phosphonucleotides using metabolomics analysis. As expected, T-Early cells treated with oligomycin and FCCP exhibited significantly higher ATP and lower AMP/GMP concentrations compared to controls treated with only oligomycin (Figure 5E-F). Given the ATP synthase blockade, the increase of cellular ATP and reductions of AMP and GMP may be primarily attributed to matrix-bound substrate-level phosphorylation. Finally, to confirm that oligomycin treatment caused a surge in TCA cycle intermediates, we analyzed the metabolic profiles of T-Early cells that were incubated in media containing labeled 13C-glutamine following treatment with oligomycin or with oligomycin plus FCCP, compared to without treatment. In line with our hypothesis, respiratory restriction yielded marked increases of several key TCA cycle metabolites—including succinate, malate, and citrate—compared to control (Figure 5G and its source data). Additionally, relative to controls, oligomycin treatment led to increased levels of glutamate and aspartate, which are linked to the TCA cycle via the Gaba Shunt and the malate-aspartate shuttle, respectively (Figure 5G). Importantly, the addition of FCCP to oligomycin-treated T-Early cells reduced the signal levels of all TCA-linked intermediates, indicating stimulation of the TCA cycle (Figure 5G).

Short exposure to atmospheric oxygen pressure rescues CD8+ T cells’ response to lentiviral challenge under systemic hypoxia in vivo

Our findings demonstrated that during early activation, OXPHOS is required primarily to provide ATP for mitochondrial-biogenesis. It is thought that the build-up of additional mitochondrial biomass is a critical checkpoint in T cell activation (Ron-Harel et al., 2016; Buck et al., 2016). Following the mitochondrial-biogenesis checkpoint, fully activated CD8+ T cells show only a marginal reduction in proliferation capacity under hypoxic conditions (Doedens et al., 2013). Thus, our results suggest that during systemic hypoxia, activated CD8+ T cells are arrested at the mitochondrial-biogenesis checkpoint, and might thus be rescued by short oxygen resuscitation. Building on these insights, we attempted to rescue activated CD8+ T cells that were inhibited by hypoxia by re-exposing them to atmospheric oxygen (Figure 6A). Naïve CD8+ T cells were activated under hypoxic or normal atmospheric conditions in vitro. Twenty-four hours later, the CD8+ T cells activated under hypoxia were re-exposed to normal atmospheric conditions or left under hypoxic conditions. As expected, the activated CD8+ T cells that were left under hypoxic conditions for 72 hr remained arrested and showed reduced elevation of CD25 expression compared to control (Figure 6B-E). In contrast, CD8+ T cells that were activated under hypoxia and then re-exposed to atmospheric oxygen pressure exhibited significantly increased CD25 expression and proliferative capacity (Figure 6B-E).
Figure 6.

Short oxygen exposure rescues CD8+ T cells activated under hypoxia in vivo.

(A) Schematic describing the experiment in B-E. CellTrace-labeled mouse splenocytes were activated with anti-CD3/28 under 1% or atmospheric oxygen pressure (21% O2). Twenty-four hours post activation, a group of cells from the 1% O2 chamber were transferred to 21% O2 (1/21%). The different cell groups were collected at 72 hr post activation and analyzed by flow cytometry. (n = 5 biological replicates). (B) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (C) Bar graph summarizing the results in B. (P value ** 0.0079 ** 0.0079). (D) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from cells that either were grown in 21% O2 (front) or 1% O2 (middle), or from cells that were grown in 1% O2 and transferred to 21% O2 (back). (E) Bar graph summarizing the results in D as proliferation index. (P value ** 0.0079 ** 0.0079). (F) Schematic of experiment presented in panels G-J. C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Three days after the viral challenge, mice were adoptively transferred i.p. with 4 × 106 CellTrace-labeled splenocytes from OT1/mito-Dendra2 double transgenic mice. Mice were then divided into four groups; (1) Lv-OVA infected mice grown in 21% O2 (21%) for another 3 days. (2) Lv-OVA infected mice grown in 8% O2 for another 3 days (8%). (3) Lv-OVA infected mice grown in 8% O2 for 24 hr and then transferred to 21% O2 for another 48 hr (8/21%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Cells from the deep cervical lymph nodes were then analyzed by flow cytometry analysis. (n = 5 mice for groups 1–3 and n = 3 mice for the control group). (G) Representative flow cytometry overlay histogram of CellTrace intensity gated on TCR Vα2+, CD8+, and Dendra+ triple positive cells from each of the four groups. (H) Bar graph summarizing the results in G, as Proliferation Index. (P value ** 0.0079 ** 0.0079). (I) Representative flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the TCR Vα2+, CD8+, and Dendra2+ triple positive cells from each of the four groups. (J) Bar graph summarizing the results in I, Dendra2 mean fluorescence intensity (MFI). (P value ** 0.0079 ** 0.0079). (K) Schematic of experiment presented in panels (L-Q). C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Twenty-four hours after the viral challenge mice were divided into four groups; (1) Lv-OVA infected mice grown in 21% O2 (21%). (2) Lv-OVA infected mice grown in 8% O2 (8%). (3) Lv-OVA infected mice grown in 8% O2 for 48 hr, transferred to 21% O2 for 24 hr and then transferred back to 8% O2 for an additional 48 hr (8/21/8%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Seven days from the beginning of the experiment, cells from the deep cervical lymph nodes were analyzed by flow cytometry. (L) Representative flow cytometry plots of CD25 vs. CD62L gated on TCR Vα2+, CD8+ T cells from each of the four groups. Numbers indicate the frequencies of CD25+ CD62L- cells. (M) Bar graph summarizing the number of TCR Vα2+, CD8+, and CD25+ cells in each of the groups. (P value * 0.0238 **0.0022 ** 0.0022). (N) Bar graph summarizing the number of TCR Vα2+, CD8+, CD25+ and CD62L- cells in each of the groups. (P value *0.0238 ** 0.0022 ** 0.0022). (O) Same as in L focusing on the CD44+ and CD62L- cells. (P) Bar graph summarizing the number of TCR Vα2+, CD8+, and CD44+ cells in each of the groups. (P value * 0.0238 ** 0.0022 ** 0.0022). (Q) Same as in P, focusing on the TCR Vα2+, CD8+, CD44+ and CD62L- cells. (P value *0.0238 ** 0.0022 ** 0.0022). Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Twenty-four hours after the viral challenge, mice were divided into four groups: (1) Lv-OVA infected mice grown in 21% O2 (21%). (2) Lv-OVA infected mice grown in 8% O2 (8%). (3) Lv-OVA infected mice grown in 8% O2 for 48 hr, transferred to 21% O2 for 24 hr and then transferred back 21% O2 for another 48 hr (8/21/8%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Seven days from the beginning of the experiment, cells from the deep cervical lymph nodes were analyzed by flow cytometric analysis. (Naïve n = 3 biological replicates, activated n = 6 biological replicates per group) (A) Bar graph summarizes the number of TCR Vα2+, CD8+ and CD62L- cells in each of the groups. (P value * 0.0238 ** 0.0022 ** 0.0087) (B) Bar graph summarizes the number of TCR Vα2+, CD8+, CD44+, CD25+ and CD62L- cells in each of the groups. (P value * 0.0238 ** 0.0022 * 0.0299). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Short oxygen exposure rescues CD8+ T cells activated under hypoxia in vivo.

