Literature DB >> 33152025

High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia.

Lemu Golassa1, Alebachew Messele1, Alfred Amambua-Ngwa2, Gote Swedberg3.   

Abstract

Deletions in Plasmodium falciparum histidine rich protein 2(pfhrp2) gene threaten the usefulness of the most widely used HRP2-based malaria rapid diagnostic tests (mRDTs) that cross react with its structural homologue, PfHRP3. Parasites with deleted pfhrp2/3 genes remain undetected and untreated due to 'false-negative' RDT results. As Ethiopia recently launched malaria elimination by 2030 in certain selected areas, the availability of RDTs and the scale of their use have rapidly increased in recent years. Thus, it is important to explore the presence and prevalence of deletion in the target genes, pfhrp2 and pfhrp3. From a total of 189 febrile patients visited Adama Malaria Diagnostic centre, sixty-four microscopically-and polymerase chain reaction (PCR)-confirmed P. falciparum clinical isolates were used to determine the frequency of pfhrp2/3 gene deletions. Established PCR assays were applied to DNA extracted from blood spotted onto filter papers to amplify across pfhrp2/3 exons and flanking regions. However, analysis of deletions in pfhrp2, pfhrp3 and flanking genomic regions was successful for 50 of the samples. The pfhrp2 gene deletion was fixed in the population with all 50(100%) isolates presenting a deletion variant. This deletion extended downstream towards the Pf3D7 0831900 (MAL7PI.230) gene in 11/50 (22%) cases. In contrast, only 2/50 (4%) of samples had deletions for the Pf3D7 0831700 (MALPI.228) gene, upstream of pfhrp2. Similarly, the pfhrp3 gene was deleted in all isolates (100%), while 40% of the isolates had an extension of the deletion to the downstream flanking region that codes for Pf3D7 13272400 (MAL13PI.485).The pfhrp3 deletion also extended upstream to Pf3D7 081372100 (MAL13PI.475) region in 49/50 (95%) of the isolates, exhibiting complete absence of the locus. Although all samples showed deletions of pfhrp2 exon regions, amplification of an intron region was successful in five cases. Two different repeat motifs in the intron regions were observed in the samples tested. Pfhrp2/3 gene deletions are fixed in Ethiopia and this will likely reduce the effectiveness of PfHRP2-based mRDTs. It will be important to determine the sensitivity PfHRP 2/3-based RDTs in these populations and conduct a countrywide survey to determine the extent of these deletions and its effect on routine RDT-based malaria diagnosis.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 33152025      PMCID: PMC7644029          DOI: 10.1371/journal.pone.0241807

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

In Ethiopia, Plasmodium falciparum and Plasmodium vivax are co-transmitted and respectively accounted for 60% and 40% of all malaria cases [1,2]. Nearly 68% of the landmass of Ethiopia is favourable for malaria transmission [1] and endemicity is heterogeneous with varied epidemiological presentation in different geographic settings [3]. Like in many parts of Africa, the incidence of malaria has substantially declined with a reported 40% reduction between 2000 and 2015 [4,5]. Ethiopia is on track to achieve the 2020 milestone to reduce the incidence of malaria by 40%. This also aligns with the World Health Organization (WHO) Global Technical Strategy (GTS) to intensify existing malaria interventions towards elimination by 2030 [5]. Rapid diagnostic tests (RDTs) were also introduced to improve early diagnosis of malaria in remote areas where microscopic examination of blood smears remains impractical. A majority of commercially available mRDTs are designed to detect malaria specific antigens such as lactate dehydrogenase or aldolase for pan-malaria diagnosis and PfHRP2 for P. falciparum specific diagnosis [6]. RDTs have become extremely essential for implementing early diagnosis and prompt effective treatment of malaria and for the continuous reduction of its burden. In Ethiopia, mRDTs were introduced as one of the diagnostic methods following the revision of malaria diagnosis and treatment guideline in 2004 in the country. Depending on the antigen they target, different types of RDTs exist. Those that target histidine-rich protein-2 (HRP-2) only detect P. falciparum, while those that target the parasite enzyme lactate dehydrogenase (LDH) and aldolase can detect non-falciparum from mixed infection [7,8]. PfHRP2/3-based RDTs have been widely used for detection of P. falciparum at health posts/community levels in Ethiopia since 2005 [9]. PfHRP2 is a non-essential protein encoded by pfhrp2 gene located on chromosome 8 of P. falciparum. Its structural homologue, PfHRP3, is coded by a locus on chromosome 13 [10]. Pfhrp3 antigen epitopes are recognised by some PfHRP2-based RDTs [11] and may influence the diagnostic performance of these mRDTs. Hence, PfHRP3 contributes to reactivity of PfHRP2-based RDTs. Although PfHRP2-based RDTs have been widely used, its performance is complicated by the natural deletion of pfhrp2 gene in parasite populations in some geographical regions. Variation in the performance of RDTs has been observed, probably driven by polymorphisms in gene loci targeted, such as the recently described deletions in the Pfhrp2/3 loci. The prevalence and dynamics of these pfhrp2/3 deleted P. falciparum strains and their impact on diagnosis has not been extensively investigated in Ethiopia. Following the first report detailing the deletion of the pfhrp2 gene in P. falciparum isolates from Peru, several studies have shown the global spread of malaria parasites lacking pfhrp2 gene and the flanking chromosomal regions [12]. This generated anxiety on possible reduced sensitivity of PfHRP2-based RDTs. In Eritrea, P. falciparum lacking pfhrp2 now constitute a major threat to malaria control [13,14] as they are not detected by PfHRP2-based RDTs and remain untreated. It has been suggested that these strains with deletions at pfhrp2/3 genes have a fitness advantage and pose a challenge to progress made in malaria control and elimination [15] as these parasites will escape detection by PfHRP2-based RDTs and may be selected to expand due to routine use of RDTs leading to increasing frequencies of parasite population with pfhrp2/3 deleted genes in the communities. Though P. falciparum strains without these loci continue to thrive, the role of PfHRP2/3 loci in parasite virulence and fitness is not clear as these are expressed in all stages of development of parasite, probably contributing to survival advantage [16-18]. A substantial proportion of parasite isolates with both pfhrp2 and pfhrp3 gene deletions have been reported across malaria endemic countries in Africa with the highest prevalence of deletion from Eritrea (62%) [14] and the lowest from Angola (0.4%) [19]. Indeed, in some hospitals in Eritrea the levels of gene deletions were as high as 80% [14]. As the malaria transmission intensity and intervention history in Ethiopia is similar to that in Eritrea, it is therefore possible that pfhrp2/3 deleted isolates may be in circulation in Ethiopia at similarly high frequencies. Following the WHO recommendation for pfhrp2/3 surveys and cross border surveillance activities, this study investigates the extent of pfhrp2/3 deleted P. falciparum parasites in an Ethiopian P. falciparum population. Molecular analyse targeting the region across exons and flanking genes were used to provide evidence of gene deletions in the pfhrp2/3 genes.

