Comparative analysis of the complete mitochondrial genomes in two limpets from Lottiidae (Gastropoda: Patellogastropoda): rare irregular gene rearrangement within Gastropoda.

To improve the systematics and taxonomy of Patellogastropoda within the evolution of gastropods, we determined the complete mitochondrial genome sequences of Lottia goshimai and Nipponacmea fuscoviridis in the family Lottiidae, which presented sizes of 18,192 bp and 18,720 bp, respectively. In addition to 37 common genes among metazoa, we observed duplication of the trnM gene in L. goshimai and the trnM and trnW genes in N. fuscoviridis. The highest A + T contents of the two species were found within protein-coding genes (59.95% and 54.55%), followed by rRNAs (56.50% and 52.44%) and tRNAs (56.42% and 52.41%). trnS1 and trnS2 could not form the canonical cloverleaf secondary structure due to the lack of a dihydrouracil arm in both species. The gene arrangements in all Patellogastropoda compared with those of ancestral gastropods showed different levels of gene rearrangement, including the shuffling, translocation and inversion of single genes or gene fragments. This kind of irregular rearrangement is particularly obvious in the Lottiidae family. The results of phylogenetic and gene rearrangement analyses showed that L. goshimai and Lottia digitalis clustered into one group, which in turn clustered with N. fuscoviridis in Patellogastropoda. This study demonstrates the significance of complete mitogenomes for phylogenetic analysis and enhances our understanding of the evolution of Patellogastropoda.

Introduction

The order Patellogastropoda (common name, true limpets) consists of the most primitive gastropod molluscs, which inhabit intertidal rocky shores worldwide, from tropical to polar regions[1,2]. Most species from this group feed by scraping a fine film of microalgae from what appears to be a bare rock surface. Their shells have the appearance of hats of different sizes, generally reaching no more than 20 cm[3,4]. These limpets, which are ecologically important in coastal regions, separated from other gastropods early in molluscan evolution[5]. They can be used in marine ecotoxicology research because of their wide distribution, and their gametes are available throughout the year[6]. This group is characterized by intraspecific polyphenism, the existence of cryptic species, and the intraspecific variation of characteristics such as shell morphology and colour. Therefore, it is difficult to identify species in this group by traditional methods alone[7-10]. The phylogenetic analysis of Patellogastropoda has generally focussed on Caenogastropoda, Neomphalina, Vetigastropoda, Neritimorpha and Heterobranchia. The phylogenetic position of the group and the evolutionary relationships among families of true limpets have been highly controversial[11,12].

Nipponacmea fuscoviridis (Teramachi, 1949) and Lottia goshimai (Nakayama, Sasaki & T. Nakano, 2017) both belong to the family Lottiidae. N. fuscoviridis commonly appears in temperate areas around the Japanese islands and the southeastern coastal region of China[13]. Species of this genus are common along the Asian coast of the Pacific Ocean from Vietnam to Russia[14]. L. goshimai was previously thought to be an intraspecific variant of the northern population of N. fuscoviridis and was later proven to be a new species[15]; thus, there have been few studies on this species. Its developmental stages and gene expression were studied by Wang et al.[16-18].

The complete mitochondrial genome provides more information than individual genes. It exhibits the characteristics of maternal inheritance, a high evolutionary rate and a relatively low intermolecular recombination rate, and it is becoming increasingly common for mitochondrial genomes to be used for phylogenetic reconstruction[19-22]. The circular mitochondrial genome of gastropods generally contains 37 genes (22 transfer RNA genes, two ribosomal RNA genes, 13 protein-coding genes) and a noncoding control region. Nevertheless, Lottiidae species seem to be an exception, exhibiting different numbers of tRNA genes[23].

In the present study, two mitochondrial genomes (L. digitalis and N. fuscoviridis) from the Lottiidae family were sequenced, annotated and compared to the other available genomes from Patellogastropoda. We analysed the main characteristics of the newly generated mitogenomes, such as their nucleotide composition, codon usage and the secondary structure of their tRNAs. Complete mitogenome sequences from six subclasses of Gastropoda were downloaded from the GenBank database to reconstruct the phylogenetic tree. The results will help us to obtain further insight into the evolutionary relationships within Patellogastropoda.

