| Literature DB >> 33176597 |
Fei Wang1, Qiheng Zhao1, Wenping Liu2, Daliang Kong1.
Abstract
Osteosarcoma (OS) is a cancerous tumor in a bone. We aimed to identify the critical genes involved in OS progression, and then try to elucidate the molecular mechanisms of this disease. The microarray data of GSE32395 was used for the present study. We analyzed differentially expressed genes (DEGs) in OS cells compared with control group by Student's t-test. The significant enriched gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) pathways were analyzed for upregulated genes and downregulated genes, respectively. In addition, a protein-protein interaction (PPI) network was constructed. GO and KEGG enrichment analyses were conducted for genes in the PPI network. In total, 183 DEGs, including 100 upregulated DEGs and 83 downregulated DEGs were screened. The upregulated DEGs were significantly enriched in 2 KEGG pathways, such as "Glycosaminoglycan biosynthesis-chondroitin sulfate" and the downregulated DEGs were significantly enriched in 12 pathways, including "cell adhesion molecules," "pentose phosphate pathway" and "allograft rejection." GO enrichment analysis indicated that the upregulated DEGs were significantly involved in biological process, such as "multicellular organismal metabolic process" and "limb morphogenesis," while the downregulated DEGs were significantly enriched in biological process, such as "Positive regulation of pathway-restricted SMAD protein phosphorylation." The PPI network included 84 interactions and 51 nodes. The "glycosaminoglycan biosynthesis-chondroitin sulfate pathway," "microtubule motor activityfunction," and "regulation of mitosis process" were significantly enriched by genes in PPI network. In particular, CENPE, PRC1, TTK, and PLK4 had higher degrees in the PPI network. The interactions between TTK and PLK4 as well as CENPE and PRC1 may involve in the OS development. These 4 genes might be possible biomarkers for the treatment and diagnosis of OS.Entities:
Keywords: differentially expressed genes; molecular mechanisms; osteosarcoma
Year: 2020 PMID: 33176597 PMCID: PMC7675850 DOI: 10.1177/1533033820973278
Source DB: PubMed Journal: Technol Cancer Res Treat ISSN: 1533-0338
Primers for Quantitative Real-Time PCR.
| Primer | Direction | Sequence (5’-3’) |
|---|---|---|
| CENPE | Forward | AAGACCGAGCTTTCTTACAAGA |
| Reverse | CTACAGTTTGCAGCGTAGAATC’ | |
| PRC1 | Forward | CCTATTCTGAGTTTGCGAAGGA |
| Reverse | TGATCAGGGCTTCTCAGGAC | |
| TTK | Forward | TGGCCAACCTGCCTGTTT |
| Reverse | AATGCATTCATTTGCTGAAGAAGA | |
| PLK4 | Forward | CCTTATCACCTCCTCCTTC |
| Reverse | CCAAGTCCTTCATTTGTAACC | |
| GAPDH | Forward | TGACAACTTTGGTATCGTGGAAGG |
| Reverse | AGGCAGGGATGATGTTCTGGAGAG |
The List of 188 Differentially Expressed Genes.
| Category | Genes |
|---|---|
| The upregulated genes |
|
| The downregulated genes |
|
KEGG Pathway Enrichment Analysis of Differentially-Expressed Genes.
|
|
|
|
|---|---|---|
|
| ||
| Glycosaminoglycan biosynthesis– chondroitin sulfate | 2 | 6.21 × 10-3 |
| Arrhythmogenic right ventricular cardiomyopathy | 3 | 7.34 × 10-3 |
|
| ||
| Cell adhesion molecules | 5 | 2.90 × 10-4 |
| Pentose phosphate pathway | 2 | 6.66 × 10-3 |
| Allograft rejection | 2 | 1.20 × 10-2 |
| Graft vs. host disease | 2 | 1.50 × 10-2 |
| Type I diabetes mellitus | 2 | 1.64 × 10-2 |
| Cell cycle | 3 | 1.86 × 10-2 |
| Autoimmune thyroid disease | 2 | 2.35 × 10-2 |
| Natural killer cell mediated cytotoxicity | 3 | 2.37 × 10-2 |
| Phagosome | 3 | 3.21 × 10-2 |
| Viral myocarditis | 2 | 4.06 × 10-2 |
| Adherens junction | 2 | 4.38 × 10-2 |
| Antigen processing and presentation | 2 | 4.71 × 10-2 |
KEGG: Kyoto Encyclopedia of Genes and Genomes; Gene Counts: number of genes.
