BACKGROUND: Patients with anaplastic thyroid cancer (ATC), which is among the deadliest of all cancers, often have a poor response to traditional therapies. Currently, the role of long non-coding RNAs (lncRNAs) in ATC carcinogenesis is unclear. In this study, we analyzed the lncRNA expression profile of ATC with the aim of identifying potential molecular targets for treatment of the disease. METHODS: Whole transcriptome sequencing of three ATC and two normal thyroid (NT) samples was performed, and the lncRNA expression profile of ATC was analyzed. Original data as well as datasets deposited in the Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA) were used for clinical validation. Cell proliferation, Transwell, and apoptosis assays were performed using ATC cell lines. Gene Ontology (GO) and gene set enrichment analyses (GSEA) were performed to determine the dysregulated pathways. RESULTS: Whole transcriptome sequencing revealed 182 lncRNAs to be differentially expressed in ATC. One of the lncRNAs, mitotically associated long non-coding RNA (MANCR; LINC00704), was significantly overexpressed in ATC cell lines and patient samples compared with NT and papillary thyroid cancer (PTC). MANCR depletion in ATC cells significantly inhibited cancer cell proliferation and invasion, and induced apoptosis. By further analyzing the transcriptome data, we identified 451 genes co-expressed with MANCR. GO and GSEA showed that the top dysregulated pathways were related to mitosis and cell cycle. CONCLUSIONS: MANCR is a tumor promoter in ATC, and its role in carcinogenesis is possibly associated with cell cycle regulation. Because MANCR expression is minimal in most normal tissues, it may serve as a potential target in the future treatment of ATC. 2020 Annals of Translational Medicine. All rights reserved.
BACKGROUND: Patients with anaplastic thyroid cancer (ATC), which is among the deadliest of all cancers, often have a poor response to traditional therapies. Currently, the role of long non-coding RNAs (lncRNAs) in ATC carcinogenesis is unclear. In this study, we analyzed the lncRNA expression profile of ATC with the aim of identifying potential molecular targets for treatment of the disease. METHODS: Whole transcriptome sequencing of three ATC and two normal thyroid (NT) samples was performed, and the lncRNA expression profile of ATC was analyzed. Original data as well as datasets deposited in the Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA) were used for clinical validation. Cell proliferation, Transwell, and apoptosis assays were performed using ATC cell lines. Gene Ontology (GO) and gene set enrichment analyses (GSEA) were performed to determine the dysregulated pathways. RESULTS: Whole transcriptome sequencing revealed 182 lncRNAs to be differentially expressed in ATC. One of the lncRNAs, mitotically associated long non-coding RNA (MANCR; LINC00704), was significantly overexpressed in ATC cell lines and patient samples compared with NT and papillary thyroid cancer (PTC). MANCR depletion in ATC cells significantly inhibited cancer cell proliferation and invasion, and induced apoptosis. By further analyzing the transcriptome data, we identified 451 genes co-expressed with MANCR. GO and GSEA showed that the top dysregulated pathways were related to mitosis and cell cycle. CONCLUSIONS: MANCR is a tumor promoter in ATC, and its role in carcinogenesis is possibly associated with cell cycle regulation. Because MANCR expression is minimal in most normal tissues, it may serve as a potential target in the future treatment of ATC. 2020 Annals of Translational Medicine. All rights reserved.