Results and discussion

Characteristics, structure and organization of the mitogenomes

The gene arrangements found within Patellogastropoda mitochondrial genomes have been relatively conservative, but those of Lottiidae differ to some extent. The comparison of the two newly sequenced mitogenomes with a reported mitogenome from Lottiidae revealed the rearrangement of gene positions and structures. The complete mitochondrial genome sequences of L. goshimai and N. fuscoviridis were 18,192 bp and 18,720 bp, respectively (GenBank accessions MT248298 and MK395167) (Fig. 1, Table 1). Both circular mitochondrial genomes of the species contained 13 PCGs, 2 rRNA genes (12S rRNA and 16S rRNA), 22 putative tRNA genes and a control region (CR). Compared to the fragment of the genome previously published, we found an additional trnM gene in both species and additional trnW gene in N. fuscoviridis.

Figure 1

Maps of the mitochondrial genomes of two Lottiidae species. The direction of gene transcription is indicated by the arrows.

Table 1

List of species analysed in this study with their GenBank accession numbers.

Subclass	Family	Species	Size (bp)	Accession no.
Caenogastropoda	Muricidae	Concholepas concholepas	15,495	NC_017886
		Rapana venosa	15,272	EU170053
	Conidae	Conus tribblei	15,570	NC027957
		Conus tulipa	15,756	KR006970
	Turridae	Turricula nelliae spuria	16,453	MK251986
	Xenophoridae	Onustus exutus	16,043	MK327366
	Pomatiopsidae	Oncomelania hupensis robertsoni	15,188	LC276228
		Oncomelania hupensis nosophora	15,182	LC276226
		Oncomelania quadrasi	15,184	LC276227
	Turritellidae	Turritella bacillum	15,868	NC_029717
	Epitoniidae	Epitonium scalare	15,143	MK251987
Neomphaliones	Bathysciadiidae	Bathysciadiidae sp.	17,238	MH837532
	Cocculinidae	Coccocrater sp.	13,983	MH837535
		Cocculina subcompressa	18,167	MH837536
Vetigastropoda	Turbinidae	Angaria delphinus	19,554	NC_031860
		Angaria neglecta	19,470	NC_028707
		Astralium haematragum	16,310	NC_031858
		Bolma rugosa	17,432	NC_029366
		Lunella aff. Cinereal	17,670	KF700096
		Lunella granulate	17,190	NC_031857
	Tegulidae	Tegula brunnea	17,690	NC_016954
		Tegula lividomaculata	17,375	NC_029367
		Tectus pyramis	18,439	MF138911
	Trochidae	Gibbula umbilicalis	16,277	NC_035682
		Stomatella planulata	17,151	NC_031861
		Umbonium thomasi	15,998	MH729882
	Haliotidae	Haliotis rufescens	16,646	NC_036928
		Haliotis laevigata	16,545	NC_024562
		Haliotis rubra	16,907	AY588938
		Haliotis tuberculata	16,521	FJ599667
	Phasianellidae	Phasianella solida	16,698	NC_028709
Neritimorpha	Neritidae	Clithon retropictus	15,802	NC_037238
		Nerita albicilla	15,314	MK516738
		Nerita yoldii	15,719	MK395169
		Nerita fulgurans	15,343	KF728888
		Nerita tessellata	15,741	KF728889
		Nerita versicolor	15,866	KF728890
		Nerita melanotragus	15,261	GU810158
Heterobranchia	Aplysiidae	Aplysia californica	14,117	AY569552
		Aplysia dactylomela	14,128	DQ991927
		Aplysia kurodai	14,131	KF148053
	Polyceridae	Roboastra europaea	14,472	NC_004321
	Siphonariidae	Siphonaria pectinate	14,065	AY345049
	Volvatellidae	Ascobulla fragilis	14,745	AY345022
	Placobranchidae	Elysia cornigera	14,118	NC_035489
		Elysia timida	14,088	NC_035490
	Onchidiidae	Onchidella celtica	14,150	AY345048
		Platevindex mortoni	13,991	NC_013934
	Ellobiidae	Myosotella myosotis	14,246	AY345053
	Pyramidellidae	Pyramidella dolabrata	13,856	AY345054
Patellogastropoda	Lottiidae	Nipponacmea fuscoviridis	18,720	MK395167
		Lottia goshimai	18,192	MT248298
		Lottia digitalis	26,835	DQ238599
	Acmaeidae	Bathyacmaea nipponica	16,792	MF095859
	Nacellidae	Cellana radiata	16,194	MH916651
		Nacella clypeater	16,742	KT990124
		Nacella magellanica	16,663	KT990125
		Nacella concinna	16,761	KT990126
	Patellidae	Patella ferruginea	14,400	MH916654
		Patella vulgata	14,808	MH916653
Outgroup	Mopaliidae	Cryptochiton stelleri	15,082	KJ569363
		Katharina tunicata	15,532	NC_001636