(A) Schematic describing the experiment in B-E. CellTrace-labeled mouse splenocytes were activated with anti-CD3/28 under 1% or atmospheric oxygen pressure (21% O2). Twenty-four hours post activation, a group of cells from the 1% O2 chamber were transferred to 21% O2 (1/21%). The different cell groups were collected at 72 hr post activation and analyzed by flow cytometry. (n = 5 biological replicates). (B) Representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. Numbers indicate the frequencies of CD25+ cells. (C) Bar graph summarizing the results in B. (P value ** 0.0079 ** 0.0079). (D) Representative flow cytometry overlay histogram of CellTrace intensity gated on CD8+ T cells from cells that either were grown in 21% O2 (front) or 1% O2 (middle), or from cells that were grown in 1% O2 and transferred to 21% O2 (back). (E) Bar graph summarizing the results in D as proliferation index. (P value ** 0.0079 ** 0.0079). (F) Schematic of experiment presented in panels G-J. C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Three days after the viral challenge, mice were adoptively transferred i.p. with 4 × 106 CellTrace-labeled splenocytes from OT1/mito-Dendra2 double transgenic mice. Mice were then divided into four groups; (1) Lv-OVA infected mice grown in 21% O2 (21%) for another 3 days. (2) Lv-OVA infected mice grown in 8% O2 for another 3 days (8%). (3) Lv-OVA infected mice grown in 8% O2 for 24 hr and then transferred to 21% O2 for another 48 hr (8/21%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Cells from the deep cervical lymph nodes were then analyzed by flow cytometry analysis. (n = 5 mice for groups 1–3 and n = 3 mice for the control group). (G) Representative flow cytometry overlay histogram of CellTrace intensity gated on TCR Vα2+, CD8+, and Dendra+ triple positive cells from each of the four groups. (H) Bar graph summarizing the results in G, as Proliferation Index. (P value ** 0.0079 ** 0.0079). (I) Representative flow cytometry histogram overlay plot of Dendra2 fluorescence intensity gated on the TCR Vα2+, CD8+, and Dendra2+ triple positive cells from each of the four groups. (J) Bar graph summarizing the results in I, Dendra2 mean fluorescence intensity (MFI). (P value ** 0.0079 ** 0.0079). (K) Schematic of experiment presented in panels (L-Q). C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Twenty-four hours after the viral challenge mice were divided into four groups; (1) Lv-OVA infected mice grown in 21% O2 (21%). (2) Lv-OVA infected mice grown in 8% O2 (8%). (3) Lv-OVA infected mice grown in 8% O2 for 48 hr, transferred to 21% O2 for 24 hr and then transferred back to 8% O2 for an additional 48 hr (8/21/8%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Seven days from the beginning of the experiment, cells from the deep cervical lymph nodes were analyzed by flow cytometry. (L) Representative flow cytometry plots of CD25 vs. CD62L gated on TCR Vα2+, CD8+ T cells from each of the four groups. Numbers indicate the frequencies of CD25+ CD62L- cells. (M) Bar graph summarizing the number of TCR Vα2+, CD8+, and CD25+ cells in each of the groups. (P value * 0.0238 **0.0022 ** 0.0022). (N) Bar graph summarizing the number of TCR Vα2+, CD8+, CD25+ and CD62L- cells in each of the groups. (P value *0.0238 ** 0.0022 ** 0.0022). (O) Same as in L focusing on the CD44+ and CD62L- cells. (P) Bar graph summarizing the number of TCR Vα2+, CD8+, and CD44+ cells in each of the groups. (P value * 0.0238 ** 0.0022 ** 0.0022). (Q) Same as in P, focusing on the TCR Vα2+, CD8+, CD44+ and CD62L- cells. (P value *0.0238 ** 0.0022 ** 0.0022). Statistical method, non-parametric Mann–Whitney test, mean ± s.e.m.

Short oxygen exposure rescues CD8+ T cells activated under hypoxia in vivo.

C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Twenty-four hours after the viral challenge, mice were divided into four groups: (1) Lv-OVA infected mice grown in 21% O2 (21%). (2) Lv-OVA infected mice grown in 8% O2 (8%). (3) Lv-OVA infected mice grown in 8% O2 for 48 hr, transferred to 21% O2 for 24 hr and then transferred back 21% O2 for another 48 hr (8/21/8%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Seven days from the beginning of the experiment, cells from the deep cervical lymph nodes were analyzed by flow cytometric analysis. (Naïve n = 3 biological replicates, activated n = 6 biological replicates per group) (A) Bar graph summarizes the number of TCR Vα2+, CD8+ and CD62L- cells in each of the groups. (P value * 0.0238 ** 0.0022 ** 0.0087) (B) Bar graph summarizes the number of TCR Vα2+, CD8+, CD44+, CD25+ and CD62L- cells in each of the groups. (P value * 0.0238 ** 0.0022 * 0.0299). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m. Next, we tested our hypothesis in vivo (Figure 6F). Mice were primed with LV-OVA or left uninfected. Three days after the viral challenge, mice were adoptively transferred with CellTrace-labeled splenocytes from OT1/mito-Dendra2 double transgenic mice. Then the mice were either continuously maintained at atmospheric or 8% oxygen level for 72 hr, or kept at an 8% oxygen level for 24 hr and then transferred to atmospheric oxygen pressure for another 48 hr. In line with the in vitro results, compared to mice kept under systemic hypoxia for 72 hr, the hypoxic mice that were resuscitated at atmospheric oxygen for 48 hr exhibited a significantly improved anti-lentiviral CD8+ T cell response, manifested by a marked increase in proliferative capacity (Figure 6G–H). Importantly, resuscitation at atmospheric oxygen pressure also led to increased mtDendra2 expression compared to mice kept under hypoxia for 72 hr (Figure 6I–J). These results demonstrate the reversibility of the CD8+ T cell activation arrest mediated by respiratory restriction. Finally, to examine whether we can utilize our findings to improve anti-viral response in a more clinically relevant approach, we tested whether a short, 24 hr, exposure to atmospheric oxygen pressure would rescue the CD8+ T cell response to Lv-OVA under systemic hypoxia in vivo. We compared markers of CD8+ T cell activation status in mice challenged under atmospheric oxygen pressure, 21% oxygen pressure, continuous systemic hypoxia (8% oxygen pressure), or transient resuscitation (systemic hypoxia followed by 24 hr resuscitation at atmospheric oxygen pressure) (Figure 6K). As expected, our analysis of CD62L, CD44, and CD25 revealed that the CD8+ response was strongly inhibited under continuous systemic hypoxia. In contrast, in the transient resuscitation group, we observed a marked increase in the population of OVA-associated CD44+, CD25+, CD62LCD8+ T cells (Figure 6L–Q and Figure 6—figure supplement 1A–B). Importantly the phenotype in the transient resuscitation group was almost indistinguishable from the control group that was kept under normal atmospheric conditions. Overall, our results demonstrate that the detrimental effect caused by systemic hypoxia in vivo may be alleviated by short exposure to atmospheric oxygen pressure.
Figure 6—figure supplement 1.

Short oxygen exposure rescues CD8+ T cells activated under hypoxia in vivo.

C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Twenty-four hours after the viral challenge, mice were divided into four groups: (1) Lv-OVA infected mice grown in 21% O2 (21%). (2) Lv-OVA infected mice grown in 8% O2 (8%). (3) Lv-OVA infected mice grown in 8% O2 for 48 hr, transferred to 21% O2 for 24 hr and then transferred back 21% O2 for another 48 hr (8/21/8%). (4) Lv-OVA uninfected mice grown in 21% O2 (Ctrl). Seven days from the beginning of the experiment, cells from the deep cervical lymph nodes were analyzed by flow cytometric analysis. (Naïve n = 3 biological replicates, activated n = 6 biological replicates per group) (A) Bar graph summarizes the number of TCR Vα2+, CD8+ and CD62L- cells in each of the groups. (P value * 0.0238 ** 0.0022 ** 0.0087) (B) Bar graph summarizes the number of TCR Vα2+, CD8+, CD44+, CD25+ and CD62L- cells in each of the groups. (P value * 0.0238 ** 0.0022 * 0.0299). Statistical method, non-parametric Mann-Whitney test, mean ± s.e.m.