Entities:
Keywords:
Long non-coding RNA (lncRNA); anaplastic; oncogenesis; thyroid carcinoma
Anaplastic thyroid cancer (ATC), one of the deadliest of all cancers, is responsible for as much as 14–39% of mortality caused by thyroid cancer (1,2). Approximately 50% of ATC patients present with distant metastasis, and the disease has a median survival of a mere 5 months (3,4). ATC responds poorly to traditional therapies; however, dabrafenib and trametinib is the first targeted regimen to receive approval by FDA and achieved an overall response rate of 69% in a phase II clinical trial,, significantly improving the survival of ATC patients with BRAF mutation (5). Thus, understanding the molecular mechanisms underlying the initiation and progression of ATC is important and would help us to identify potential molecular targets for treating the disease.Owing to the rarity of ATC and its extensive infiltration by macrophages, studying the genetic landscape of ATC presents a significant challenge (6). Several studies based primarily on genomic analyses have reported multiple mutations in oncogenes and tumor suppressors in ATC (7,8). Recent studies have shown that the TERT promoter mutation was one of the most frequently identified mutations in ATC along with the BRAFV600E and RAS mutations (9). Nevertheless, only 3% of RNAs are protein-coding messenger RNAs and the rest 97% RAN molecules are non-coding RNAs (ncRNAs) (10).Long non-coding RNAs (lncRNAs) are a class of ncRNAs that exceed 200 nt in length. LncRNAs are widely expressed in human tissues and are strongly associated with cancer progression (11). HATAIR, for instance, which is a lncRNA that is overexpressed in multiple cancers, promotes cancer invasiveness and metastasis via interaction with PRC2 and silencing of anti-metastatic genes (12). However, the role of lncRANs in ATC tumorigenesis is unclear. Recently, a small number of lncRNAs have been linked with ATC. One study identified a low expression of the lncRNA PTCSC3 in ATC tissues and cells. Meanwhile, the overexpression of PTCSC3 inhibited the drug resistance of ATC to doxorubicin via the STAT3/INO80 pathway (13). Another study identified 19 upregulated and 28 downregulated lncRNAs in 9 ATC samples compared with normal tissue. Of these lncRNAs, PAR5 exerted a tumor-suppressive effect in ATC by impairing the oncogenic activity of EZH2 (14).In the current study, we performed whole transcriptome sequencing of three ATC and two normal thyroid (NT) tissue samples and characterized the lncRNA expression profile of ATC. We subsequently defined the role of a lncRNA, mitotically associated long non-coding RNA (MANCR), in ATC. We believe that this study will reinforce our understanding of lncRNAs in the initiation and progression of ATC.We present the following article in accordance with the MDAR reporting checklist (available at http://dx.doi.org/10.21037/atm-20-4530).
Methods
Tissue samples and whole transcriptome sequencing
Three ATC and two NT tissue samples were sequenced. Total RNA from the samples using TRIzol reagent (Invitrogen Inc., CA, USA). Ribosomal RNA was removed from total RNA with Ribo-Zero Gold (Illumina, San Diego, CA, USA) before the construction of RNA-seq libraries. Comparisons of transcriptome library sequencing data and human reference genomes were performed with TopHat (http://tophat.cbcb.umd.edu/), and gene expression was quantified with HTSeq (https://pypi.org/project/HTSeq/). The sequencing data was mapped with TopHat2 software, and the expression counts of each lncRNA were determined by HTSeq. DEseq2 was used to analyze the differential expression profiles of the lncRNAs based on the gene counts.
Cell culture and transfection
Five ATC cell lines (SW1736, C643, CAL-62, BTH101, and 8305C), three papillary thyroid cancer (PTC) cell lines (TPC1, K1, and BCPAP), and one NT cell line (Nthy-ori3-1) were obtained for analysis. SW1736, 8305C, TPC1, and K1 were obtained from Cell Bank of University of Colorado Cancer Center; C643, CAL-62, BTH101, and BCPAP were obtained from the Typical Culture Preservation Commission Cell Bank, Chinese Academy of Sciences (Shanghai, China); and Nthy-ori 3-1 was purchased from Sigma-Aldrich, Inc. (MO, USA).The SW1736, C643, and BCPAP cells were grown in RPMI 1649 medium; the CAL-62, BTH101, K1, BCPAP, Nthy-ori3-1 cells were grown in DMEM medium; and the 8305C cells were grown in MEM medium. All cells were cultured with 10% heat-inactivated fetal bovine serum (FBS), 100 IU/mL penicillin, and 10 µg/mL streptomycin at 37 °C with 5% CO2. MANCR was knocked down in SW1736 cells with two ASOs designed by and purchased from Ribobio Co., Ltd (Guangzhou, China). (). MANCR overexpression construct was used to overexpress MANCR in SW1736 cells, and an empty vector was used as the negative control. After 24 h of transfection, all cells were harvested for further analysis.