TOP 5 Significantly Enriched BP, CC and MF for Differentially-Expressed Genes.
|
|
|
|
|
|---|---|---|---|
| Upregulated | |||
| GO:0044236_BP | Multicellular organismal metabolic process | 5 | 5.24 × 10-4 |
| GO:0035108_BP | Limb morphogenesis | 5 | 7.66 × 10-4 |
| GO:0007156_BP | Homophilic cell adhesion | 5 | 8.18 × 10-4 |
| GO:0048703_BP | Embryonic viscerocranium morphogenesis | 2 | 1.19 × 10-3 |
| GO:0009636_BP | Response to toxic substance | 4 | 4.60 × 10-3 |
| GO:0005794_CC | Golgi apparatus | 16 | 3.90 × 10-4 |
| GO:0070195_CC | Growth hormone receptor complex | 1 | 5.16 × 10-3 |
| GO:0005592_CC | Collagen type XI | 1 | 1.03 × 10-2 |
| GO:0005899_CC | Insulin receptor complex | 1 | 1.54 × 10-2 |
| GO:0031982_CC | Vesicles | 11 | 2.13 × 10-2 |
| GO:0005520_MF | Insulin-like growth factor binding | 3 | 2.58 × 10-4 |
| GO:0008907_MF | Integrase activity | 1 | 5.03 × 10-3 |
| GO:0005509_MF | Calcium ion binding | 9 | 6.23 × 10-3 |
| GO:0043014_MF | α-tubulin binding | 2 | 6.39 × 10-3 |
| GO:0042277_MF | Peptide binding | 4 | 7.32 × 10-3 |
| Downregulated | |||
| GO:0010862_BP | Positive regulation of pathway-restricted SMAD protein phosphorylation | 3 | 2.42 × 10-4 |
| GO:0060391_BP | Positive regulation of SMAD protein import into nucleus | 2 | 9.63 × 10-4 |
| GO:0035335_BP | Peptidyl-tyrosine dephosphorylation | 3 | 1.32 × 10-3 |
| GO:0007088_BP | Regulation of mitosis | 4 | 1.52 × 10-3 |
| GO:0051301_BP | Cell division | 8 | 2.20 × 10-3 |
| GO:0005819_CC | Spindle | 9 | 9.35 × 10-7 |
| GO:0042612_CC | MHC class I protein complex | 2 | 9.44 × 10-4 |
| GO:0005865_CC | Striated muscle thin filament | 2 | 2.03 × 10-3 |
| GO:0005900_CC | Oncostatin-M receptor complex | 1 | 1.26 × 10-2 |
| GO:0005945_CC | 6-phosphofructokinase complex | 1 | 1.26 × 10-2 |
| GO:0050699_MF | WW domain binding | 2 | 4.91 × 10-3 |
| GO:0042801_MF | Polo kinase kinase activity | 1 | 5.02 × 10-3 |
| GO:0047757_MF | Chondroitin-glucuronate 5-epimerase activity | 1 | 5.02 × 10-3 |
| GO:0008017_MF | Microtubule binding | 4 | 6.70 × 10-3 |
| GO:0042605_MF | Peptide antigen binding | 2 | 8.64 × 10-3 |
GO: Gene Ontology; BP: biological process; CC: cellular component; MF: molecular function; Gene Counts: number of genes.
Figure 1.Protein-Protein Interaction (PPI) Network of Differentially Expressed Genes (DEGs) in Osteosarcoma. Red nodes represent upregulated DEGs; green nodes represent downregulated DEGs; gray lines stand for the interaction between 2 proteins. DEGs, differentially-expressed genes.