Materials and methods

Study area

The study was conducted in Adama town, East Shoa Zone, Oromia, Ethiopia. The town is located at 8.54°N and 39.27°E, at an elevation of 1,712 meters above sea levels and is 99 km southeast of Ethiopia’s capital, Addis Ababa. Located between the base of an escarpment in the West and the Great Rift Valley in the East, Adama town experiences rainfall from mid-June to mid-September with short rains in March. Adama Malaria diagnostic center is the oldest laboratory exclusively committed to malaria diagnosis. As a matter of fact, people from the Adama town and the surrounding rural areas preferentially use this laboratory as far as malaria diagnosis is concerned over hospitals and other surrounding health centers in the town. The study site exhibits high malaria transmission with both P.falciparum and P.vivax malaria are co-endemic. In the study area, major and minor transmission seasons exist. The major malaria transmission season is from September through November and the minor from April to May. Anopheles arabiensis is the dominant malaria vector.

Sample collection and diagnosis of malaria

The study was initiated to explore the genetic variation and deletions in the pfhrp2/3 genes. Finger-prick blood samples were collected from 64 febrile patients attending Adama Malaria Diagnostic Centre from September through December 2015. Thick and thin blood smears were prepared for microscopic diagnosis of malaria parasite infections and identification of species. Parasite densities were calculated according to described standard methods (Parasites/μL = no. of asexual parasites X 8000/no. of WBC counted) [1]. Infected blood samples were spotted onto Whatman 3MM filter papers for parasite DNA extraction.

PCR confirmation of Plasmodium falciparum infections

Parasite DNA was extracted from dried blood spots using the chelex100 extraction method as described earlier [20]. The presence of Plasmodium species was confirmed by targeting 18S rRNA by a nested polymerase chain reaction (nPCR) using genus-specific primers rPLU 6: (5’TTAAAATTGTTGCAGTTAAAACG3’), rPLU 5: (5’CCTGTTGTTGCCTTAAACTTC3’) followed by species-specific primers rFAL 1: (5’TTAAACTGGTTTGGGAAAACCAAATATATT3’), rFAL2: (5’ACACAATGAACTCAATCATGACTACCCGTC3’) as described by Snounou [21]. The cycling conditions were as follows: denaturation, 95°C for 5 min; 35 cycles of 94°C for 30 s, 56°C for 30 s, and 60°C for 60 s; and a final extension at 60°C for 5 min. The presence of amplification product is detected by simple ethidium bromide staining following agarose gel electrophoresis and a 205 bp size of the PCR product confirms P. falciparum.

PCR-based genotyping of pfhrp2/3 deletions

Amplifications of exons 2 and their flanking regions of pfhrp2/3 genes were done by semi-nested PCR [22] using published protocols and primers (Table 1). Nest-1 PCR targets repeat sequences within the most variable part of the genes while the second primer set targets an intron region. For pfhrp2, PCR nest-1 product sizes of 720–830 bp were expected while for Pfhrp3, the expected PCR product size was< 500 bp. The PCR products were purified by the GeneJet PCR Cleanup Kit from Thermo Fisher Scientific and sent for sequence determination at Eurofins genomics, Germany. Sequences were analysed by the 4peaks program (A. Griekspoor and Tom Groothuis, nucleobytes.com).
Table 1

Primers name and sequences used to amplify pfhrp2/3 genes including the flanking regions.