Table S1
Primers and ASO sequences
MANCR
Sequence
qPCR forward primer
TCCACTCACCACTCGCTCACTG
qPCR reverse primer
CAGGATTAGCACGTTCCAGGTTCC
ASO1 target
CAGTGCAGTTTTCAGTTGTT
ASO2 target
CTCCTTTCTTACATATCCAC
MANCR, mitotically associated long non-coding RNA; qPCR, quantitative real time polymerase chain reaction.
qRT-PCR
Total RNA was extracted from cell lines using TRIzol reagent (Invitrogen, Inc.) following the manufacturer’s protocol. Next, a reverse transcription (RT) reaction was performed using PrimeScriptTM RT reagent kit (Takara Bio, Inc., Japan) to convert total RNA to cDNA, and cDNA templates were mixed with gene-specific primers for MANCR () and internal control β-actin. Then, quantitative real time polymerase chain reaction (qPCR) was carried out using ABI7900 HT Fast Real time system (Thermo Fisher Scientific Inc., MA, USA) to quantitate MANCR expression. Finally, the comparative Ct (2−ΔΔCt) method was used to analyze the threshold cycle (Ct) values.
CCK-8 assay
Cell proliferation was analyzed by cell counting Kit-8 (CCK-8) assay (Sigma-Aldrich; Merck KGaA). After 24 h of transfection, SW1736 cells were seeded in 96-well plates. An aliquot of 10 µL of CCK-8 solution was added to each well and the plate was incubated at 37 °C for 4 h. The absorbance reading was performed at 450 nm using a spectrophotometer (Thermo Scientific TM NanoDropTM 8000; Thermo Fisher Scientific, Inc., MA, USA) every 24 h. Five replicates were measured for each experimental group.
Transwell assay
Transwell assay (Corning, Tewksbury, MA, USA) was performed to evaluate cell invasion ability. Cells were seeded into the upper chamber of a Matrigel-coated (Sigma-Aldrich) insert, and medium containing 10% FBS was placed into the lower chamber as chemoattractant. After 24 h of incubation at 37 °C, the invaded cells were fixed with methanol and then stained with 0.5% crystal violet. The images of the cell were obtained with an IX71 inverted microscope (Olympus, Tokyo, Japan).
Apoptosis
Flow cytometry was used to analyze cell apoptosis 24 h after transfection. The collected cells were double stained with FITC-annexin V and propidium iodide (PI), and then analyzed using a flow cytometer (FACScan; BD Biosciences, NJ, USA) equipped with CellQuest software (BD Biosciences, NJ, USA). Apoptotic cells were marked based on Annexin V expression (Annexin V+/PI− and Annexin V+/PI+). Data from independent experiments performed in triplicate were studied to compare the number of apoptotic cells.
The Cancer Genome Atlas (TCGA) and GEO datasets
TCGA dataset for thyroid cancer was downloaded (https://www.cbioportal.org) (15). The raw data of the GSE29265 (9 ATC samples, 20 PTC samples, and 20 NT samples) and GSE65144 (12 ATC samples and 13 NT samples) datasets were retrieved from the Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) and analyzed using R software packages.
Statistical analysis
Data preparation and statistical analyses were performed using SPSS version 20.0 (Chicago, IL, USA), GraphPad Prism version 8.2.1 (La Jolla, CA, USA), gene set enrichment analyses (GSEA) version 4.0.3 (http://www.gsea-msigdb.org), and R version 3.6.2 (Vienna, Austria). One-way analysis of variance (ANOVA) and Student’s t-test were used for statistical comparisons. The Kaplan-Meier method and log-rank test were used for survival analysis. Two-tailed P values were adopted, with P<0.05 considered significant.
Results
LncRNA expression profiling in ATC
Whole transcriptome sequencing of three ATCs and two adjacent NT samples was conducted. In one case, the ATC had completely replaced the thyroid and therefore no adjacent NT was collected. The expression profiling of the lncRNAs is illustrated in . Of 11,085 sequenced lncRNAs, 182 lncRNAs were identified to be differentially expressed in ATC compared with NT. Among these lncRNAs, 67 were upregulated (P<0.05), and 115 were downregulated in ATC (P<0.05). Of the downregulated lncRNAs, PTCSC3 (P<0.001) was reported as a tumor suppressor in PTC (16), while the overexpression of PTCSC3 inhibited the drug resistance of ATC to doxorubicin (13). LINC00982 (P<0.001) was a divergent transcript of RDM16 and a biomarker for poor survival in lung adenocarcinoma and gastric cancer (17,18). Meanwhile, ADAMTS9-AS2 (P<0.001) was a tumor suppressor in multiple cancers and was associated with the PI3K/AKT pathway (19,20). Of the upregulated lncRNAs, mitotically associated long non-coding RNA (MANCR or LINC00704) (P=0.0016) was related to cell division in aggressive breast cancer (21).