Overlapping and noncoding regions

Most of the genes identified in N. fuscoviridis are located on the heavy strand except for three PCGs and seven tRNAs. In addition, fourteen genes of L. goshimai (seven PCGs and seven tRNA genes) are located on the light strand, with the remaining genes being located on the heavy strand (Fig. 1 and Tables 2, 3). The mitochondrial genome of L. goshimai contains intergenic spacers with lengths ranging from 1 to 178 bp, and there are two genes showing overlapping nucleotides (6 and 20 bp). The longest intergenic spacer is located between trnY and nad5 (Table 2). The mitochondrial genome of N. fuscoviridis exhibits intergenic spacers with lengths ranging from 2 to 380 bp, and there are two genes with overlapping nucleotides (4 and 11 bp). The longest intergenic spacer is located between trnY and nad3 (Table 3). In conclusion, there are significant differences in the intergenic spacers and overlapping nucleotides of the two species, and these species of limpets also present large variations compared with other families (e.g., Nacellidae, Acmaeidae and Patellidae)[24-28].

Table 2

Annotation of the Lottia goshimai mitochondrial genome.

Gene	Strand	Location		Length	Codons	Intergenic nucleotide (bp)	Anticodon
		Start	Stop
cox1	+	1	1560	1560	GTG/TAG	26
trnM1	+	1587	1652	66		− 20	CAT
nad1	−	1633	2562	930	ATG/TAG	37
trnT	+	2600	2668	69		3	TGT
trnY	−	2672	2738	67		9	GTA
nad5	−	2748	4421	1674	ATT/TAA	178
nad4l	+	4600	4902	303	ATG/TAG	51
nad4	+	4954	6279	1326	ATG/TAG	67
cox3	−	6347	7204	858	ATG/TAA	10
trnG	+	7215	7274	67		11	TCC
trnS2	+	7286	7350	65		8	TGA
trnQ	+	7359	7425	67		22	TTG
atp6	−	7448	8209	762	ATG/TAA	85
cox2	−	8295	8960	666	ATG/TAA	86
trnL1	+	9047	9112	66		5	TAG
trnI	+	9118	9189	72		8	GAT
trnP	+	9198	9265	68		1	TGG
trnF	+	9267	9334	68		43	GAA
nad6	+	9378	9896	519	ATG/TAA	4
nad3	+	9901	10,254	354	ATG/TAA	11
trnM2	−	10,266	10,332	67		45	CAT
trnL2	+	10,378	10,443	66		12	TAA
trnA	−	10,456	10,525	70		0	TGC
trnN	−	10,526	10,593	68		15	GTT
trnW	−	10,609	10,678	70		14	TCA
nad2	−	10,693	11,655	963	ATT/TAA	103
trnV	−	11,759	11,827	69		7	TAC
trnK	+	11,835	11,903	69		15	TTT
trnS1	+	11,919	11,985	67		10	TCT
trnD	−	11,996	12,061	66		76	GTC
rrnS	+	12,138	13,058	921		11
trnE	+	13,070	13,139	70		11	TTC
trnC	+	13,151	13,219	69		− 6	GCA
rrnL	+	13,214	14,746	1533		63
cytb	+	14,810	15,973	1164	ATG/TAA	28
trnR	+	16,002	16,070	69		1722	TCG
atp8	−	17,793	17,951	159	ATG/TAA	145
trnH	+	18,097	18,166	70		26	GTG

Table 3

Annotation of the Nipponacmea fuscoviridis mitochondrial genome.