Primer nameGeneSequence (5’ → 3’)
Hrp-2 outer (reverse primer)HRP25'-TCT ACA TGT GCT TGA GTT TCG-3'
Hrp-2 outer (forward primer)HRP25'-GGT TTC CTT CTC AAA AAA TAA AG-3'
Hrp-2 inner (forward primer)HRP25'- GTA TTA TCC GCT GCC GT TTT GCC-3'
Hrp-2 inner (reverse primer)HRP25'-CTA CAC AAG TTA TTATTA AAT GCG GAA- 3'
pfhrp2newoutfwHRP2Fw: ATA TTT GCA CAT CTT GC
pfhrp2newoutrevHRP2Rev: ATG GTT TCC TTC TCA AA
pfhrp2newnestfwHRP2Fw: TCG CTA TCC CAT AAA TTA CA
pfhrp2newnestrevHRP2Rev: GAT TAT TAC ACG AAA CTC AAG C
228 outer-forward228Fw: CAA TAG TTG CTT GTG CGG ATG
228 outer-reverse228Rev AGA AGT TGC AGA GAC ATA CTT AGG
228 nested-forward228Fw: AGA CAA GCT ACC AAA GAT GCA GGT
228 nested-reverse228Rev: TAA ATG TGT ATC TCC TGA GGT AGC
230 outer-forward230Fw: CCC TGC TAT ATA GAT GAG GAA A
230 outer-reverse230Rev: CTA CCA CTT CTG TTG CTA CC
230 nested forward230Fw: TAT GAA CGA AAT TTA AGT GAG GCA
230 nested-reverse230Rev: TAT CCA ATC CTT CCT TTG CAA CAC C
Hrp3 out rev newHRP35´-CCA TAC ACT TAT GCT GTA TTTA- 3´
Hrp3 outfw newHRP35´- TGG TAA TTT CTG TGT TTA TG- 3´
Hrp3-2 nestfwHRP35´- TAT CCG CTG CCG TTT TTG CTT CC- 3´
Hrp3 nest revHRP35´- TGG TGT AAG TGA TGC GTA GT- 3´
MAL 475 REV set1 (out-rev)4755´-TCC CAC ATC GTA TAT CTC AGT TTC- 3´
MAL 475 FWD set1 (out-fw)4755´-GGA AAG CAC AAC AAG ATG GAT AC- 3´
MAL 13PI 475 rev (nest-rev)4755´-TCG TAC AAT TCA TCA TAC TCA CC- 3´
MAL 13PI 475 fw (nest-fw)4755´-TTC ATG AGT AGA TGT CCT AGG AG- 3´
MAL 485 REV set1 (out-rev)4855´-GCT TCT TTC CAC ATT TCT CAC AT- 3´
MAL 485 FWD set5 (out-fw)4855´-GTG TGT TTC CAT GTA TTA CGG AAG- 3´
MAL 12PI 485 rev (nest-rev)4855´-AAA TCA TTT CCT TTT ACA CTA GTG C- 3´
MAL 12PI 485 fw (nest-fw)4855´-TTG AGT GCA ATG ATGATG GGA G- 3´

Amplification of pfhrp2/3 flanking regions

For amplifications of genes immediately flanking pfhrp2 (MAL7P1.230 (5.535 kb upstream) and MAL7P1.228 (6.49 kb downstream)), and pfhrp3 (MAL13P1.485 (4.404 kb upstream) and MAL13P1.475 (1.684 kb downstream)), the following primers and PCR conditions were used (Table 2).
Table 2

PCR conditions and expected product sizes of the pfhrp2/3 flanking regions.

GenePCR conditionsExpected PCR product size
MAL7P1_22894°C for 10 min, followed by 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min227 bp
MAL7P1_23094°C for 10 min, followed by 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min346 bp
MAL13P1_47594°C for 10 min, followed by94°Cfor 30 sec, 60°C for 30 sec, 68°C for 1 min260 bp
MAL12P1_48594°C for 10 min, followed by 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min287 bp
To rule out the possibility that the absence of amplification in pfhrp2/3 may be an artifact of the PCR, alternative primers with different binding sites and amplification conditions were used. All primers were used on samples from Tanzania with intact pfhrp2/3 genes with good results. In addition, amplifications of pfmdr1 and pfubp-1 genes were successful in all samples suggesting the deletion of pfhrp2/3 genes.

Ethical issue

The study was approved by Aklilu Lemma Institute of Pathobiology, Addis Ababa University, Institutional review Board. Written consent and/or assent were obtained from each study participant.

Results

Of 189 self-reporting febrile patients seeking malaria diagnosis at Adama Malaria Diagnostic Centre, 33.9% (64/189) were positive for P. falciparum as confirmed by expert microscopy which was later proven positive by PCR. The male: female ratio was 3.1:1. Participant’s mean age was 25.2 years (range 11–48). The minimum parasite density reported was 400 parasites/μL. Although all microscopically confirmed cases tested positive by PCR, only 50 samples had enough DNA for further analysis of deletion in pfhrp2/3 genes and the flanking regions. By targeting six regions in the pfhrp2/3 genes and their flanking genes, different deletion patterns were observed in Ethiopian P. falciparum clinical samples. Most parasite isolates had deleted the gene located 3’ of pfhrp2, PF3D7_0831900, compared to the flanking gene5’, PF3D7_0831700. In contrast, the 5’ flanking PF3D7_1372100 gene, upstream of pfhrp3, showed more deletions than the downstream 3’ flanking PF3D7_1372400 region. Combining deletions in the genes and flanking regions, the most common pattern exhibited in the isolates was the presence of the two flanking regions for pfhrp2 in combination with the downstream flanking region for pfhrp3. This was followed by isolates that had a deleted downstream flanking region of pfhrp3 but with the two flanking regions of pfhrp2 retained. Notably, only one isolate showed intact flanking regions for both gene loci. Amplifications of pfmdr1 and pfubp-1 genes in these samples are an indication that the absence of PCR products in the pfhrp2/3 genes and the respective flanking regions are due to deletions.