Figure 1
Whole transcriptome sequencing and validation of lncRNA expression in ATC. (A) Cluster analysis and a heat map showing significantly differentially expressed lncRNAs in three ATCs compared with two adjacent NT samples; (B) a volcano plot identifying the differentially expressed lncRNAs in ATC; (C) validation of the expressions of SLC26A4-AS1, PWRN1, NKX2-1-AS1, LINC00982, SFTA1P, and ADAMTS9-AS2 in GEO datasets showed similar results with the sequencing data; (D) quantitative RT-PCR assays of the candidate lncRNA, MANCR, in one NT cell line (Nthy-ori3-1), three PTC cell lines, and five ATC cell lines showed that MANCR was overexpressed in all five ATC cell lines. *, P<0.05; **, P<0.01; ****, P<0.0001. ATC, anaplastic thyroid cancer; PTC, papillary thyroid cancer; NT, normal thyroid; ns, not significant; GEO, Gene Expression Omnibus.
Whole transcriptome sequencing and validation of lncRNA expression in ATC. (A) Cluster analysis and a heat map showing significantly differentially expressed lncRNAs in three ATCs compared with two adjacent NT samples; (B) a volcano plot identifying the differentially expressed lncRNAs in ATC; (C) validation of the expressions of SLC26A4-AS1, PWRN1, NKX2-1-AS1, LINC00982, SFTA1P, and ADAMTS9-AS2 in GEO datasets showed similar results with the sequencing data; (D) quantitative RT-PCR assays of the candidate lncRNA, MANCR, in one NT cell line (Nthy-ori3-1), three PTC cell lines, and five ATC cell lines showed that MANCR was overexpressed in all five ATC cell lines. *, P<0.05; **, P<0.01; ****, P<0.0001. ATC, anaplastic thyroid cancer; PTC, papillary thyroid cancer; NT, normal thyroid; ns, not significant; GEO, Gene Expression Omnibus.Next, the expressions of the differentially expressed lncRNAs were validated by combining the GSE29265 and GSE65144 datasets (21 ATC, 20 PTC and 33 NT). The expressions of SLC26A4-AS1, LINC00982, and NKX2-1-AS1 were significantly downregulated in ATC compared with NT (P<0.0001). The expression of ADAMTS9-AS2 was downregulated in ATC compared with PTC (P<0.01). These lncRNAs were tumor suppressors in ATC, as indicated by our sequencing data. SFTA1P was significantly overexpressed in ATC compared with PTC and NT, which indicated its role as an oncogene in ATC. The expressions of PWRN1 were not significantly different among the groups ().
Clinical validation of MANCR expression
The expressions of the differentially expressed lncRNAs were validated further using one NT, three PTC, and five ATC cell lines. Strikingly, the relative expression of MANCR was significantly increased in all 5 ATC cell lines compared with NT cell line (C643 P=0.0242; 8305C P=0.0096; SW1736 P<0.0001; CAL62 P<0.0001; and BTH101 P<0.0001). MANCR was also overexpressed in PTC cell line K1 (P=0.0332). However, there was no significant difference between MANCR expression in PTC cell line TPC1 (P=0.1229) and BCPAP (P=0.4444) and that in the NT cell line ().Since MANCR was not an annotated lncRNA in the GEO datasets, we used the TCGA 495 PTC cohort for clinical validation. MANCR overexpression was correlated with extrathyroidal extension (ETE, P=0.0029) and AJCC T stage IV (P=0.0009); however, it had no association with lymph node metastasis, distant metastasis, or disease-free survival ().
Figure 2
Clinical validation of MANCR expression. (A) In the TCGA 495 PTC patient dataset, MANCR was overexpressed in patients with ETE (P=0.0029) and T4 (P=0.0009); (B) in patient samples of PDTC (N=5), PTC (N=5), and NT (N=5), the expression of MANCR was significantly elevated in the PDTC samples compared with the NT (P=0.0107) and PTC samples (P=0.0106). *, P<0.05; **, P<0.01; ***, P<0.001. ns, not significant; PTC, papillary thyroid cancer; ETE, extrathyroidal extension; PDTC, poorly differentiated thyroid cancer; NT, normal thyroid.