Gene	Strand	Location		Length	Codons	Intergenic nucleotide (bp)	Anticodon
		Start	Stop
cox1	+	1	1551	1551	ATG/TAG	19
trnL2	+	1571	1636	66		2	TAA
cox3	+	1639	2425	787	ATG/T(AA)	99
trnM1	+	2525	2588	64		15	CAT
nad4	−	2604	3905	1302	ATG/TAA	81
trnC	−	3987	4046	66		17	GCA
nad1	+	4064	4999	936	ATG/TAG	5
trnH	+	5005	5072	68		14	GTG
trnA	+	5087	5153	67		84	TGC
nad5	−	5238	6851	1614	ATT/TAG	1562
atp8	+	8413	8574	162	ATG/TAG	3
cox2	+	8578	9265	688	ATG/T(AA)	115
atp6	+	9381	10,181	801	ATG/TAG	41
cytb	+	10,223	11,357	1135	ATG/T(AA)	68
trnG	+	11,426	11,491	66		6	TCC
trnK	+	11,498	11,565	68		3	TTT
trnI	+	11,569	11,640	72		4	GAT
trnP	+	11,645	11,711	67		2	TGG
trnN	+	11,714	11,780	67		7	GTT
trnM2	+	11,788	11,855	68		60	CAT
nad4l	−	11,916	12,212	297	ATA/TAA	220
trnE	+	12,433	12,499	67		58	TTC
nad6	+	12,558	13,046	489	ATA/TAG	4
trnW1	−	13,051	13,116	66		11	CCA
trnS1	+	13,128	13,193	66		378	TCT
trnL1	−	13,572	13,637	66		2	TAG
trnY	−	13,640	13,706	67		380	GTA
nad3	+	14,087	14,440	354	GTG/TAG	− 11
rrnL	+	14,430	15,867	1438		16
trnD	+	15,884	15,948	65		6	GTC
trnR	+	15,955	16,020	66		11	TCG
trnF	+	16,032	16,097	66		0	GAA
trnT	−	16,098	16,166	69		10	TGT
trnW2	−	16,177	16,243	67		11	TCA
trnQ	+	16,255	16,321	67		− 4	TTG
nad2	−	16,318	17,355	1038	ATT/TAA	6
trnV	−	17,362	17,426	65		129	TAC
rrnS	+	17,556	18,491	936		3
trnS2	+	18,495	18,561	67		159	TGA

The control region (CR) is the largest non-coding region; it usually presents a high AT content and is therefore also known as the A + T rich region[29]. It is an essential element involved in mitochondrial genome replication and transcription initiation[30]. The mitogenomes of L. goshimai and N. fuscoviridis each contain one CR, and both CRs show relatively high AT contents of 61.61% and 53.43%, respectively. The CR is located between trnR and atp8 in L. goshimai, with a length of 1722 bp. In N. fuscoviridis, it is located between nad5 and atp8, with a length of 1561 bp. It also contains a replication origin for light-strand synthesis (OL), which is 21 bp (CCCTCCCCCCCAGGGGGAGGG) in length and folds into a hairpin secondary structure.

Base composition of mitogenomes

The A + T content of the whole mitogenome if 60.17% for L. goshimai (28.18% A, 32.00% T, 24.11% G and 15.71% C), and 54.15% for N. fuscoviridis (23.83% A, 30.32% T, 25.39% G and 20.46% C) (Table 4). The A + T contents of all PCGs in L. goshimai range from 55.65% (atp8) to 62.64% (cytb), and those in N. fuscoviridis range from 52.07% (nad4) to 57.25% (cox1) (Table 4). We observed the highest A + T contents of the two species in PCGs (59.95% and 54.55%), followed by rRNAs (56.50% and 52.44%) and tRNAs (56.42% and 52.41) (Table 4). The AT skew of the total PCGs is negative, and the GC skew is positive across the two species, indicating that they contain a slightly higher percentage of T and G bases than A and C bases. For each PCG of two Lottiidae species in addition to the cox2 gene of L. goshimai, most of the AT skew values are negative.