Genetic deletion of pfhrp2 and pfhrp3 and their flanking genes

The deletion variant at pfhrp2 gene was fixed in the population analysed as the gene was deleted in all 50(100%) isolates assessed. The deletion extended downstream pfhrp2 gene flanking region towards the Pf3D7 0831900(MAL7PI.230) gene in 11/50 (22%) of the cases (Table 3). In contrast, only 2/50(4%) of samples had deletions for the upstream gene Pf3D7 0831700(MALPI.228).
Table 3

Extension of deletions of pfhrp 2 and pfhrp3 genes, the respective flanking regions and exon primers used in Ethiopian isolates.

DNA sample ID.Gene 228pfhrp2Gene 230Gene 475pfhrp3Gene 485
1+----+
2+----+
3+-+---
4+-+--+
5+-+--+
6+-+--+
7+-+--+
8+-+(+)-+
9+-+--+
10+-+--+
11+-+--+
12+-+---
13+-+---
14+-----
15+-+--+
16+----+
17+----+
18+----+
19+-+--+
20+-+---
21+-+---
22+-+---
23+-+---
24+-+---
25+-----
26+-+--+
27+-+--+
28+----+
29+-+--+
30+-+---
31+-+---
32+-+---
33--+---
34--+---
35+-+---
36+-----
37+-+--+
38+-+---
39+----+
40+----+
41+-+--+
42+-+--+
43+-+--+
44+-+--+
45+-+--+
46+-+---
47+-+---
48+-+---
49+-+--+
50+-+--+
Similar results were observed for pfhrp3 and flanking regions. Here, all the isolates had deletions in the pfhrp3 gene (100%). Like for pfhrp2 gene, pfhrp3 deletion extended to the downstream flanking region to include Pf3D7 13272400 (MAL13PI.485) in 40% of samples. However, the extension of the deletion was more prevalent upstream towards Pf3D7 081372100 (MAL13PI.475), with 49/50 (95%) of isolates deleted at these loci. The summary of deletions in pfhrp2 and pfhrp3 genes and the respective flanking regions are indicated in S1 File. In addition to the exon primers that cover the normally analysed variable region, a set of primers targeting an intron sequence with a varying number of AT repeats. In spite of the negative results for all samples in exon-based PCR, five samples actually gave PCR products for the intron region. The samples contained different numbers of AT repeat sequence motif (one sample with 10 repeats, and four samples with 17 repeats) and suggest that the deletion in this region did not involve the entire region (Table 4).
Table 4

Repeat sequences in pfhrp2 intron, in 50 Ethiopian samples tested, those not listed did not give PCR products.

