| Literature DB >> 33195629 |
Hans-Peter Fuehrer1, Ana Margarida Alho2, Feodora Natalie Kayikci1, Bita Shahi Barogh1, Hugo Rosa3, José Tomás3, Hugo Rocha3, Josef Harl4, Luís Madeira de Carvalho2.
Abstract
Vector-borne diseases of zoonotic and/or veterinary relevance have been increasingly reported in horses globally, although data regarding working and military horses is lacking. Portuguese military horses may constitute a risk group for these pathogens, as they frequently work outdoors in various regions of the country. This study included 101 apparently healthy horses belonging to the Portuguese National Republican Guard. Blood samples were analyzed to determine the presence and prevalence of piroplasms, Anaplasmataceae, Rickettsia spp., and filarioid helminths. Overall 32.7% of the horses gave positive results for Theileria equi. Two genotypes of T. equi were verified. No positive results were recorded for Anaplasma spp., Rickettsia spp., filarioid helminthes, and Babesia caballi. As equine piroplasmosis is a severe infectious tick-borne disease responsible for significant losses in equine production and with numerous impacts in the international movement of horses, adequate treatment, and preventive measures are needed to reduce exposure to vectors and future infections.Entities:
Keywords: Portugal; Theileria equi; equine piroplasmosis; military horses; vector-borne diseases; zoonosis
Year: 2020 PMID: 33195629 PMCID: PMC7593411 DOI: 10.3389/fvets.2020.591943
Source DB: PubMed Journal: Front Vet Sci ISSN: 2297-1769
Primer sequences and PCR protocols used for molecular analysis of vector-borne pathogens in military horses.
| Piroplasms | BTH-1F: CCTGAGAAACGGCTACCACATCT | 94°C: 2 min, | ~700 | ( | |
| B-For: GACTAGGGATTGGAGGTC | 94°C: 2 min, | ~650 | ( | ||
| Anaplasmataceae | EHR16SD: GGTACCYACAGAAGAAGTCC | 95°C: 2 min, | 345 | ( | |
| ITS-F: GATAGGTCGGGTGTGGAAG | 96°C: 4 min, 35 cycles - 94°C: 1 min, 52°C: 1 min, 72°C: 2 min, 72°C: 3 min | 350–550 | ( | ||
| Filarioid nematodes | mt | H14FilaCO1Fw: GCCTATTTTGATTGGTGGTTTTGG | 95°C: 2 min, | 724 | ( |
Figure 1Bayesian inference tree of T. equi lineages based on 530 bp sections of the 18S. The BI posterior probabilities and ML bootstrap values are indicated at most nodes. The scale bar indicates the expected mean number of substitutions per site according to the model of sequence evolution applied. Asterisks mark the lineages isolated from horses in Portugal in the present study. As outgroup a sequence of Theileria ovis (AY533144) was included.