Table 4

Base composition of the mitochondrial genome of the two limpets.

Region	Size(bp)		A (%)		T (%)		G (%)		C (%)		A + T (%)		AT-skew		GC-skew
	Lg	Nf	Lg	Nf	Lg	Nf	Lg	Nf	Lg	Nf	Lg	Nf	Lg	Nf	Lg	Nf
Mitogenome	18,192	18,720	28.18	23.83	32.00	30.32	24.11	25.39	15.71	20.46	60.17	54.15	− 0.063	− 0.120	0.211	0.108
cox1	1560	1551	24.49	22.63	36.15	34.62	24.04	24.37	15.32	18.38	60.64	57.25	− 0.192	− 0.209	0.222	0.140
cox2	666	688	31.68	25.30	27.48	27.43	16.67	28.02	24.17	19.25	59.16	52.73	0.071	− 0.090	− 0.184	0.253
cox3	805	787	25.59	20.08	32.55	35.58	18.88	26.94	22.98	17.41	58.14	55.65	− 0.120	− 0.272	− 0.098	0.265
nad1	930	936	26.13	20.73	34.52	35.04	16.99	28.10	22.37	16.13	60.65	55.77	− 0.138	− 0.257	− 0.137	0.271
nad2	963	1038	28.45	21.39	30.43	31.31	16.20	18.69	24.92	28.61	58.88	52.70	− 0.034	− 0.188	− 0.212	− 0.210
nad3	346	354	20.81	18.64	40.75	33.62	26.88	31.07	11.56	16.67	61.56	52.26	− 0.324	− 0.287	0.399	0.302
nad4	1326	1302	20.44	21.89	39.44	30.18	26.24	20.35	13.88	27.57	59.88	52.07	− 0.317	− 0.159	0.308	− 0.151
nad4l	284	297	20.77	22.90	37.32	33.33	29.58	22.90	12.32	20.88	58.10	56.23	− 0.285	− 0.185	0.412	0.046
nad5	1674	1614	29.57	24.10	31.66	28.62	14.22	17.97	24.55	29.31	61.23	52.73	− 0.034	− 0.086	− 0.266	− 0.240
nad6	519	489	18.30	23.31	43.93	32.31	24.28	30.06	13.49	14.31	62.24	55.62	− 0.412	− 0.162	0.286	0.355
cytb	1159	1135	21.74	20.88	40.90	34.45	20.97	25.81	16.39	18.85	62.64	55.33	− 0.306	− 0.245	0.123	0.156
atp6	762	801	28.35	20.72	32.28	34.58	15.49	27.59	23.88	17.10	60.63	55.31	− 0.065	− 0.251	− 0.213	0.235
atp8	115	162	20.00	22.22	35.65	33.33	20.87	23.46	23.48	20.99	55.65	55.56	− 0.281	− 0.200	− 0.059	0.056
tRNAs	1558	1597	28.75	24.92	27.66	27.49	24.65	26.61	18.93	20.98	56.42	52.41	0.019	− 0.049	0.131	0.118
rRNAs	2494	2374	28.47	27.38	28.03	25.06	25.54	28.52	17.96	19.04	56.50	52.44	0.008	0.044	0.174	0.199
PCGs	11,238	11,154	24.33	21.91	35.62	32.65	20.87	25.03	19.178	20.42	59.95	54.55	− 0.188	− 0.197	0.042	0.101

Protein-coding genes and codon usage

The total length of the all PCGs is 11,238 bp in L. goshimai and 11,154 bp N. fuscoviridis, accounting for 61.77% and 59.58% of the whole genome, respectively (Table 4). The comparison of the initiation and termination codons of all PCGs showed that most of the PGCs of the two Lottiidae species are initiated with an ATN codon and terminated with TAN. Only the cox1 gene of L. goshimai and nad3 of N. fuscoviridis start with GTG (Tables 2, 3). While the cox2, cox3 and cytb genes of N. fuscoviridis use an incomplete T stop codon, which is remarkably common in invertebrate mitogenomes.