Sample ID. (No. tested = 50 samples)AT repeats intron
217
2417
2510
2717
3417

Discussion

As per WHO which hosted a technical consultation on pfhrp2/3 gene deletions and drafted interim guidance for investigating false-negative RDTs [23], understanding the distribution and evolution of these mutant parasites is a priority. However, it is yet unknown whether reliance on PfHRP2-based RDTs to guide treatment across malaria endemic countries is exerting evolutionary pressure favouring the spread of this mutation. At present, PfHRP2-based RDTs are central to malaria control programmes in spite of the threat by parasites that do not express PfHRP2. This study is the first to report the presence of extensive deletion of pfhrp2 gene including deletion in its structural homolog, pfhrp3, in clinical isolates in Ethiopia All 50 samples (100%) yielded deletion for pfhrp2 and pfhrp3 genes. In pfhrp2 gene, the deletion extended to 4% (2/50) of flanking region gene 228. Flanking region gene 230 contained deletions in 22% (11/50) of the samples. Around pfhrp3 genes 475 and 485 were deleted for 95% and 40% of the samples, respectively. The fact that HRP2-based RDTs tests accounted for 74% of malaria diagnostic testing in the sub-Saharan Africa in 2017 [24], such massive utilization of RDTs could lead to selection and spread of P. falciparum strains that can evade detection through the deletion of the pfhrp2 genes. Nowadays, a great concern with the use of PfHRP2-based RDTs malaria diagnosis has been the evolving reports of P. falciparum isolates lacking the pfhrp2 and pfhrp3 genes, which respectively encode the PfHRP2 and the PfHRP3 proteins [12,25,26]. The deletion assay includes six targets of pfhrp2/3 and flanking regions, and at least one locus was amplified for 50 samples out of 64 microscopically and PCR confirmed P. falciparum clinical samples collected. While the deletion in pfhrp2 gene extended downstream in 11/50 (22%) of the isolates, the deletion was only 4% in upstream of pfhrp2. However, it is unclear if these pfhrp2 deletions are recent events or emerged prior to the introduction of PfHRP2-based RDTs in Ethiopia. In Peru, for instance, pfhrp2-deleted parasites were present before the introduction of RDTs, but the sweep in the population that occurred after RDT introduction shows the strength of selection against this new diagnostic tool [27]. It is indicated that the extensive use of PfHRP2-based RDTs is sufficient to select P. falciparum parasites lacking this protein [15]. Similarly, deletion was evident in 100% of the isolates analysed in pfhrp3 gene and extended to the downstream flanking region that codes for Pf3D7 13272400 (MAL13PI.485) gene in 40% of the isolates. The pfhrp3 deletion also extended upstream to Pf3D7 081372100 (MAL13PI.475) region in 49/50 (95%) of the isolates, exhibiting complete absence of the locus. Two distinct repeat motifs were observed for pfhrp2 intron region in 50 of the samples tested suggesting that the deletion in this region did not involve the entire region. Interestingly, PfHRP2-based RDTs are far more popular in Ethiopia than pLDH-based RDTs, partly because of their higher sensitivity for P. falciparum diagnosis. The presence of deletions in both pfhrp2 and pfhrp3 genes suggest that this could have been a result of a recent selection as a consequence of the widely used PfHRP2-based RDTs. The possible spread of pfhrp2/3 deleted parasite from a neighbour country like Eritrea can’t be overlooked for the presence high deletions in Ethiopian P. falciparum populations. Very high frequencies of these deletions have also been reported in Eritrea, a close geographic population and neighbour to Ethiopian parasite populations [13,14]. Deletions in both genes are less frequent in other African populations, though this phenomenon is quite prevalent in South American countries [27,28]. Recent whole genome analysis of P. falciparum across Africa countries found isolates from Ethiopia to be highly divergent from the rest of continent, defining a genomic background that could respond differently to selective forces such as RDTs and drugs [20]. These deletion isolates formed a closely related cluster probably from clonal proliferation of a recent pfhrp2-deleted ancestor [27]. Expansion of these deleted isolates could jeopardise the effectiveness of PfHRP2-based RDTs. RDT-based malaria diagnosis followed by treatment could be selectively clearing infections with parasites retaining the pfhrp2/3 genes and hence increase the rate of spread of parasites with deletions [29]. When the pfhrp2 gene deletion was reported in 2010 in South America, this led to the recommendation against the use of PfHRP2-based RDTs in these areas [30-32]. If the results here are corroborated in a larger study across Ethiopia, a similar recommendation may be warranted. Unfortunately, patient recruitment in this study was based on microscopy and this does not allow us to determine the outcome of PfHRP2/3-based RDT for P. falciparum population with complete deletion of pfhrp2/3 genes. Hence, further large-scale studies using microscopy and PfHRP2/3-based RDTs are required to validate these high frequencies of pfhrp2/3 gene deletions and their effect on RDT malaria diagnosis in Ethiopia. For now, polymorphisms in pfhrp2/3 genes in Ethiopian isolates don’t seem to influence performance of currently used PfHRP2 RDTs given that they have been widely used in the country. Furthermore, as the samples were collected from one location in Ethiopia, a geographically expanded study would better inform the national malaria control program (NMCP) on need for reviewing policy on type of mRDTs in the country and the extent of pfhrp2/3 genes deletions. This study has several important limitations. The samples were collected during a single malaria transmission season spanning September through December 2015 from one study site. Hence, the results here can’t be generalized to the clinical isolates from other endemic areas of Ethiopia. The number of isolates analysed was also small in number (50 P. falciparum clinical isolates). The fact that the clinical samples were collected using microscopy alone, it is impossible to know if the deleted isolates would test negative or positive for RDTs in the absence of pfhrp2/3 genes as we didn’t perform RDT-based diagnosis. In summary, P. falciparum parasite populations with deletions of the pfhrp2 and pfhrp3 genes are present in Adama site of Ethiopia. Continuous monitoring of deletions among clinical isolates in the target regions is important in this era of malaria elimination, which largely depends on RDTs.

Summary of pfhrp2, pfhrp3 amplification and their respective flanking genes in P. falciparum samples collected in Ethiopia.

(PDF) Click here for additional data file.

PCR protocol used for amplification of Plasmodium DNA.

(DOC) Click here for additional data file.

Pfhrp2/3 gene amplification for Tanzanian samples (both positive and negative) and Ethiopian samples (all negatives).