Discussion

Our present results revealed that under systemic chronic hypoxia, CD8+ T cells failed to activate and respond to a viral challenge due to a matrix-localized ATP deficiency that disrupted critical mitochondrial processes. Several lines of evidence from our study indicated that mitochondrial respiratory-based ATP was not required for T cell cytoplasmic function during activation. Using both genetic and acute models of cytoplasm-specific mitochondrial ATP restriction, we determined that in CD8+ T cells, the ATP demand in the mitochondrial matrix was distinct from that in the cytoplasm. Furthermore, through functional assays, we revealed a matrix-specific ATP crisis following oligomycin mediated acute respiratory-restriction. To confirm these results, we demonstrated that uncoupler-based restimulation of the TCA cycle could functionally rescue respiratory-restricted T-Early cells. In line with these findings, our metabolic analysis revealed that oligomycin treatment during early activation led to an accumulation of TCA intermediates. Moreover, we demonstrated that addition of the proton uncoupler FCCP substantially reduced the accumulation of mono-phosphonucleotide intermediates, and elevated ATP levels. Since oligomycin maintains ATP synthase arrest, even following the addition of FCCP (Lee and O’Brien, 2010), the increase of cellular ATP and reductions of both AMP and GMP may be primarily attributed to matrix-bound substrate-level phosphorylation. Notably, some of these mechanistic observations regarding the inhibitory effect mediated by an acute respiratory restriction on CD8+ T cell activation, were based on the application of oligomycin. Since oligomycin, only partially mimics hypoxia, follow-up work should look into further mechanistic effects induced by hypoxia. Taken together, our results suggested that under chronic hypoxia, activated CD8+ T cells were arrested at the mitochondrial-biogenesis checkpoint, and could be rescued by oxygen resuscitation. Building on these insights, we demonstrated that hypoxia-arrested CD8+ T cells in vivo could be rescued by short exposure to atmospheric conditions. Overall, our present study revealed that hypoxia had detrimental effects on mitochondrial-biogenesis in activated CD8+ T cells suggest a potential new approach to the reduction of viral infections in hypoxia-associated diseases.

Materials and methods

Mice

The C57BL/6J (wild-type), Slc25a5tm1.1Nte/J (ANT2), and C57BL/6-Tg(TcraTcrb)1100Mjb/J (OT1) mice were from The Jackson Laboratory. B6.Cg-Tg(Lck-cre)1CwiN9 (Lck-Cre) were from Taconic. The T cell-specific ANT2 knockout mice were generated by crossing mice containing a conditional floxed allele of ANT2 Slc25a5tm1.1Nte/J (ANT2flox/lox) with transgenic mice expressing Cre under the control of the Lck gene promoter (Lck-Cre). Gt(ROSA)26Sortm1.1(CAG-Mito-Dendra2) Dcc (mito-Dendra2) mice were a kind gift from Dr. Tsvee Lapidot from the Weizmann Institute of Science. Mice were maintained and bred under specific pathogen free conditions in the Hebrew University animal facilities according to Institutional Animal Care and Use Committee regulations. All mice were maintained on the C57BL/6J background and used for experiments at 8–12 weeks of age.

Quantitative real-time PCR and cDNA preparation

Total RNA from purified CD8+ T cells was extracted with Direct-zol RNA MiniPrep Plus (Zymo Research) following DNA removal step. cDNA was synthesized using ProtoScript First Strand cDNA Synthesis Kit (New England BioLabs, Inc – E6300L) with random primers for the MT-RNR transcripts, and oligo-dT primers for all other transcripts. Quantitative real-time PCR was then performed using Applied Biosystems (AB), Viia 7 Real-Time PCR system with a Power SYBR green PCR master mix kit (Applied Biosystems). Reaction was performed as follow: 50°C 2 min, one cycle 95°C 10 min, one cycle 95°C 15 s - > 60°C 1 min, 40 cycles 95°C 15 s, one cycle 60°C 1 min, one cycle 95°C 15 s, one cycle Data was normalized to Mouse endogenous control (UBC and or RPL13) and analyzed using ΔΔCt model unless else is indicated. Each experiment was performed in sixplicates and was repeated three times. Student’s t-test was used with 95% confidence interval.

Primers used for quantitative Real-Time PCR

Protein mass spectrometry

Sample preparation

Agarose beads containing immunoprecipitated samples, frozen at −20°C was subject to tryptic digestion, performed in the presence of 0.05% ProteaseMAX Surfactant (from Promega Corp., Madison, WI, USA). The peptides were then desalted on C18 Stage tips (Rappsilber et al., 2007). A total of 0.5 µg of peptides were injected into the mass spectrometer.

LC-MS/MS analysis

MS analysis was performed using a Q Exactive Plus mass spectrometer (Thermo Fisher Scientific) coupled on-line to a nanoflow UHPLC instrument (Ultimate 3000 Dionex, Thermo Fisher Scientific). Eluted peptides were separated over a 60 min gradient run at a flow rate of 0.3 µl/min on a reverse phase 25-cm-long C18 column (75 µm ID, 2 µm, 100 Å, Thermo PepMapRSLC). The survey scans (380–2,000 m/z, target value 3E6 charges, maximum ion injection times 50 ms) were acquired and followed by higher energy collisional dissociation (HCD) based fragmentation (normalized collision energy 285). A resolution of 70,000 was used for survey scans and up to 15 dynamically chosen most abundant precursor ions were fragmented (isolation window 1.6 m/z). The MS/MS scans were acquired at a resolution of 17,500 (target value 5E4 charges, maximum ion injection times 57 ms). Dynamic exclusion was 60 s.

MS data analysis

Mass spectra data were processed using the MaxQuant computational platform, version 1.5.3.12. Peak lists were searched against the Homo sapiens Uniprot FASTA sequence database containing a total of 26,199 reviewed entries or a custom FATSA file containing mouse mitochondrial leader peptides. The search included cysteine carbamidomethylation as a fixed modification and oxidation of methionine as variable modifications. Peptides with minimum of seven amino-acid length were considered and the required FDR was set to 1% at the peptide and protein level. Protein identification required at least three unique or razor peptides per protein group. The dependent-peptide and match-between-runs options were used.

In vivo viral challenge under chronic hypoxia

C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 transduction units (TU) of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers for additional 6 days and kept under either 8% or 21% oxygen pressure. Extracted cells from the deep cervical lymph nodes were then analyzed by flow cytometry as follows.

In vivo T cell proliferation assay

C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA. Three days after the viral challenge, mice were adoptively transferred i.p. with 4 × 106 CellTrace-labeled splenocytes from OT1/mito-Dendra2 double transgenic mice. Three days later cells from the deep cervical lymph nodes were analyzed by flow cytometry analysis.

In vitro T cell proliferation assay

Splenocytes or human PBMCs were stained with CellTrace (Molecular Probes, Eugene, OR) prior to activation for 30 min at 37°C. Cells were then activated in 24-flat-well plates (5 × 106 cells per well) or 96-flat-well plates (1 × 106 cells per well) with soluble anti-CD3ε (1 µg/ml) and anti-CD28 (1 µg/ml). Proliferation index reflects the sum the percentage of cells in each generation group multiplied by the number of division.

Antibodies

The following antibodies were used for flow cytometry: anti-CD8α (53–6.7), anti-CD44 (IM7), anti-CD69 (H1.2F3), anti-CD25 (3C7), anti-CD62L (MEL-14), anti-mouse TCR Vα2 (B20.1), anti-human CD8 (HIT8a), anti-human CD25 (M-A251), and anti-mouse Ki67 (16A8). All antibodies were from BioLegend. Purified anti-CD3ε (145–2C11) and anti-CD28 (37.51; both from Biolegend) were used at the appropriate concentration for mouse T cell activation. Purified anti-CD3ε (OKT3) and anti-CD28 (CD28.2; both from Biolegend) were used at the appropriate concentration for human T cell activation. Antibody to AMPKα phosphorylated on Thr172 and anti-AMPKα both from Cell Signaling Technology were used for immunoblot analysis. Antibody to Ubiquitinated proteins (FK2) from Merck-Millipore was used for the immunoprecipitation assay.

Flow cytometry

Cells were stained with various conjugated mAbs against cell-surface markers in FACS buffer (PBS containing 1% FBS and 1 mM EDTA) for 30 min at 4°C. For mitochondrial membrane potential staining, cells were labeled with TMRM 50 nM (Molecular Probes, Eugene, OR) in FACS buffer without EDTA for 30 min at 30°C. Stained cells were analyzed by Gallios flow cytometer with Kaluza software (Beckman Coulter, Brea, CA) and analyzed by FACS Express 6 (De Novo Software).