The analysis of the two Lottiidae species indicated that the most frequently used amino acids are Gly, Ser1 and Val, while Gln and His are the least common amino acids (Fig. 2). In L. goshimai, the highest relative synonymous codon usage (RSCU) was found for UUA (Leu2), followed by AUU (Ile), GUU (Val) and UUU (Phe) (Fig. 2). In N. fuscoviridis, the highest relative synonymous codon usage (RSCU) was found for GGG (Gly), followed by GCU (Ala), UUU (Phe) and UUA (Leu2) (Fig. 2).

Figure 2

The codon distribution and relative synonymous codon usage (RSCU) in the mitogenomes of L. goshimai (Lg) and N. fuscoviridis (Nf). CDspT, codons per thousand codons.

Transfer RNA genes

We identified 23 tRNA genes from the mitochondrial genome of L. goshimai, including one more trnM gene than is common invertebrates, with lengths ranging from 65 (trnS2) to 72 bp (trnI). In addition, N. fuscoviridis exhibited one more trnW gene than L. goshimai, and 24 tRNA genes ranging from 64 (trnM1) to 72 bp (trnI) in length were identified. In both Lottiidae species, trnS1 and trnS2 cannot form a secondary structure due to the lack of dihydrouracil (DHU) arms, while other tRNAs are capable of folding into a typical clover-leaf secondary structure. The comparison of the tRNA genes of the two species showed that each corresponding amino acid is encoded by the same anticodon with the exception of the trnW1 gene of N. fuscoviridis, which is encoded by different anticodons (CCA). Moreover, methionine is encoded by two tRNAs with the same anticodons (CAT) (Tables 2, 3 and Figs. 3, 4).

Figure 3

Secondary structure of the tRNA genes of the L. goshimai mitochondrial genome.

Figure 4

Secondary structure of the tRNA genes of the N. fuscoviridis mitochondrial genome.

Nonsynonymous and synonymous substitutions.

We calculated the selection pressure (estimated by using Ka/Ks) on 13 PCGs in the two Lottiidae species (Fig. 5). Most of the Ka/Ks ratios are below 1 for these PCGs, indicating that they evolved under purifying selection. The remaining nad2, nad5, nad6 and cytb genes, with high Ka/Ks ratios, may have been affected by positive selection during evolution. Positive selection is influenced by the external environment for the self-regulation and transformation of genes, the elimination of genes that do not adapt to the environment, and the production of genes that can effectively adapt to the environment[31]. Therefore, advantageous genes are retained after non-synonymous mutations.

Figure 5

The Ka/Ks values of each PCG represent the ratios of nonsynonymous substitutions (Ka) to synonymous substitutions (Ks).

The substitution saturation index was analysed on the basis of the combined dataset of all PCGs of 60 Gastropoda mitogenomes, and the observed Iss value (Iss = 0.651) was significantly lower than that of the critical value (Iss.cSym = 0.859, p = 0.0000) (Fig. 6), indicating that sequence substitution is unsaturated; thus, the combined data are suitable for phylogenetic analysis.

Figure 6

Saturation plots for all PCGs. The plots show the uncorrected pairwise divergence in transitions (s) and transversions (v) against the divergence calculated using the GTR model.

Phylogenetic analysis

We used the Bayesian inference (BI) and maximum likelihood (ML) methods to reconstruct a phylogenetic tree based on 13 PCGs from the two new Lottiidae species and 58 other species within Gastropoda (i.e., 8 Patellogastropoda species, 11 Caenogastropoda species, 3 Neomphalina species, 17 Vetigastropoda species, 7 Neritimorpha species, and 12 Heterobranchia species), using two Mopaliidae species as outgroups.