Clinical validation of MANCR expression. (A) In the TCGA 495 PTC patient dataset, MANCR was overexpressed in patients with ETE (P=0.0029) and T4 (P=0.0009); (B) in patient samples of PDTC (N=5), PTC (N=5), and NT (N=5), the expression of MANCR was significantly elevated in the PDTC samples compared with the NT (P=0.0107) and PTC samples (P=0.0106). *, P<0.05; **, P<0.01; ***, P<0.001. ns, not significant; PTC, papillary thyroid cancer; ETE, extrathyroidal extension; PDTC, poorly differentiated thyroid cancer; NT, normal thyroid.Next, MANCR expression was validated using the sequencing data of poorly differentiated thyroid cancer (PDTC), PTC, and adjacent NT samples. This cohort comprised five PDTC tissues, five PTC tissues, and five NT tissues, as was reported previously (22). Interestingly, the expression level of MANCR was similar in the NT and PTC samples (P=0.7591), and its expression was significantly elevated in the PDTC samples compared with the NT (P=0.0107) and PTC (P=0.0106) samples (). These results indicated that MANCR was an oncogene in ATC/PDTC.
MANCR is a tumor promoter in ATC
In order to define the biological role of MANCR in ATC, MANCR was transiently knocked down and overexpressed in SW1736 cells using ASOs and MANCR overexpression construct (). After 24 h of transfection, CCK8 assays were performed. Following knockdown, MANCR was shown to significantly inhibit the proliferation of SW1736 cells. Similarly, MANCR overexpression could increase cell proliferation in SW1736 cells (). Moreover, the results of the Transwell assays demonstrated that the knockdown of MANCR with both ASO1 and ASO2 in SW1736 cells decreased their invasive ability compared with the negative controls (). Finally, flow cytometry analyses were performed, showing that the knockdown of MANCR could induce cell apoptosis in SW1736 cells (). These results demonstrated that MANCR is a tumor promoter in ATC, in which it increases cancer cell proliferation and invasion and decreases apoptosis.
Figure 3
MANCR was a tumor promoter in ATC in vitro. (A) SW1736 cells transfected with ASOs and MANCR overexpression construct showed significantly downregulated and upregulated MANCR expression compared with NC by RT-qPCR, respectively; (B) SW1736 displayed increased proliferation upon MANCR knockdown, and decreased proliferation upon overexpression in CCK8 assays; (C) the invasion ability was decreased in MANCR knockdown SW1736 cells compared with NC in the Transwell assays. The photos (×10) showed cells in ASO1, ASO2, and NC, respectively; (D) the percentage of apoptotic cells was significantly decreased in the MANCR knockdown cells compared with the NCs in flow cytometry analyses. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. NC, negative control; OE, overexpression; MANCR, mitotically associated long non-coding RNA; ATC, anaplastic thyroid cancer.
MANCR was a tumor promoter in ATC in vitro. (A) SW1736 cells transfected with ASOs and MANCR overexpression construct showed significantly downregulated and upregulated MANCR expression compared with NC by RT-qPCR, respectively; (B) SW1736 displayed increased proliferation upon MANCR knockdown, and decreased proliferation upon overexpression in CCK8 assays; (C) the invasion ability was decreased in MANCR knockdown SW1736 cells compared with NC in the Transwell assays. The photos (×10) showed cells in ASO1, ASO2, and NC, respectively; (D) the percentage of apoptotic cells was significantly decreased in the MANCR knockdown cells compared with the NCs in flow cytometry analyses. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. NC, negative control; OE, overexpression; MANCR, mitotically associated long non-coding RNA; ATC, anaplastic thyroid cancer.