Metabolism assays

OCR and ECAR were measured using a 24-well XF extracellular flux analyzer (EFA) (Seahorse Bioscience). Purified naive or activated CD8+ T cells (1 × 106 cells per well) were seeded in Seahorse XF24 designated plates using Cell-Tak (Corning) adherent and assayed according to manufacturer instructions.

Western blot and immunoprecipitation

Purified naïve or activated CD8+ T cells were lysed in radioimmunoprecipitation assay (RIPA) buffer; 10 μg protein from each sample was separated by SDS–PAGE, and immunoblotted with anti AMPKα antibody or p-AMPKα (Thr172) (Cell Signaling, Danvers, MA; 2532) followed by peroxidase donkey anti‐rabbit IgG (Jackson Laboratory; 711‐005‐152). For immunoprecipitation extracts from purified activated CD8+ T cells were prepared in extraction buffer (50 mM Tris-HCI, pH 8.0, 5 mm EDTA, 150 mM NaCl and 0.5% NP-40, supplemented with Protease Inhibitor Cocktail, Sigma-Aldrich, Israel). Protein extracts were then precleared with protein G beads (EZview Red Protein G Affinity Gel, Sigma-Aldrich, Israel), following incubation for 30 min at 4°C. Protein G beads were pelleted out, and the supernatant was taken for immunoprecipitation with 2 μg of anti-ubiquitin antibody (FK2, Merck-Millipore) for 12 hr at 4°C. Immune complexes were pelleted with protein G beads as before, and the pellets were washed three times in buffer B (5% sucrose, 50 mM Tris-HCI pH 7.4, 500 mM NaCI, 5 mM EDTA and 0.5% NP-40), followed by three washes with buffer C (50 mM Tris-HCI pH 7.4, 150 mM NaCl and 5 mM EDTA). The precipitated proteins were then subjected to MS analysis.

Targeted metabolic analysis

CD8+ T cells were cultured in either anti-CD3/CD28 coated or uncoated 96 well plate (1 million cells/well), suspended in RPMI supplemented with 10% dialyzed Fetal Bovine Serum and 100 μM Alanine with or without labeled glutamine. Following 5 or 24 hr activated cells were treated with 500 nM Oligomycin, Oligomycin and 1 μM FCCP or left untreated for 2 hr. Naïve, and activated cells were then extracted for metabolomics LC-MS analysis.

Medium extracts

Twenty microliters of culture medium was added to 980 μl of a cold extraction solution (−20°C) composed of methanol, acetonitrile, and water (5:3:2). Cell extracts: Cells were rapidly washed three times with ice-cold PBS, after which intracellular metabolites were extracted with 100 μl of ice-cold extraction solution for 5 min at 4°C. Medium and cell extracts were centrifuged (10 min at 16,000 g) to remove insoluble material, and the supernatant was collected for LC-MS analysis. Metabolomics data was normalized to protein concentrations using a modified Lowry protein assay. LC-MS metabolomics analysis was performed as described previously (Mackay et al., 2015). Briefly, Thermo Ultimate 3000 high-performance liquid chromatography (HPLC) system coupled to Q- Exactive Orbitrap Mass Spectrometer (Thermo Fisher Scientific) was used with a resolution of 35,000 at 200 mass/charge ratio (m/z), electrospray ionization, and polarity switching mode to enable both positive and negative ions across a mass range of 67 to 1000 m/z. HPLC setup consisted ZIC-pHILIC column (SeQuant; 150 mm x 2.1 mm, 5 μm; Merck), with a ZIC-pHILIC guard column (SeQuant; 20 mm x 2.1 mm). 5 μl of Biological extracts were injected and the compounds were separated with mobile phase gradient of 15 min, starting at 20% aqueous (20 mM ammonium carbonate adjusted to pH.2 with 0.1% of 25% ammonium hydroxide) and 80% organic (acetonitrile) and terminated with 20% acetonitrile. Flow rate and column temperature were maintained at 0.2 ml/min and 45°C, respectively, for a total run time of 27 min. All metabolites were detected using mass accuracy below five ppm. Thermo Xcalibur was used for data acquisition. TraceFinder 4.1 was used for analysis. Peak areas of metabolites were determined by using the exact mass of the singly charged ions. The retention time of metabolites was predetermined on the pHILIC column by analyzing an in-house mass spectrometry metabolite library that was built by running commercially available standards.

