| Literature DB >> 33200041 |
Mark S LeDoux1,2.
Abstract
Background: Myoclonus-Dystonia (M-D) is a pleiotropic neuropsychiatric disorder of variable penetrance. Pathogenic variants in SGCE, a maternally imprinted gene, are the most frequent known genetic cause of M-D. The population prevalence of SGCE-linked M-D is unknown, the pathogenicity of SGCE variants identified in patients with M-D may be indeterminant, and SGCE variants predicted to be deleterious by in silico analysis may appear in patients undergoing whole-exome or whole-genome sequencing for seemingly unrelated disorders. The Genome Aggregation Database (gnomAD) v2 provides variant data on 125,748 exomes and 15,708 genomes from unrelated individuals sequenced as part of various disease-specific and population genetic studies.Entities:
Keywords: SGCE; dystonia; missense pathogenic variant; myoclonus; splice-site pathogenic variant; stop-gained pathogenic variant
Year: 2020 PMID: 33200041 PMCID: PMC7646276 DOI: 10.5334/tohm.567
Source DB: PubMed Journal: Tremor Other Hyperkinet Mov (N Y) ISSN: 2160-8288
In silico analysis of published SGCE MDS-linked variants.
| Transcript Description | Annotation | Protein Description | Genomic Description | gnomAD Alleles | CADD PHRED | REVEL rankscore | MetaLR rankscore | Reference |
|---|---|---|---|---|---|---|---|---|
| NM_001099401.1:c.966delT | indel/frameshift/stop | NP_001092871.1:p.(Val323CysfsTer11) | GRCh37:7:94230028:CA:C | 0 | 29.8 | NA | NA | Schule et al. 2004 [ |
| NM_001099401.1:c.179A>G | missense | NP_001092871.1:p.(His60Arg) | GRCh37:7:94259084:T:C | 0 | 25.4 | 0.979 | 0.983 | Schule et al. 2004 [ |
| NM_001099401.1:c.232+2T>C | splice | NP_001092871.1:p.? | GRCh37:7:94259029:A:G | 0 | 33 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1: c.233-1G>T | splice | NP_001092871.1:p.? | GRCh37:7:94257672:C:A | 0 | 35 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1: c.232+1G>A | splice | NP_001092871.1:p.? | GRCh37:7:94259030:C:T | 0 | 33 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1: c.1114C>T | nonsense/stop | NP_001092871.1:p.(Arg372Ter) | GRCh37:7:94228226:G:A | 0 | 41 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.300G>A | nonsense/stop | NP_001092871.1:p.(Trp100Ter) | GRCh37:7:94257604:C:T | 0 | 37 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.208G>T | nonsense/stop | NP_001092871.1:p.(Glu70Ter) | GRCh37:7:94259055:C:A | 0 | 40 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.812G>A | missense | NP_001092871.1:p.(Cys271Tyr) | GRCh37:7:94232615:C:T | 1 | 35 | 0.986 | 0.994 | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.344A>G | missense | NP_001092871.1:p.(Tyr115Cys) | GRCh37:7:94257560:T:C | 0 | 27.8 | 0.997 | 0.992 | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.742_745dup | indel/frameshift/stop | NP_001092871.1:p.(Ser249MetfsTer2) | GRCh37:7:94232681:C:CTACA | 0 | 33 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.835_839del | indel/frameshift/stop | NP_001092871.1:p.(Thr279AlafsTer17) | GRCh37:7:94230155:CTTTGT:C | 0 | 32 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.444_447del | indel/stop | NP_001092871.1:p.(Asn149Ter) | GRCh37:7:94252652:TATTA:T | 0 | 33 | NA | NA | Du Montcel et al. 2006 [ |