Differentially-Expressed Genes With >2 Degrees of Connectivity in the Protein-Protein Interaction Network.
|
|
|
|---|---|
| CENPE | 11 |
| PRC1 | 11 |
| TTK | 10 |
| KIF23 | 10 |
| ANLN | 10 |
| PLK4 | 10 |
| FAM64A | 8 |
| DBF4 | 8 |
| KIF20B | 8 |
| DIAPH3 | 7 |
| HMGB2 | 6 |
| HLA-B | 5 |
| PARK2 | 4 |
| HLA-A | 4 |
| TUBA4A | 4 |
| SEPT5 | 3 |
| DSE | 3 |
| TPM1 | 3 |
| NCAM1 | 3 |
| CDR1 | 2 |
| UST | 2 |
| KDM6A | 2 |
| COL4A1 | 2 |
| MYL9 | 2 |
| TAGLN | 2 |
| GHR | 2 |
| MICB | 2 |
KEGG Pathway Enrichment Analysis of Differentially-Expressed Genes in the Protein-Protein Interaction Network.
|
|
|
|
|---|---|---|
| Glycosaminoglycan biosynthesis-chondroitin sulfate | 3 | 1.12 × 10-4 |
| Phagosome | 5 | 4.76 × 10-4 |
| Natural killer cell mediated cytotoxicity | 4 | 2.77 × 10-3 |
| Antigen processing and presentation | 3 | 4.38 × 10-3 |
| Small cell lung cancer | 3 | 5.99 × 10-3 |
| Allograft rejection | 2 | 1.14 × 10-2 |
| Graft-vs.-host disease | 2 | 1.39 × 10-2 |
| Type I diabetes mellitus | 2 | 1.52 × 10-2 |
| Cell cycle | 3 | 1.67 × 10-2 |
| Cell adhesion molecules | 3 | 2.02 × 10-2 |
| Autoimmune thyroid disease | 2 | 2.18 × 10-2 |
| Pathogenic | 2 | 2.51 × 10-2 |
| Viral myocarditis | 2 | 3.79 × 10-2 |
| Cardiac muscle contraction | 2 | 4.51 × 10-2 |
KEGG, Kyoto Encyclopedia of Genes and Genomes; Gene Counts, number of genes.
TOP 5 Significantly Enriched BP, CC and MF Terms for Differentially-Expressed Genes in the Protein-Protein Interaction Network.
|
|
|
|
|
|---|---|---|---|
| GO:0007088_BP | Regulation of mitosis | 5 | 2.40 × 10-5 |
| GO:0051301_BP | Cell division | 8 | 1.93 × 10-4 |
| GO:0002480_BP | Antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent | 2 | 3.79 × 10-4 |
| GO:0006266_BP | DNA ligation | 2 | 5.76 × 10-4 |
| GO:0030208_BP | Dermatan sulfate biosynthetic process | 2 | 5.76 × 10-4 |
| GO:0007080_BP | Mitotic metaphase plate congression | 2 | 8.14 × 10-4 |
| GO:0005819_CC | Spindle | 8 | 4.68 × 10-7 |
| GO:0042612_CC | MHC class I protein complex | 2 | 4.38 × 10-4 |
| GO:0000139_CC | Golgi membrane | 7 | 1.00 × 10-3 |
| GO:0070195_CC | Growth hormone receptor complex | 1 | 2.87 × 10-3 |
| GO:0001725_CC | Stress fiber | 2 | 6.78 × 10-3 |
| GO:0003777_MF | Microtubule motor activity | 4 | 9.65 × 10-5 |
| GO:0047757_MF | Chondroitin-glucuronate 5-epimerase activity | 1 | 3.13 × 10-3 |
| GO:0005200_MF | Structural constituent of cytoskeleton | 3 | 3.16 × 10-3 |
| GO:0042605_MF | Peptide antigen binding | 2 | 3.44 × 10-3 |
| GO:0042169_MF | SH2 domain binding | 2 | 4.48 × 10-3 |
GO, Gene Ontology; BP, biological process; CC, cellular component; MF, molecular function; MHC, major histocompatibility complex; TAP, transporter associated with antigen processing; Gene counts, number of genes.
Figure 2.Real-time PCR analysis of CENPE, PRC1, TTK and PLK4 in 4 kinds of osteosarcoma cells, including MG63, HOS, Saos and U2OS cells and human mesenchymal stem cells (MSCs). *P < 0.05, ** P < 0.01, *** P < 0.001 compared with the human mesenchymal stem cells.