Statistical analysis

The statistical significance of differences was determined by the two-tailed Mann-Whitney non-parametric t-test. Biological replicates refer to independent experimental replicates sourced from different mice/human donors. Technical replicates refer to independent experimental replicates from the same biological source. Differences with a P value of less than 0.05 were considered statistically significant. Graph prism and Perseus programs were used. MS data was normalized by ranking, when applicable, non-values were plugged with replicates mean to prevent zeros bias. In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Acceptance summary: In this study, Saragovi and colleagues demonstrate that mitochondrial respiration is critical during these first hours to enable TCA cycle activity and produce ATP within mitochondrial matrix to support mitochondrial-biogenesis. The authors show a detrimental effect of hypoxia/oligomycin on mitochondrial-biogenesis during T cell activation. They find that ATP-dependent matrix processes, critical for mitochondrial-biogenesis, are impaired under respiratory restriction condition, leading to compromised T cell activation. Moreover, increased mitochondrial matrix-localized ATP via boosting substrate-level phosphorylation can partially rescue the defect upon respiratory restriction. Thus, they refute a common hypothesis that mitochondrial activity is critical for providing ATP to the cytosol, since inhibition of ATP export does not inhibit T cell activation. Lastly, they show that anti-viral responses under systemic oxygen restriction in vivo can be rescued by short exposure to atmospheric oxygen pressure. Thus, the authors provide interesting evidence regarding linkages between hypoxia, mitobiogenesis and T cell activation. Decision letter after peer review: Thank you for submitting your article "Systemic hypoxia inhibits T cell response by limiting mitobiogenesis via matrix substrate-level phosphorylation arrest" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Satyajit Rath as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Noga Ron-Harel (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is 'in revision at eLife'. Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.) Summary: Early T cell activation initiates a robust program of mitochondrial-biogenesis and metabolic rewiring, and induces mitochondrial respiration. While previous studies have suggested that there is a critical time window of mitochondrial activity for T cell activation, the mechanistic basis of this dependency has been unclear. In this study, Saragovi and colleagues demonstrate that mitochondrial respiration is critical during these first hours to enable TCA cycle activity and produce ATP within mitochondrial matrix to support mitochondrial-biogenesis. The authors show a detrimental effect of hypoxia on mitochondrial-biogenesis during T cell activation. They use oligomycin treatment to mimic respiratory restriction and find that ATP-dependent matrix processes, critical for mitochondrial-biogenesis, are impaired under respiratory restriction condition, leading to compromised T cell activation. Moreover, increased mitochondrial matrix-localized ATP via boosting substrate-level phosphorylation can partially rescue the defect upon respiratory restriction. Thus, they refute a common hypothesis that mitochondrial activity is critical for providing ATP to the cytosol, since inhibition of ATP export does not inhibit T cell activation. Lastly, they show that anti-viral responses under systemic oxygen restriction in vivo can be rescued by short exposure to atmospheric oxygen pressure. Thus, the authors provide convincing evidence to demonstrate the linkages between hypoxia, mitobiogenesis and T cell activation. However, a number of major concerns, identified below, remain to be addressed in order to increase enthusiasm for publication. Essential revisions: 1) The authors use oligomycin treatment to establish respiratory restriction and mimic a hypoxic environment. However, it is unclear whether the impaired T cell activation coupled with ATP-deficiency and blocked mitobiogenesis upon oligomycin treatment is similar to the phenotypes observed under hypoxic conditions. It is therefore essential to examine if hypoxia also impairs T cell activation when encountered at early but not at later stages, and whether the mitobiogenesis and ATP-dependent matrix processes are also inhibited under hypoxic conditions. Similarly, it is advisable to examine if oligomycin-mediated effects can also be reversed as hypoxic effects can be (Figure 6A-6D). 2) While the model chosen for in vivo studies is appropriate (Figures 1 and 6), the data provided require additions of further analysis of T cell activation and effector functions under the different experimental conditions used. In Figure 1 and in Figure 6, which essentially repeats the experiment in Figure 1 and tests whether a short exposure to high oxygen can rescue T cell activation under hypoxia, the authors show reduction in CD62L expression as the only parameter of T cell activation. It will be more convincing to include additional activation markers (such as CD25, CD69), especially since those are used in other experiments presented in the paper, and the sporadic usage of different markers is confusing. Assays for T cell proliferation (using Ki67, for example) and effector functions (IFNγ, TNFa, GzB levels) under hypoxia are also advisable. In the experiments for Figure 6 day 3 was chosen for normoxia; but using an earlier time point would be more congruent with the ~9 h in-vitro time window. Finally, it would be important to test if mitobiogenesis is also rescued after short oxygen exposure, so as to further identify a specific time window for mitobiogenesis essential for T cell activation. 3) In order to enhance the observations on AMPK signaling (Figure 3), it would be useful to include treatment with AMPK inhibitors in order to conclude that activated AMPK signaling is independent of the impaired activation upon respiratory restriction. 4) While investigating the role of ATP transportation, it would be best to examine the activation phenotypes in ANT2-depleted or Bongkrekic acid-treated T-Early and T-Late T cells upon oligomycin treatment or hypoxia conditions Figures 3D-G). 5) The impaired cellular processes observed in T-Early, not in T-Late, T cells (Figure 4) could indicate either that mitochondrial-biogenesis is ongoing and essential for the early phase of T cell activation and is less critical in T-Late cells, or that these cellular processes in T-Late cells are independent of respiratory restriction. Data comparing these cellular processes in untreated T-Early and T-Late cells to test if mitobiogenesis has already declined in T-Late cells in comparison with T-Early cells would be useful to distinguish between these. Thus, for example, in Figure 4C, all groups could be normalised to the untreated 9 h group. Similarly, with respect to the importance of mitobiogenesis in the development of tolerance, it would be useful to examine mitobiogenesis or mitochondrial mass in T-Early and T-Late cells in Figure 4A. 6) In the examination of cell size, CD25 expression and proliferation in oligomycin-treated T cells (Figure 2A), analyses of percentages of CD44- and CD25-positive cells and the expression levels of the activation markers in activated T cells would be very useful. 7) In Figure 6, there appears to be some confusion that needs clarification. The bar graph in Figure 6F shows higher levels of effector T cells (CD62L-) in mice kept under hypoxia, which is the opposite of what the authors claim. In Figure 6G, showing CD62L expression in antigen-specific CD8 T cells, the authors claim that the data are showing reduced CD62L expression in mice exposed to high oxygen. However, the difference in the presented histograms seem to be in the number of cells acquired. 8) The language in the manuscript is very difficult to follow, and revision would be very helpful. Careful editing is also needed; an example is of panels that are mentioned in the text but are missing from the figures (S3B-S3G). [Editors' note: further revisions were suggested prior to acceptance, as described below.] Thank you for submitting your article "Systemic hypoxia inhibits T cell response by limiting mitobiogenesis via matrix substrate-level phosphorylation arrest" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Satyajit Rath as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Noga Ron-Harel (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data. Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper. Summary: Early T cell activation initiates a robust program of mitochondrial-biogenesis and metabolic rewiring, and induces mitochondrial respiration. While previous studies have suggested that there is a critical time window of mitochondrial activity for T cell activation, the mechanistic basis of this dependency has been unclear. In this study, Saragovi and colleagues demonstrate that mitochondrial respiration is critical during these first hours to enable TCA cycle activity and produce ATP within mitochondrial matrix to support mitochondrial-biogenesis. The authors show a detrimental effect of hypoxia/oligomycin on mitochondrial-biogenesis during T cell activation. They use oligomycin treatment to mimic respiratory restriction and find that ATP-dependent matrix processes, critical for mitochondrial-biogenesis, are impaired under respiratory restriction condition, leading to compromised T cell activation. Moreover, increased mitochondrial matrix-localized ATP via boosting substrate-level phosphorylation can partially rescue the defect upon respiratory restriction. Thus, they refute a common hypothesis that mitochondrial activity is critical for providing ATP to the cytosol, since inhibition of ATP export does not inhibit T cell activation. Lastly, they show that anti-viral responses under systemic oxygen restriction in vivo can be rescued by short exposure to atmospheric oxygen pressure. Thus, the authors provide interesting evidence regarding linkages between hypoxia, mitobiogenesis and T cell activation. A number of major concerns identified have been mostly addressed in the revised manuscript. However, a couple of issues still remain as identified below. Revisions for this paper: 1) The use of oligomycin to mimic hypoxia remains a problem, since it does not simply mimic hypoxia. If it can be achieved, it is very advisable to perform these experiments with hypoxia. At the very least, the conclusions of this manuscript should be toned down substantially in the interim. 2) The cell death of early activated naive T cells induced by compound C may be a dosage-related artificial result. It is not clear whether the authors examine different doses. Some controls should be included to make the conclusion made. At the very least, the authors need to tone done their conclusions of these data in the interim. Revisions expected in follow-up work: If the additional oligomycin- and compound C-related work mentioned above cannot be provided now, data addressing these concerns would be expected in follow-up work. Essential revisions: 1) The authors use oligomycin treatment to establish respiratory restriction and mimic a hypoxic environment. However, it is unclear whether the impaired T cell activation coupled with ATP-deficiency and blocked mitobiogenesis upon oligomycin treatment is similar to the phenotypes observed under hypoxic conditions. It is therefore essential to examine if hypoxia also impairs T cell activation when encountered at early but not at later stages, and whether the mitobiogenesis and ATP-dependent matrix processes are also inhibited under hypoxic conditions. Oligomycin partially mimics the effect induced by hypoxia by imposing cellular respiratory restriction (Chang et al., 2013) (Solaini et al., 2010) (Sgarbi et al., 2018). We chose to use oligomycin for two main reasons: 1. It provides a simple experimental system to test the immediate effects of respiratory restriction under multiple conditions. 