a). Tanzanian samples tested positives for hrp2/3 genes. b). Ethiopian samples tested negatives for hrp2/3 genes (please note that no positive control is included). (DOC) Click here for additional data file. 4 Sep 2020 PONE-D-20-24429 High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia PLOS ONE Dear Dr. Golassa, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. I am sure that the reviewers' comments are very useful to improve this manuscript. Please consider and respond to all of the expert reviewers' comments and extensively revise the manuscript based on their comments. Please submit your revised manuscript by Oct 19 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Takafumi Tsuboi Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for including the following funding information within the acknowledgements section of your manuscript; "This work was supported through the DELTAS Africa Initiative [DELGEME grant 107740/Z/15/Z]. The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS)’s Alliance for Accelerating Excellence in Science in Africa (AESA) and supported by the New Partnership for Africa’s Development Planning and Coordinating Agency (NEPAD Agency) with funding from the Wellcome Trust [DELGEME grant 107740/Z/15/Z] and the UK government. " We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "No, the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." 3. Thank you for including your competing interests statement; "No, I have read the journal's policy and the authors of this manuscript have the following competing interests" Please complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now This information should be included in your cover letter; we will change the online submission form on your behalf. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this study, the authors determined the deletions of pfhrp2 and pfhrp3, as well as of genes upstream and downstream of these two genes, by PCR analysis of samples from patients infected with Plasmodium falciparum in Ethiopia. The authors show that in a substantial number of samples, the parasite lacks both pfhrp2 and pfhrp3, which may lead to pseudo-negative results when using HRP2-based RDTs for testing individuals suspected to have malaria in Ethiopia. I think some modifications and additional explanations are required. (1) Abstract (Conclusion, line 5 from the bottom): Because the term “fixed” might have the same meaning as “repaired,” I was confused when I read the manuscript for the first time. In this paper, did you mean “found?” I think it would be better to rephrase the sentence. (2) Introduction (Paragraph 3, line 9): Please replace “pfhr2/3loci” with “pfhrp2/3 loci.” (3) Introduction (Paragraph 4, lines 1 to 6 from the bottom): The sentences from “As per” to “of this mutation” should be moved to the Discussion section. (4) Methods: I think the information about the pseudo-positive rates of the HRP2-based RDTs is important. Do you have results of the RDTs for samples from the 50 patients infected with hrp2- hrp3- parasite? (5) Results (p. 14, line 12): The term “fixed” should be replaced with an appropriate term. (6) Results (p. 14, line 4): You have annotated “Table 3;” however, important results and/or information are included in Additional file 1. You should annotate Additional file 1 as Table 3. (7) Table 3: I cannot understand what have you listed in Table 3. Why did you list the five samples? Reviewer #2: This manuscript reports the results of a small study assaying the prevelence of Pfhrp2 and 3 deletions in 50 samples from a single collection point in Ethiopia collected between September and November 2015. The authors report that all parasites characterised had deletions of both genes, presumably rendering them non-detectable by the commonly used PfHRP2 based RDTs used in this area. The methodology is appropriate, and the results of interest. I have several points that the authors may consider for revision: As there are no page numbers on the document, I have numbered them myself, with Page 1 of the PDF being the abstract… General The manuscript needs a thorough proofreading to correct numerous typological, spelling and grammatical errors. Please could data on the malaria endemicity of the region from which samples were collected be given? Is this a high transmission region for P. falciparum? Samples are rather few, and are from a very specific region of Ethiopia. It is very difficult to ascertain whether the results here are representative of a the wider Ethiopian P. falciparum population or simply constitute a small local population. There is no description of the diagnosistics commonly used in this region of Ethiopia – as the patients here were diagnosed by microscopy, is it right to assume this is the standard protocol? In which case, presumably, RDTs are not used here. In which case, the authors need to offer some hypothesis of why HRP2 deleted parasites dominate in a region where there should have not undergone selection…. There is a general lack of essential information in the introduction; it would be beneficial for the reader to know not only the malariometrics of the study area (entomological inoculation rates, malaria parasite species present, parasite prevelence etc), but also the extent to which RDTs are used for diagnosis, and when they were introduced. Introduction Page 2, sentence 1: please use percentages (60%) instead of “in 0.60 of cases”. Page 2, sentence 3. 40% reduction since when? Page 2, paragraph 3. The authors contend that PfHRP2 deletions have not been extensively surveyed in Africa. There are, in fact, very many reports detailing such surveys. Methods Page 4. Please at least give the primer names and conditions for the PCR rather than referring to previous publications Page 6. The positive control samples (with the Pfhrp2 genes intact) come from Tanzania. Is it possible that the strains circulating in Ethiopia have different sequences at the primer binding sights in hrp2/3 genes, rendering the PCR ineffective? Why wasn’t an Ethiopian PfHRP2 intact P. falciparum used as a positive control? Discussion Page 11 paragraph 1 – the authors find three deletion variants according to the size of the deletion. This does not fit with proposal of clonal expansion of one mutant. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Richard Culleton [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 15 Oct 2020 Dear respected reviewers, I would like to thank you for your critical review of our manuscript and constructive comments you have given us to enrich our manuscript. Dear Editor, I appreciate your constructive comments and guidance. I have uploaded a point-by-point response to your respective comments online for your consideration Sincerely, Lemu Golassa, PhD Submitted filename: Response to Reviewers, PLOS_LG.doc Click here for additional data file. 19 Oct 2020 PONE-D-20-24429R1 High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia PLOS ONE Dear Dr. Golassa, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Both expert reviewers have mostly appreciated the Authors' efforts for the significant improvement of the manuscript. However, please make a minor revision with all the recommendation by the Reviewer 2. Especially, “fixed” is entirely appropriate so please revert "found" back to "fixed". Please submit your revised manuscript by Dec 03 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Takafumi Tsuboi Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: I Don't Know ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The sentence on p. 10, line 3 (In addition to ~~ AT repeats) was incomplete. “a set of primers targeting an intron sequence with a varying number of AT repeats was investigated.”? Reviewer #2: Abstract The word “fixed” is generally understood to mean that an allele is at 100% prevalence in a population; it is a well-known and understood genetic term. In my opinion, the authors should revert to the word “fixed”, rather than using the replacement term “found” which doesn’t really make sense in the context of this sentence. In any incidence where the prevalence of a mutation was found to be 100%, the word “fixed” is entirely appropriate, and preferred over the term “found”. General In response to my comment regarding the usage of RDTs as diagnostics in the area, the authors have answered, convincingly, in their replies to the reviewers document, but have not included this information in the modified manuscript! It would be useful for readers of the MS to also have this information. Please could they include this information in the discussion section? ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Richard Culleton [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 19 Oct 2020 Dear Editor, Thanks you very much for the update. Query 1. Both expert reviewers have mostly appreciated the Authors' efforts for the significant improvement of the manuscript. However, please make a minor revision with all the recommendation by the Reviewer 2. Especially, “fixed” is entirely appropriate so please revert "found" back to "fixed". Response: Thanks, we revert ‘fixed’ instead of ‘found’ across the document. Other points raised by reviewer # have been well addressed in the previous responses to reviewers. Submitted filename: Response to Reviewers, PLOS_LG.doc Click here for additional data file. 21 Oct 2020 High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia PONE-D-20-24429R2 Dear Dr. Golassa, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Takafumi Tsuboi Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 26 Oct 2020 PONE-D-20-24429R2 High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia Dear Dr. Golassa: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Takafumi Tsuboi Academic Editor PLOS ONE
  26 in total