| NM_001099401.1:c.107C>G | missense | NP_001092871.1:p.(Thr36Arg) | GRCh37:7:94285304:G:C | 0 | 24 | 0.852 | 0.962 | Raymond et al. 2008 [ |
| NM_001099401.1:c.551T>C | missense | NP_001092871.1:p.(Leu184Pro) | GRCh37:7:94248181:A:G | 0 | 23.8 | 0.987 | 0.995 | Raymond et al. 2008 [ |
| NM_001099401.1:c.662G>A | missense | NP_001092871.1:p.(Gly221Asp) | GRCh37:7:94248070:C:T | 0 | 34 | 0.987 | 0.995 | Peall et al. 2014 [ |
| NM_001099401.1:c.109+5G>C | splice | NP_001092871.1:p.? | GRCh37:7:94285297:C:G | 0 | 23.9 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.289C>T | nonsense/stop | NP_001092871.1:p.(Arg97Ter) | GRCh37:7:94257615:G:A | 1 | 29.8 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.463+1G>A | splice | NP_001092871.1:p.? | GRCh37:7:94252636:C:T | 0 | 35 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.630_658del | indel/frameshift/stop | NP_001092871.1:p.(Val211GlyfsTer20) | GRCh37:7:94248073:TCCTTCAGGTCATTAATGGGAAGTGGCACC:T | 0 | 33 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.765_773del | indel/in-frame | NP_001092871.1:p.(Ile256_Cys258del) | GRCh37:7:94232653:ACATGTTATT:A | 0 | 21.2 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.771_772del | indel/stop | NP_001092871.1:p.(Cys258Ter) | GRCh37:7:94232654:CAT:C | 0 | 32 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.835_839del | indel/frameshift/stop | NP_001092871.1:p.(Thr279AlafsTer17) | GRCh37:7:94230155:CTTTGT:C | 0 | 32 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.1037+5G>A | splice | NP_001092871.1:p.? | GRCh37:7:94229953:C:T | 0 | 25.7 | NA | NA | Peall et al. 2014 [ |
| NM_001099401.1:c.1114C>T | nonsense/stop | NP_001092871.1:p.(Arg372Ter) | GRCh37:7:94228226:G:A | 0 | 41 | NA | NA | Peall et al. 2014 [ |
GnomAD v2 SGCE variants.
| CADD | # Variants | Total alleles* | Total individuals** | Population ratio | US population 330,270,291*** | US cases corrected for imprinting |
|---|---|---|---|---|---|---|
| ≥30 | 23 variants | 56 | 56 | 1/2454 | 130,851 | 65,426 |
| ≥25 | 92 variants | 408 | 406 | 1/348 | 948,817 | 474,409 |
| ≥20 | 265 variants | 1,250 | 1,243 | 1/114 | 2,904,876 | 1,452,438 |
| >0 | 780 variants | 134,145 | 113,162 | 1/1.25 | 264,458,345 | 1,3222,917 |
* max: 282,646. ** correction for homozygotes. *** Based on US Census Bureau estimates.
Variant annotation and CADD scores (gnomAD v2).
| CADD ≥30 | CADD ≥25 & <30 | CADD ≥20 & <25 | ||||
|---|---|---|---|---|---|---|
| Annotation | Number of variants | Total alleles | Number of variants | Total alleles | Number of variants | Total alleles |
| Stop | 3 | 3 | 2 | 24 | 0 | 0 |
| Frameshift | 4 | 4 | 0 | 0 | 1 | 1 |
| Splice | 4 | 14 | 1 | 1 | 4 | 6 |
| Missense | 12 | 35 | 66 | 327 | 133 | 743 |
| Synonymous | 0 | 0 | 0 | 0 | 7 | 30 |
| Intronic | 0 | 0 | 0 | 0 | 9 | 20 |
| Start lost | 0 | 0 | 0 | 0 | 1 | 1 |
| 5’UTR | 0 | 0 | 0 | 0 | 15 | 32 |
| 3’UTR | 0 | 0 | 0 | 0 | 0 | 0 |
| In-Frame Insertion/Deletion | 0 | 0 | 0 | 0 | 3 | 9 |
| All variants | 23 | 56 | 69 | 352 | 173 | 842 |
MetaLR, REVEL and CADD scores for 237 missense variants.
| High Score | Low Score | Median Score | |
|---|---|---|---|
| MetaLR_rankscore* | 0.99 | 0.95 | 0.97 |
| REVEL_rankscore | 0.99 | 0.54 | 0.87 |
| CADD_PHRED | 34.00 | 14.45 | 23.20 |
* MetaLR (D-disease causing, Reliability_index of 9 or 10).