2. as opposed to hypoxia, it allows to distinguish between the indirect effects mediated by the inhibition of the electron transport chain and the TCA cycle (Martínez-Reyes et al., 2016), and the direct effect, as a result of reduced mitochondrial ATP (Lee and O’Brien, 2010). It is worthy to mention that there are several papers that already showed that hypoxia leads to impaired activation of naïve T cells in vitro, but none of them provided mechanistic insight that will explain why oxygen is necessary for activation of naïve T cells. Applying oligomycin and later combination of oligomycin and FCCP allows a fine dissection of the direct role of oxygen in T cell activation. Hypoxia is an evolving process that leads to accumulative effects. When the experimental conditions were suitable, we repeated the experiment using a hypoxic chamber. However, due to multiple reasons such as oxygen pressure in the media, the hypoxic chamber method is not rapid enough to meet the requirements in some of the more mechanistic experiments. For example testing the immediate-direct influence of ATP-dependent matrix processes requires precise timing. Please note that these sets of experiments are performed by applying oligomycin to a very short period of ~1h. This cannot be done by applying hypoxic conditions. Following the reviewers' comments we now provide the additional data as follow: New Figure 2A-E: CD8+ T cells were activated in vitro and subjected to hypoxia at early and late time points post stimuli. Indeed, CD8+ T cells that were exposed to hypoxia at an early time point (5h) following activation demonstrated an impaired elevation in CD25 expression and decreased proliferative capacity. These impairments were shown to be significantly improved in cells that were transferred to hypoxic conditions at a late time point (18h) following activation (Figure 2B-E). These results suggest that, similar to oligomycin-treatment, hypoxia impairs T cell activation when encountered at early but not at later stages. New Figure 4A-D: using CD8+ T cells from mito-Dendra2 we show that the intensity of Dendra2 in activated CD8+ T cells failed to be elevated when the cells were exposed to 1% oxygen 5 hours but not 18 hours following activation. These results demonstrate that, similar to oligomycin treatment, mitochondrial-biogenesis is inhibited under hypoxic conditions. Similarly, it is advisable to examine if oligomycin-mediated effects can also be reversed as hypoxic effects can be (Figure 6A-6D). Oligomycin is an irreversible ATP synthase inhibitor (Matsuno-Yagi A, Hatefi Y. J Biol Chem. 1993;268(3):1539-45. PMID: 8380571). Therefore the effects of oligomycin cannot be reversed by simply washing it from the medium. However, we demonstrated that the effect on T cell activation mediated by oligomycin can be rescued by FCCP, suggesting that the effect of oligomycin on cellular respiration may be reversible. 2) While the model chosen for in vivo studies is appropriate (Figures 1 and 6), the data provided require additions of further analysis of T cell activation and effector functions under the different experimental conditions used. In Figure 1 and in Figure 6, which essentially repeats the experiment in Figure 1 and tests whether a short exposure to high oxygen can rescue T cell activation under hypoxia, the authors show reduction in CD62L expression as the only parameter of T cell activation. It will be more convincing to include additional activation markers (such as CD25, CD69), especially since those are used in other experiments presented in the paper, and the sporadic usage of different markers is confusing. Assays for T cell proliferation (using Ki67, for example) and effector functions (IFNγ, TNFa, GzB levels) under hypoxia are also advisable. In the experiments for Figure 6 day 3 was chosen for normoxia; but using an earlier time point would be more congruent with the ~9 h in-vitro time window. Finally, it would be important to test if mitobiogenesis is also rescued after short oxygen exposure, so as to further identify a specific time window for mitobiogenesis essential for T cell activation. The reviewers' comments and suggestions regarding the in vivo model are well taken. We do believe that since it is the first time that the influence of systemic low oxygen levels on T cell priming in vivo is tested, a more careful look is needed. Therefore, we invested significant resources to substantially improve the in vivo model and the subsequent phenotyping of antigen specific T cells activation status. To better examine the priming of anti-ova CD8 T cells we modified the model from our first submission in line with a method previously used to test T cell priming in response to vaccination with lentivirus, Furmanov et al, 2010 and Furmanov et al., 2013. This model entails the injection of the OVA-lentivirus into ear pinna, intradermally. CD8 T cells activation status could then be measured by extracting cells from the deep cervical lymph nodes, which was shown to specifically drain the ear pinna. The adjusted model offered a more rapid, simple, robust method to characterize T cell activation in respect to IM immunization. Importantly the new model allows picking an experimental time frame similar to the one used in vitro. Using this model we repeated all the in vivo experiments and completely revised both Figures 1 and 6 to include CD25, CD44, and CD62L as activation markers and Ki67/CellTrace as a marker for proliferation of the ova specific T cells. We couldn't observe CD69 elevation in our in vivo model. Most probably since CD69 elevation in T cells is a temporary event, peaks at 24 h post-activation, begin to decrease after 48h and almost entirely diminished after 96-120 h from activation. We therefore, for the sake of coherence, thought to exclude CD69 from our analysis both in vivo and in vitro. The new results are presented now in the revised Figures 1A-H, S1-C, 6K-Q, and S7A-B. Together with the experiments conducted for the first version we believe we present compelling evidence that CD8 T cell activation is compromised under systemic hypoxia. To account for the influence of systemic exposure to low oxygen on T cell proliferation and mitochondrial-biogenesis we further developed our in vivo model. Mice were primed with LV-OVA. Three days after the viral challenge, mice were adoptively-transferred with CellTrace-labeled splenocytes from OT1/mito-Dendra2 double transgenic mice. Mice were then either kept in 8% oxygen levels for 24 hours and then transferred to atmospheric oxygen pressure for another 48 hours, or continuously kept for 72 hours in atmospheric or 8% oxygen levels. Using this approach we could directly show that low oxygen levels lead to impaired antigen-specific T cell proliferation and mitochondrial-biogenesis by analyzing CellTrace and Dendra2 intensities respectively. This key finding demonstrates that effects caused by systemic hypoxia on T cell activation are reversible and supports the notion that a short exposure to atmospheric oxygen pressure can rescue hypoxic T cells. The new results are presented now in the revised Figures 6F-J. Numeros studies examined the effect of hypoxia on effector function of T cells. The primary focus of this paper is to understand how systemic hypoxia mechanistically affects CD8 T cell priming. We therefore thought that screening effector molecules (cytokines, grenzym), either in vitro or in vivo, will be a distraction from the primary focus of the paper. Importantly, effector molecules secretion is localized at the site of inflammation, our model was designed to examine cells in the draining lymph nodes. These CD8 T cell samples are not suitable for effector molecules phenotyping. Finally, examination of effector molecules in the small population of cells that did activate under systemic hypoxia will represent a biased phenotyping of selective cells. We therefore ask to leave effector molecules phenotyping out of the current paper. 3) In order to enhance the observations on AMPK signaling (Figure 3), it would be useful to include treatment with AMPK inhibitors in order to conclude that activated AMPK signaling is independent of the impaired activation upon respiratory restriction. We used p-AMPK to show that the lack of ATP is not sensed differently in T-Late and T-Early and therefore is not correlated with impaired activation of T-Early. Nevertheless, following the reviewers' comment we treated T cells at different time points following activation with Compound C (also called dorsomorphin) an AMPK inhibitor. Unfortunately, naïve CD8+ T cells, T-Early, and T-Late cells all died following the treatment. These results indicate that both fully-activated and naïve T cells require functional AMPK to complete their activation. 4) While investigating the role of ATP transportation, it would be best to examine the activation phenotypes in ANT2-depleted or Bongkrekic acid-treated T-Early and T-Late T cells upon oligomycin treatment or hypoxia conditions Figures 3D-G). The revised Figures 3D-G now include oligomycin treatment of ANT2KO cells. 5) The impaired cellular processes observed in T-Early, not in T-Late, T cells (Figure 4) could indicate either that mitochondrial-biogenesis is ongoing and essential for the early phase of T cell activation and is less critical in T-Late cells, or that these cellular processes in T-Late cells are independent of respiratory restriction. Data comparing these cellular processes in untreated T-Early and T-Late cells to test if mitobiogenesis has already declined in T-Late cells in comparison with T-Early cells would be useful to distinguish between these. Thus, for example, in Figure 4C, all groups could be normalised to the untreated 9 h group. Similarly, with respect to the importance of mitobiogenesis in the development of tolerance, it would be useful to examine mitobiogenesis or mitochondrial mass in T-Early and T-Late cells in Figure 4A. Following the reviewers' comments, we added new data which include: 1) Influence of hypoxia on mitobiogenesis in T-Early: mtDendra2-derived derived CD8+ T cells transferred to hypoxic chamber 5h after activation demonstrated a significant reduction in Dendra2 intensity in comparison to cells (Figure 4C-D). 2) Influence of oligomycin treatment on mitobiogenesis in T-Early: at early CD8+ T cell activation abrogated activation (Figure 4E-F) and inhibited the increase in mitochondrial mass observed in control mtDendra2-derived CD8+ T cells (Figure 4G-H). 3) Influence of oligomycin treatment on mitobiogenesis in T-Late with respect to their proliferation status: we observed a substantially higher Dendra2 intensity in proliferating T-Late with respect to undivided T-Late (Figure 4I). Overall these findings support the conclusion that respiratory restriction inhibits activation by disrupting mitochondrial-biogenesis in T-Early. Notably, we observed no reduction in dendra2 signal following oligomycin treatment in proliferating T-Late, suggesting that T-Late cells maintain mitochondrial-biogenesis during cell division independent of oxygen levels. 