MANCR is related to cell cycle
The whole transcriptome sequencing data was further analyzed, and 4,454 genes correlated with MANCR expression were identified (P<0.05), among which 3,216 were upregulated (logFC ≥1) and 66 were downregulated (logFC ≤−1) in ATC. A total of 451 genes were differentially expressed in ATC compared with NT (P<0.05). These genes included 335 protein-coding genes, 57 lncRNAs, 26 pseudogenes, and 33 other transcripts. Gene ontology (GO) analysis showed that the most relevant biological processes of these genes were nuclear division, organelle fission, chromosome segregation, and mitotic nuclear division, all of which are related to cell cycle (). Also, in gene set enrichment analysis (GSEA), 1,227 and 148 upregulated gene sets were identified in ATC and NT, respectively, using the molecular signatures database (MSigDB) GO gene sets. The top upregulated pathways in ATC included mitotic nuclear division [normalized enrichment scores (NES) =2.63, P<0.001], mitotic sister chromatic segregation (NES =2.5663998, P<0.001), mitotic cell cycle (NES = 2.5384307, P<0.001), and cell division (NES =2.5367835, P<0.001) ( and ). Interestingly, all the 11 pathways involving mitosis and 29 out of 34 pathways involving cell cycle were upregulated in the ATC samples.
Figure 4
The genes co-expressed with MANCR were related to cell cycle and mitosis. (A) GO analysis identified the top pathways in biological processes, cellular components, and molecular functions; (B) the enrichment of genes in cell cycle signaling using the KEGG graph in combination with the results of GSEA; (C) GSEA showed the top upregulated gene sets were nuclear division, mitotic sister chromatic segregation, mitotic cell cycle, and sister chromatid segregation. NES, normalized enrichment scores; MANCR, mitotically associated long non-coding RNA; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, gene set enrichment analysis.
Table S2
The top 20 enriched pathways in GSEA
Name
Size
ES
NES
NOM, P value
FDR, q value
Mitotic nuclear division
66
0.680992
2.6302454
0
0
Mitotic sister chromatid segregation
44
0.71238106
2.5663998
0
0
Mitotic cell cycle
177
0.5873111
2.5384307
0
0
Cell division
120
0.6203864
2.5367835
0
0
Sister chromatid segregation
48
0.7019476
2.5346344
0
0
Chromosome segregation
69
0.65553945
2.5342991
0
0
Organelle fission
83
0.6434189
2.5147588
0
0
Spindle
63
0.6566169
2.509476
0
0
Kinetochore
42
0.68970376
2.504258
0
0
Microtubule cytoskeleton organization involved in mitosis
34
0.72687423
2.4917073
0
0
Nuclear chromosome segregation
55
0.6654862
2.491389
0
0
Chromosome centromeric region
53
0.6560592
2.4422739
0
0
Spindle organization
39
0.69604653
2.438128
0
0
Condensed chromosome centromeric region
39
0.69650483
2.4267435
0
0
Mitotic spindle organization
30
0.7267824
2.388443
0
0
Spindle pole
33
0.69190294
2.3506067
0
0
Regulation of cell cycle phase transition
82
0.5874122
2.348358
0
0
Condensed chromosome
60
0.61129266
2.3382494
0
0
Microtubule
55
0.6332199
2.3355393
0
0
Cell cycle process
196
0.5423144
2.3332796
0
0
GSEA, gene set enrichment analysis.
The genes co-expressed with MANCR were related to cell cycle and mitosis. (A) GO analysis identified the top pathways in biological processes, cellular components, and molecular functions; (B) the enrichment of genes in cell cycle signaling using the KEGG graph in combination with the results of GSEA; (C) GSEA showed the top upregulated gene sets were nuclear division, mitotic sister chromatic segregation, mitotic cell cycle, and sister chromatid segregation. NES, normalized enrichment scores; MANCR, mitotically associated long non-coding RNA; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, gene set enrichment analysis.