In addition, in the BI analysis, due to the high rearrangement rate of Lottiidae species, which exhibited a long branch compared to other species of Patellogastropoda, we encountered a long-branch attraction (LBA) artefact in the process of constructing phylogenetic trees. This is a common systemic error in phylogenetic reconstruction resulting from the clustering of fast-evolving taxa in the tree, instead of revealing their genuine phylogenetic positions[32,33]. Specifically, the three species of the Lottiidae family and Heterobranchia erroneously formed a clade, but this situation did not appear in the ML analysis. Finally, we combined these two methods and obtained a basically consistent evolutionary tree through reference to previous research on the phylogeny of gastropods[34-37] (Fig. 7).

Figure 7

The phylogenetic tree for the two Lottiidae species and other gastropod species based on 13 PCGs. The purple dots indicate the two species sequenced in this study. The number at each node is the bootstrap probability.

The results showed a stable evolutionary tree topology in which each subclass formed a monophyletic clade. Most of the recovered clades were highly supported (Bayesian posterior probability (BPP) = 1, and Bootstrap (BS) = 100). The higher phylogenetic relationship of clade formed: (((Neomphalina + Vetigastropoda) + Neritimorpha) + Caenogastroopoda) + (Patellogastropoda + Heterobranchia). Patellogastropoda and Heterobranchia clustered together in the same clade, which was located on the outermost branch of the six subclasses. Lottiidae formed an independent branch as (N. fuscoviridis + (L. goshimai and Lottia digitalis)) within Patellogastropoda. L. goshimai was shown to be the closest extant relative of Lottia digitalis, and this clade clustered with N. fuscoviridis.

The significance of Lottiidae species in the evolution and development of gastropods was confirmed through this study. Further mitogenome sequencing work was carried out to provide more comprehensive taxon sampling for the future, thus improving the understanding of the Lottiidae phylogeny and evolution within Gastropoda.

Gene arrangement of Patellogastropoda

The gene arrangements in four subclasses were compared to the hypothetical ancestral gastropod gene order[38] (Fig. 8). Among these subclasses, the fewest gene rearrangements are observed in Bathyacmaea nipponica of the Acmaeidae family, and only certain tRNA sequences exhibit shuffling (trnY and trnM), translocation (trnF, trnQ, trnF, trnC) and inversion (trnE)[39]. The gene order is closest to that of the family Nacellidae, with six tRNAs (trnT, trnR, trnN, trnA, trnK, trnI) and one PCG (nad3) exhibiting translocation. Recent studies of Nacellidae mitogenomes suggest that genome rearrangements are relatively conservative in this group[11]. The phylogenetic analyses showed that Nacellidae is the sister group of Acmaeidae, which confirmed that rearrangement may be helpful for phylogenetic analysis. Compared with the above two families, the gene order in Patellidae differs substantially, but the fragment from cytb to atp8 has been retained, with only a portion of this fragment exhibiting local inversion. However, the genome organization is almost the same in Patella ferruginea and Patella vulgate, indicating that they are conservative in the family Patellidae. The most noteworthy finding was that there are essential differences in gene arrangement among species of different Lottiidae families, but they share the common characteristic of rrnL and rrnS gene inversion. The mitogenomes of the Lottiidae family have retained a fraction of the clusters found in ancestral gastropods[31]. For instance, Lottia digitalis has retained nad4-nad4L, and L. goshimai has retained nad5-nad4-nad4l, with the nad4 and nad4l fragments inverted in both cases. In addition, an extremely high rate of gene rearrangement is found in N. fuscoviridis, and the irregular ordering may be caused by a high rate of sequence evolution[40]. We will need to conduct more research on the family to verify this in the future.

Figure 8

Mitochondrial genome organization of the two new Lottiidae species and available patellogastropod species.

Conclusion

In this study, the complete mitochondrial genome sequences of two new limpets, L. goshimai and N. fuscoviridis, belonging to Lottiidae, were characterized and compared. Duplications of tRNA genes are found in both species (trnM or trnW). In their tRNA secondary structures, both trnS1 and trnS2 are missing DHU stems, which is also observed in other species of the family. The phylogenetic relationships with other members of Gastropoda based on 13 mitochondrial PCGs were analysed. The results showed that the phylogeny was consistent with morphological observations and previous reports. In addition, a highly irregular rearrangement of mitochondrial genes was found within Lottiidae. Since there are currently few species in the family, it is impossible to determine whether this situation is associated with a single species or occurs throughout the family, which is worthy of further study.