6) In the examination of cell size, CD25 expression and proliferation in oligomycin-treated T cells (Figure 2A), analyses of percentages of CD44- and CD25-positive cells and the expression levels of the activation markers in activated T cells would be very useful. We revised Figures, 1I-J, S1D-E, 2B-C, 2G-H, 4A-B, 4E-F, 5A-B, and 6B-C, to include representative flow cytometry plots of FSC vs. CD25 gated on CD8+ T cells. We included gates that will show the % of the CD25+ cells and added bar graphs that will show a summary of the % CD25+ cells in all of the replicates. As for the CD44 staining: since we have redone all of the in vivo experiments we included CD44 staining. Our initial in vitro analyses did not include CD44. Therefore adding CD44 as an additional activation marker will require to repeat most of our in vitro experiments. Importantly, CD44 is elevated late in the activation process in vitro and highly expressed in mature naive, memory-like cells, independent of activation signal. Given CD44 ambiguity as an activation marker we ask not to include CD44 as a marker for activation to our in vitro analyses. 7) In Figure 6, there appears to be some confusion that needs clarification. The bar graph in Figure 6F shows higher levels of effector T cells (CD62L-) in mice kept under hypoxia, which is the opposite of what the authors claim. In Figure 6G, showing CD62L expression in antigen-specific CD8 T cells, the authors claim that the data are showing reduced CD62L expression in mice exposed to high oxygen. However, the difference in the presented histograms seem to be in the number of cells acquired. We truly apologize for this mistake. As we have redone the entire in-vivo experimentation using a new model we now present totally revised Figure 6. 8) The language in the manuscript is very difficult to follow, and revision would be very helpful. Careful editing is also needed; an example is of panels that are mentioned in the text but are missing from the figures (S3B-S3G). The comments are well taken. We revised the manuscripts and sent it to a professional editing. [Editors' note: further revisions were suggested prior to acceptance, as described below.] Revisions for this paper: 1) The use of oligomycin to mimic hypoxia remains a problem, since it does not simply mimic hypoxia. If it can be achieved, it is very advisable to perform these experiments with hypoxia. At the very least, the conclusions of this manuscript should be toned down substantially in the interim. We used Oligomycin to distinguish between the indirect effects mediated by the inhibition of the electron transport chain and the TCA cycle, and the direct effect, as a result of reduced mitochondrial ATP. This cannot be achieved using hypoxia. However, we do agree with the reviewers that Oligomycin does not simply mimic hypoxia, and therefore ideally some of these experiments should be performed under hypoxic conditions. Specifically, it could be interesting to examine whether ATP-dependent matrix processes are also inhibited under hypoxic conditions. However, in practice, these experiments will require the development of complex new protocols and the acquisition of suitable devices. The major challenge in conducting these experiments under hypoxic conditions is to capture the immediate effects of hypoxia, 1-2 hours post-induction. The time taken for hypoxia to be induced varies due to multiple factors such as medium oxygen saturation, volume, chamber pressure, etc. As with other T cell signaling experiments, the result is dependent on a robust and homogeneous readout. This is hard to achieve with hypoxic chamber settings. We are currently working to develop the protocols and settings required to perform the suggested experiments and intend to explore this issue further in our follow up work. As for our current work, we followed the reviewer request to tone down substantially the conclusions by adding the following remark in the Discussion: "Notably, some of these mechanistic observations regarding the inhibitory effect mediated by an acute respiratory restriction on CD8+ T cell activation were based on the application of oligomycin. Since oligomycin, only partially mimics hypoxia, follow-up work should look further into mechanistic effects induced by hypoxia induction.” 2) The cell death of early activated naive T cells induced by compound C may be a dosage-related artificial result. It is not clear whether the authors examine different doses. Some controls should be included to make the conclusion made. At the very least, the authors need to tone done their conclusions of these data in the interim. We would like to note that AMPK signaling is not the focus of this current study. We used AMPK activation only as a marker, a proxy for the sensing of low ATP, high AMP levels in the cytosol. We note that AMPK signaling is important for T cell activation and metabolic adaptation. However, we state that under our specific experimental conditions AMPK activation levels in oligomycin-treated T-Early and T-Late cells are similar. We then claim that AMPK activation is not correlated with T-Early cells' sensitivity to respiratory restriction. Our observation that acute AMPK inhibition by Compound C treatment (we used several concentrations, 1, 5, 10, and 20 µM) leads to T cell death is in line with previous a study, Rao et al., 2016. showed that Compound C promotes, Ca2+ signaling-induced T cell death in an AMPK-dependent manner. Moreover, this result actually emphasizes that AMPK activation is a key component in the metabolic adaptation of T cells and highly supports a previous study from Blagih et al., 2015. We agree that our observation highlights the need to further assess the role of AMPK in T cells metabolic adaptation under chronic hypoxia conditions. To this end, we aim to generate T cell-specific AMPK knockout mice that we think will be a much more suitable tool than AMPK inhibitors. As for our current work, we followed the reviewer request to tone down substantially the conclusions by stating in the Results section that our "results suggest that despite the important role of AMPK signaling in T cell metabolic adaptation (Blagih et al., 2015), it is not correlated with the inhibitory effects mediated by respiratory restriction in early activation".
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
AntibodyAnti-mouse-CD8α (Rat Monoclonal) clone 53–6.7BiolegendCat# 10071 Cat# 10072 Cat# 10072FACS 1:500
AntibodyAnti-mouse-CD44 (Rat Monoclonal) clone IM7BiolegendCat# 10452FACS 1:1000
AntibodyAnti-mouse-CD69 (Armenian Hamster Monoclonal) clone H1.2F3BiolegendCat# 10451FACS 1:500
AntibodyAnti-mouse-CD25 (Rat Monoclonal) clone 3C7BiolegendCat# 10190FACS 1:500
AntibodyAnti-mouse-CD62L (Rat Monoclonal) clone MEL-14BiolegendCat# 10441FACS 1:500
AntibodyAnti-mouse TCR Vα2 (Rat Monoclonal) clone B20.1BiolegendCat# 12780FACS 1:1000
AntibodyAnti-mouse-Ki67 (Rat Monoclonal) clone 16A8BiolegendCat# 652423FACS 1:100
AntibodyPurified anti mouse-C3ϵ (Armenian Hamster monoclonal) clone 145–2 C11BiolegendCat# 100340Activation 0.1 μg/ml
AntibodyPurified anti mouse-CD28 (Syrian Hamster monoclonal) clone 37.51BiolegendCat# 102116Activation 0.1 μg/ml
AntibodyPurified anti-human-CD3ϵ (Mouse monoclonal) clone OKT3BiolegendCat# 317326Activation 0.1 μg /ml
AntibodyPurified anti-human-CD28 (Mouse monoclonal) clone CD28.2BiolegendCat# 302934Activation 0.1 μg/ml
AntibodyAnti-human-CD8α (Mouse monoclonal) clone HIT8aBiolegendCat# 30090FACS 1:400
AntibodyAnti-human-CD25 (Mouse monoclonal) clone M-A251BiolegendCat# 35610FACS 1:500
AntibodyAnti-mouse AMPKα (Rabbit monoclonal)Cell SignallingCat# 2532WB 1:1000
AntibodyAnti-mouse phospho-AMPKα (Rabbit monoclonal)Cell SignallingCat#: 2531WB 1:1000
AntibodyDonkey Anti-Rabbit IgG H and L (HRP) (Donkey polyclonal)abcamCat# ab97085WB 1:10000
AntibodyAnti-Ubiquitin (Mouse monoclonal) clone FK2Merck-MilliporeCat# ST1200IP 2 μg
Chemical compound, drugOligomycin ACayman ChemicalsCat# 113421 nM - 1 μM
Chemical compound, drugRotenoneCayman ChemicalsCat# 139951 μM
Chemical compound, drugAntimycin ACayman ChemicalsCat# 194331 μM
Chemical compound, drugFCCPCayman ChemicalsCat# 152181 μM
Chemical compound, drugBongkrekic Acid (ammonium salt)Cayman ChemicalsCat# 190791 μM - 2 μM
Chemical compound, drugEZview Red Protein G Affinity GelSigma-AldrichCat# E3403
Chemical compound, drugProtease Inhibitor CocktailSigma-Aldrich IsraelP8340WB and IP 1:100
Sequence-based reagentUbc FThis paperPCR primersGCCCAGTGTTACCACCAAGA
Sequence-based reagentUbc RThis paperPCR primersCCCATCACACCCAAGAACA
Sequence-based reagentRpl13 FThis paperPCR primersATGACAAGAAAAAGCGGATG
Sequence-based reagentRpl13 RThis paperPCR primersCTTTCCTGCCTGTTTCCGTA
Sequence-based reagentmt-Rnr FThis paperPCR primersCATACTGGAAAGTGTGCTTGGA
Sequence-based reagentmt-Rnr RThis paperPCR primersGTGTAGGGCTAGGGCTAGGA
Sequence-based reagentmt-Rnr1 FThis paperPCR primersACCGCGGTCATACGATTAAC
Sequence-based reagentmt-Rnr1 RThis paperPCR primersCCCAGTTTGG GTCTTAGCTG
Sequence-based reagentmt-Rnr2 FThis paperPCR primersGGGATAACAGCGCAATCCTA
Sequence-based reagentmt-Rnr2 RThis paperPCR primersGATTGCTCCGGTCTGAACTC
Commercial assay, kitMitoProbe TMRM Assay Kit for Flow CytometryThermo Fischer:Cat# M20036FACS 50 nM
Commercial assay, kitProteaseMAX SurfactantPromega CorpCat# V2071
Commercial assay, kitCellTrace Violet Cell Proliferation Kit, for flow cytometryThermo Fischer: Molecular ProbesCat# C34571FACS 1:100
Commercial assay, kitEasySep Mouse CD8+T Cell Isolation KitSTEMCELL TechnologiesCat# 19853A
Commercial assay, kitDirect-zol RNA MiniPrep PlusZymo ResearchCat# R2071
Commercial assay, kitProtoScript First Strand cDNA Synthesis KitNew England BioLabs, IncCat# E6300L
Commercial assay, kitPower SYBR Green PCR Master MixApplied BiosystemsCat# 4367660
Strain, strain background Mus musculusC57BL/6JJackson LaboratoryStock No: 000664Wild type
Strain, strain background Mus musculusSlc25a5tm1.1Nte/JJackson LaboratoryStock No: 029482ANT2flox/lox
Strain, strain background Mus musculusC57BL/6-Tg(TcraTcrb)1100Mjb/JJackson LaboratoryStock No: 003831OT1
Strain, strain background Mus musculusB6.Cg-Tg(Lck-cre)1CwiN9 (Lck-Cre)TaconicModel # 4197Lck-Cre
Strain, strain background Mus musculusGt(ROSA)26Sortm1.1(CAG-Mito-Dendra2) DccDr. Tsvee Lapidot from the Weizmann Institute of Sciencemito-Dendra2
Recombinant DNA reagentLv-OVA-GFPDr. Avihai Hovav from the Hebrew University of JerusalemOvalbumin and GFP expressing lentiviral plasmid
Recombinant DNA reagentpCMV-VSV-Ga gift from Bob Weinberghttps://www.addgene.org/8454/Addgene Plasmid #8454VSV-G envelope expressing plasmid
Recombinant DNA reagentpsPAX2a gift from Didier Trono https://www.addgene.org/12260/Addgene Plasmid #12260Lentiviral packaging plasmid
Software, algorithmKaluza softwareBeckman CoulterFACS acquisition software
Software, algorithmFACS Express 6De Novo SoftwareFACS analysis software
Software, algorithmSeahorse WaveAgilentOCR and EACAR analysis
Software, algorithmPerseusMetabolic and proteomic analysis
Software, algorithmPrism 8GraphPadGraphs and Heatmaps, statistical analysis
Software, algorithmThermo XcaliburThermo Fisher ScientificMetabolomics LC-MS data acquisition
Software, algorithmTraceFinder 4.1Thermo Fisher ScientificMetabolomics LC-MS data analysis
GeneForwardReverse
UbcGCCCAGTGTTACCACCAAGACCCATCACACCCAAGAACA
Rpl13ATGACAAGAAAAAGCGGATGCTTTCCTGCCTGTTTCCGTA
mt-RnrCATACTGGAAAGTGTGCTTGGAGTGTAGGGCTAGGGCTAGGA
mt-Rnr1ACCGCGGTCATACGATTAACCCCAGTTTGGGTCTTAGCTG
mt-Rnr2GGGATAACAGCGCAATCCTAGATTGCTCCGGTCTGAACTC
  45 in total