Discussion
In the current study, whole transcriptome sequencing was used to analyze the lncRNA expression profile of ATC. A unique expression profile of lncRNAs in ATC was identified, providing a unique perspective of ATC carcinogenesis.Only a small number of studies have reported the genomic and transcriptome characteristics of ATC. Kunstman et al. analyzed 22 cases of ATC as well as 4 established ATC cell lines using whole exome sequencing. They observed new ATC-related mTOR, NF1, NF2, MLH1, MLH3, MSH5, MSH6, ERBB2, EIF1AX, and USH2A mutations, and identified established thyroid cancer genes mutations such as BRAF, TP53, and RAS-family genes (23). Landa et al. analyzed the transcriptome profiles of 37 tumors (17 PDTCs and 20 ATCs). Their data supported a model of tumorigenesis by which PDTC and ATC arise from well-differentiated tumors through the accumulation of key additional genetic abnormalities such as mutations in TP53 and TERT promoter, and PI3K/AKT/mTOR pathway effectors (7). Yoo et al. recently performed RNA sequencing in 13 ATCs and 12 advanced DTCs. They identified a fourth molecular subtype of thyroid cancer, ATC-like despite BRAF-like, RAS-like, and NBNR. They also promoted the activation of the JAK-STAT signaling pathway as a potential target in RAS-positive ATC (9). However, their analyses were not focused on lncRNAs.Our study, on the other hand, analyzed lncRNA expression profiles in ATC. Among the identified lncRNAs, MANCR was reported as an oncogene in ATC for the first time, through clinical validation and in vitro experiments. MANCR is a lncRNA that was originally identified in the transcriptome profiling of a series of breast cancer cell lines (24). With the exception of the spleen, MANCR expression is very low in most normal tissues (21). Tracy et al. reported that MANCR was overexpressed in triple-negative breast cancer cell lines and patient samples. Similar to our findings, a striking reduction was seen in cell growth, and cell death was induced upon MANCR knockdown in breast cancer cells (21).A recent study also identified MANCR as an oncogene in PTC by genome-wide analyses using datasets from TCGA and the GEO (25). The authors performed loss-of-function assays and observed that downregulation of MANCR could significantly impair the proliferation, colony formation, cell-cycle progression, and cell invasion of PTC cells via epithelial mesenchymal transition. Unlike their results, we observed no MANCR overexpression in the majority of PTC cell lines or patient samples compared with NT. However, MANCR was upregulated in ATC and in locally advanced PTC (ETE and T4 stage). These results indicated that MANCR might serve as a promoter in the anaplastic change of PTC.In fact, multiple studies support that PDTC/ATCs arise from pre-existing PTCs which undergo important genetic alterations (7,26,27). Mutations in TERT promoter, which actives TERT transcription, display a stepwise increase in frequency along the spectrum of disease progression, which is consistent with the constitutive activation of MAPK signaling (7). P53 and β-catenin mutations, which were found with increasing incidence in PDTC and ATC but not in PTC, may also serve as a direct molecular trigger of tumor dedifferentiation (27).Although the mechanism of MANCR in carcinogenesis has not been fully elucidated, our GSEA results indicated that its role was primarily related to mitosis and cell cycle. These results are consistent with the in vitro experiments in a previous study. Tracy et al. (21) revealed that in breast cancer, interphase cells had the lowest expression of MANCR, while early mitotic cells had the highest expression. They also demonstrated defective cytokinesis in MANCR knockdown cells.
Conclusions
In conclusion, our observations indicate a unique expression profile of lncRNA in ATC. MANCR, one of the most significantly overexpressed lncRNAs, is upregulated in PDTC/ATC. MANCR is a tumor promoter in ATC; it increases cancer cell proliferation and invasion and decreases apoptosis. The role of MANCR in the carcinogenesis of ATC is possibly associated with mitosis and cell cycle. Since MANCR expression is minimal in most normal tissues, it may serve as a potential target in the treatment of ATC.The article’s supplementary files as
Authors: Iñigo Landa; Tihana Ibrahimpasic; Laura Boucai; Rileen Sinha; Jeffrey A Knauf; Ronak H Shah; Snjezana Dogan; Julio C Ricarte-Filho; Gnana P Krishnamoorthy; Bin Xu; Nikolaus Schultz; Michael F Berger; Chris Sander; Barry S Taylor; Ronald Ghossein; Ian Ganly; James A Fagin Journal: J Clin Invest Date: 2016-02-15 Impact factor: 14.808
Authors: Y Kitamura; K Shimizu; M Nagahama; K Sugino; O Ozaki; T Mimura; K Ito; K Ito; S Tanaka Journal: J Clin Endocrinol Metab Date: 1999-11 Impact factor: 5.958
Authors: Jaroslaw Jendrzejewski; Huiling He; Hanna S Radomska; Wei Li; Jerneja Tomsic; Sandya Liyanarachchi; Ramana V Davuluri; Rebecca Nagy; Albert de la Chapelle Journal: Proc Natl Acad Sci U S A Date: 2012-05-14 Impact factor: 11.205
Authors: Mirolyuba Ilieva; James Dao; Henry E Miller; Jens Hedelund Madsen; Alexander J R Bishop; Sakari Kauppinen; Shizuka Uchida Journal: Noncoding RNA Date: 2022-07-22