1.  Plasmodium falciparum: histidine-rich protein II is expressed during gametocyte development.

Authors:  R E Hayward; D J Sullivan; K P Day
Journal:  Exp Parasitol       Date:  2000-11       Impact factor: 2.011

Review 2.  Ensuring quality and access for malaria diagnosis: how can it be achieved?

Authors:  David Bell; Chansuda Wongsrichanalai; John W Barnwell
Journal:  Nat Rev Microbiol       Date:  2006-09       Impact factor: 60.633

3.  Effect of sequence variation in Plasmodium falciparum histidine- rich protein 2 on binding of specific monoclonal antibodies: Implications for rapid diagnostic tests for malaria.

Authors:  Nelson Lee; Joanne Baker; Kathy T Andrews; Michelle L Gatton; David Bell; Qin Cheng; James McCarthy
Journal:  J Clin Microbiol       Date:  2006-08       Impact factor: 5.948

Review 4.  Update on rapid diagnostic testing for malaria.

Authors:  Clinton K Murray; Robert A Gasser; Alan J Magill; R Scott Miller
Journal:  Clin Microbiol Rev       Date:  2008-01       Impact factor: 26.132

5.  A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests.

Authors:  Dionicia Gamboa; Mei-Fong Ho; Jorge Bendezu; Katherine Torres; Peter L Chiodini; John W Barnwell; Sandra Incardona; Mark Perkins; David Bell; James McCarthy; Qin Cheng
Journal:  PLoS One       Date:  2010-01-25       Impact factor: 3.240

6.  Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru.

Authors:  Sheila Akinyi; Tonya Hayden; Dionicia Gamboa; Katherine Torres; Jorge Bendezu; Joseph F Abdallah; Sean M Griffing; Wilmer Marquiño Quezada; Nancy Arrospide; Alexandre Macedo De Oliveira; Carmen Lucas; Alan J Magill; David J Bacon; John W Barnwell; Venkatachalam Udhayakumar
Journal:  Sci Rep       Date:  2013-09-30       Impact factor: 4.379

7.  Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.

Authors:  Joseph F Abdallah; Sheila Akinyi Okoth; Gustavo A Fontecha; Rosa Elena Mejia Torres; Engels I Banegas; María Luisa Matute; Sandra Tamara Mancero Bucheli; Ira F Goldman; Alexandre Macedo de Oliveira; John W Barnwell; Venkatachalam Udhayakumar
Journal:  Malar J       Date:  2015-01-21       Impact factor: 2.979

8.  The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015.

Authors:  S Bhatt; D J Weiss; E Cameron; D Bisanzio; B Mappin; U Dalrymple; K Battle; C L Moyes; A Henry; P A Eckhoff; E A Wenger; O Briët; M A Penny; T A Smith; A Bennett; J Yukich; T P Eisele; J T Griffin; C A Fergus; M Lynch; F Lindgren; J M Cohen; C L J Murray; D L Smith; S I Hay; R E Cibulskis; P W Gething
Journal:  Nature       Date:  2015-09-16       Impact factor: 49.962

9.  Rapid diagnostic tests for malaria diagnosis in the Peruvian Amazon: impact of pfhrp2 gene deletions and cross-reactions.

Authors:  Jessica Maltha; Dionicia Gamboa; Jorge Bendezu; Luis Sanchez; Lieselotte Cnops; Philippe Gillet; Jan Jacobs
Journal:  PLoS One       Date:  2012-08-28       Impact factor: 3.240

Review 10.  Malaria epidemiology and interventions in Ethiopia from 2001 to 2016.