1.  The role of skin-derived dendritic cells in CD8+ T cell priming following immunization with lentivectors.

Authors:  Karina Furmanov; Mazal Elnekave; Dan Lehmann; Bjorn E Clausen; Darrell N Kotton; Avi-Hai Hovav
Journal:  J Immunol       Date:  2010-03-31       Impact factor: 5.422

2.  The Human Mitochondrial DEAD-Box Protein DDX28 Resides in RNA Granules and Functions in Mitoribosome Assembly.

Authors:  Ya-Ting Tu; Antoni Barrientos
Journal:  Cell Rep       Date:  2015-02-13       Impact factor: 9.423

3.  Rapid effector function of memory CD8+ T cells requires an immediate-early glycolytic switch.

Authors:  Patrick M Gubser; Glenn R Bantug; Leyla Razik; Marco Fischer; Sarah Dimeloe; Gideon Hoenger; Bojana Durovic; Annaïse Jauch; Christoph Hess
Journal:  Nat Immunol       Date:  2013-08-18       Impact factor: 25.606

Review 4.  Hypoxia and mitochondrial oxidative metabolism.

Authors:  Giancarlo Solaini; Alessandra Baracca; Giorgio Lenaz; Gianluca Sgarbi
Journal:  Biochim Biophys Acta       Date:  2010-02-11

5.  Mitochondrial ATP transporter Ant2 depletion impairs erythropoiesis and B lymphopoiesis.

Authors:  J Cho; J Seo; C H Lim; L Yang; T Shiratsuchi; M-H Lee; R R Chowdhury; H Kasahara; J-S Kim; S P Oh; Y J Lee; N Terada
Journal:  Cell Death Differ       Date:  2015-01-23       Impact factor: 15.828

6.  The energy sensor AMPK regulates T cell metabolic adaptation and effector responses in vivo.

Authors:  Julianna Blagih; François Coulombe; Emma E Vincent; Fanny Dupuy; Gabriela Galicia-Vázquez; Ekaterina Yurchenko; Thomas C Raissi; Gerritje J W van der Windt; Benoit Viollet; Erika L Pearce; Jerry Pelletier; Ciriaco A Piccirillo; Connie M Krawczyk; Maziar Divangahi; Russell G Jones
Journal:  Immunity       Date:  2015-01-02       Impact factor: 31.745

7.  Hypoxia-inducible factor regulates survival of antigen receptor-driven T cells.

Authors:  Yuichi Makino; Hiroshi Nakamura; Eiji Ikeda; Kei Ohnuma; Kenji Yamauchi; Yutaka Yabe; Lorenz Poellinger; Yasunori Okada; Chikao Morimoto; Hirotoshi Tanaka
Journal:  J Immunol       Date:  2003-12-15       Impact factor: 5.422

8.  Chronic Hypoxemia in Children With Congenital Heart Defect Impairs Airway Epithelial Sodium Transport.

Authors:  Anu K Kaskinen; Otto Helve; Sture Andersson; Turkka Kirjavainen; Laura Martelius; Ilkka P Mattila; Paula Rautiainen; Olli M Pitkänen
Journal:  Pediatr Crit Care Med       Date:  2016-01       Impact factor: 3.624

Review 9.  Hypoxemia in patients with COPD: cause, effects, and disease progression.

Authors:  Brian D Kent; Patrick D Mitchell; Walter T McNicholas
Journal:  Int J Chron Obstruct Pulmon Dis       Date:  2011-03-14

Review 10.  Hypoxia and antitumor CD8+ T cells: An incompatible alliance?

Authors:  Romain Vuillefroy de Silly; Pierre-Yves Dietrich; Paul R Walker
Journal:  Oncoimmunology       Date:  2016-09-09       Impact factor: 8.110

View more
  1 in total

Review 1.  CD8+ T Cells in SARS-CoV-2 Induced Disease and Cancer-Clinical Perspectives.

Authors:  Keywan Mortezaee; Jamal Majidpoor
Journal:  Front Immunol       Date:  2022-04-01       Impact factor: 8.786

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.