Materials and methods

Sample collection and DNA extraction

Specimens of L. goshimai and N. fuscoviridis were collected from the coastal area of Xiangshan County (29.48°N, 121.98°E), Zhejiang Province, in the East China Sea and Jinzhou City (40.88°N, 121.13°E), Liaoning Province, in the Bohai Sea, respectively. Morphological identification of these samples was carried out by using published taxonomic books/available taxonomic keys, and we consulted with a taxonomist from the Museum of Marine Biology of Zhejiang Ocean University[41,42]. The samples were preserved in absolute ethyl alcohol before DNA extraction. Total genomic DNA was extracted from the operculum using the salting-out method[43] and was then stored at − 20 °C before sequencing.

Mitochondrial genome sequencing, assembly and annotation

The whole mitogenomes of the two limpets were sequenced using the Illumina HiSeq X Ten platform (Shanghai Origingene Bio-pharm Technology Co., Ltd. China). An Illumina PE library with an insert size of 400 bp was generated. The original sequencing data have been stored in the sequence read archive (SRA, https://trace.ncbi.nlm.nih.gov/Traces/sra/) of the National Center for Biotechnology Information (NCBI). NOVOPlasty software (https://github.com/ndierckx/NOVOPlasty) was used for the de novo assembly of the clean data without sequencing adapters to obtain the optimal assembly result[44]. Two newly assembled mitochondrial genomes were annotated on the MITOS web server (https://mitos2.bioinf.uni-leipzig.de/index.py) using the invertebrate genetic code, and start and stop codons were confirmed by comparing the obtained nucleotide sequences with those from closely related limpets[24,45,46].

Genome visualization, secondary structure prediction and comparative studies

Circular genome visualization was conducted with the CGView Server (https://stothard.afns.ualberta.ca/cgview_server/index.html)[47]. The secondary structure of the tRNA genes was predicted using the software ARWEN (https://130.235.244.92/ARWEN/) and the tRNAscan-SE v.2.0 web server (https://lowelab.ucsc.edu/tRNAscan-SE/), as implemented on the MITOS web server[45,48,49]. The nucleotide composition and relative synonymous codon usage (RSCU) of each PCG were calculated using MEGA 7.0[50]. AT and GC skew values were calculated with the following formula: AT skew = (A − T)/(A + T) and GC skew = (G − C)/(G + C)[51]. The ratio of nonsynonymous substitutions (Ka) to synonymous (Ks) substitutions was estimated with DnaSP6.0[52].

Preparation of datasets, model selection, phylogenetic analyses

For the phylogenetic analysis, DAMBE 5.3.19 was used to adjust the nucleotide sequences of 13 protein-coding genes (PCGs) of each species, and the nucleotide substitution saturation was analysed to determine whether these sequences were suitable for constructing phylogenetic trees[53]. Sixty published mitochondrial genomes were downloaded from NCBI as references, including those of 58 other marine gastropods and two outgroups (Cryptochiton stelleri and Katharina tunicata of Polyplacophora), and were analysed along with the mitogenome sequence of the two new Lottiidae species (Table 1). Then, the sequences of each of 62 species were aligned using ClustalW with the default parameters in MEGA 7.0. The phylogenetic analyses incorporated Bayesian inference (BI) methods using the program MrBayes v3.2 and maximum likelihood (ML) using IQ-TREE[54,55]. MrMTgui was used to combine the results of PAUP 4.0, Modeltest 3.7 and MrModeltest 2.3 to find the best substitution models (GTR + I + G) with the AIC for Bayesian inference (BI)[56-58]. BI analyses were conducted with two Markov chain Monte Carlo (MCMC) runs, each with four chains (three heated and one cold) run for 2,000,000 generations, with tree sampling every 1000 steps and a burn-in of 25%. ML analysis was performed with the best-fit substitution model automatically selected by ModelFinder, and the number of bootstrap replicates was set to 1000 in ultrafast likelihood bootstrapping to reconstruct a consensus tree[59]. The phylogenetic trees were visualized and edited using FigTree v1.4.3[60].