Authors:  Hiwot S Taffese; Elizabeth Hemming-Schroeder; Cristian Koepfli; Gezahegn Tesfaye; Ming-Chieh Lee; James Kazura; Gui-Yun Yan; Guo-Fa Zhou
Journal:  Infect Dis Poverty       Date:  2018-11-05       Impact factor: 4.520

View more
  13 in total

1.  Assessment of Plasmodium falciparum histidine rich protein 2 and /3 (pfhrp 2&/ pfhrp 3) gene deletion or mutation in Plasmodium falciparum positive blood samples in a tertiary care centre in South India.

Authors:  Monika Sivaradjy; Abdoul Hamide; Sriram Krishnamoorthy; Nonika Rajkumari; Vamsi Mohan; Ferdina Marie Sharmila
Journal:  J Parasit Dis       Date:  2022-05-11

2.  Malaria serosurvey among acute febrile patients come for health care seeking at the high malaria-endemic setting of North West Ethiopia.

Authors:  Fassikaw Kebede; Tsehay Kebede
Journal:  SAGE Open Med       Date:  2022-07-16

3.  Nationwide Surveillance of Pfhrp2 Exon 2 Diversity in Plasmodium falciparum Circulating in Symptomatic Malaria Patients Living in Ghana.

Authors:  Dorcas G Bredu; George K Ahadzi; Donu Dickson; Nana Y Peprah; Alexander Asamoah; George A Asumah; Benjamin Abuaku; Kwame K Asare; Dorcas Obiri-Yeboah; Colby T Ford; Eugenia Lo; Keziah L Malm; Linda E Amoah
Journal:  Am J Trop Med Hyg       Date:  2022-05-02       Impact factor: 3.707

4.  Rapid diagnostic test negative Plasmodium falciparum malaria in a traveller returning from Ethiopia.

Authors:  Stefan Schlabe; Ingrid Reiter-Owona; Tamara Nordmann; Ramona Dolscheid-Pommerich; Egbert Tannich; Achim Hoerauf; Jürgen Rockstroh
Journal:  Malar J       Date:  2021-03-12       Impact factor: 2.979

5.  Plasmodium falciparum pfhrp2 and pfhrp3 Gene Deletions from Persons with Symptomatic Malaria Infection in Ethiopia, Kenya, Madagascar, and Rwanda.

Authors:  Eric Rogier; Jessica N McCaffery; Doug Nace; Samaly Souza Svigel; Ashenafi Assefa; Jimee Hwang; Simon Kariuki; Aaron M Samuels; Nelli Westercamp; Arsène Ratsimbasoa; Milijaona Randrianarivelojosia; Aline Uwimana; Venkatachalam Udhayakumar; Eric S Halsey
Journal:  Emerg Infect Dis       Date:  2022-03       Impact factor: 6.883

6.  Epidemiology of mutant Plasmodium falciparum parasites lacking histidine-rich protein 2/3 genes in Eritrea 2 years after switching from HRP2-based RDTs.

Authors:  Selam Mihreteab; Karen Anderson; Cielo Pasay; David Smith; Michelle L Gatton; Jane Cunningham; Araia Berhane; Qin Cheng
Journal:  Sci Rep       Date:  2021-10-26       Impact factor: 4.996

7.  Investigation of Plasmodium falciparum pfhrp2 and pfhrp3 gene deletions and performance of a rapid diagnostic test for identifying asymptomatic malaria infection in northern Ethiopia, 2015.

Authors:  Colleen M Leonard; Ashenafi Assefa; Jessica N McCaffery; Camelia Herman; Mateusz Plucinski; Heven Sime; Hussein Mohammed; Amha Kebede; Hiwot Solomon; Mebrahtom Haile; Matt Murphy; Jimee Hwang; Eric Rogier
Journal:  Malar J       Date:  2022-03-04       Impact factor: 2.979

8.  Plasmodium falciparum histidine-rich protein 2 and 3 genes deletion in global settings (2010-2021): a systematic review and meta-analysis.

Authors:  Ayalew Jejaw Zeleke; Asrat Hailu; Abebe Genetu Bayih; Migbaru Kefale; Ashenafi Tazebew Amare; Yalewayker Tegegne; Mulugeta Aemero
Journal:  Malar J       Date:  2022-01-29       Impact factor: 2.979

9.  Detection of high prevalence of Plasmodium falciparum histidine-rich protein 2/3 gene deletions in Assosa zone, Ethiopia: implication for malaria diagnosis.

Authors:  Gezahegn Solomon Alemayehu; Kayla Blackburn; Karen Lopez; Cheikh Cambel Dieng; Eugenia Lo; Daniel Janies; Lemu Golassa
Journal:  Malar J       Date:  2021-02-23       Impact factor: 2.979

10.  Plasmodium falciparum is evolving to escape malaria rapid diagnostic tests in Ethiopia.

Authors:  Sindew M Feleke; Emily N Reichert; Hussein Mohammed; Bokretsion G Brhane; Kalkidan Mekete; Hassen Mamo; Beyene Petros; Hiwot Solomon; Ebba Abate; Chris Hennelly; Madeline Denton; Corinna Keeler; Nicholas J Hathaway; Jonathan J Juliano; Jeffrey A Bailey; Eric Rogier; Jane Cunningham; Ozkan Aydemir; Jonathan B Parr
Journal:  Nat Microbiol       Date:  2021-09-27       Impact factor: 17.745

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.