Clinical characteristics of re-positive COVID-19 patients in Huangshi, China: A retrospective cohort study.

A cluster of patients with coronavirus disease 2019 (COVID-19) underwent repeated positive severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA tests after they were discharged from the hospital. We referred to them as re-positive (RP) patients in this study. We aimed to describe the clinical characteristics of these patients in a retrospective cohort study. After being treated for COVID-19, the patients underwent 14 days of quarantine following their discharge from the Huangshi Hospital of Traditional Chinese Medicine and the Huangshi Hospital of Youse. Two additional sequential SARS-CoV-2 RNA tests were performed at the end of quarantine. The median age of the 368 patients was 51 years, and 184 (50%) patients were female. A total of 23 RP patients were observed at follow-up. Using multivariate Cox regression analysis, risk factors associated with RP included a higher ratio of lymphocyte/white blood cell on admission (adjusted HR 7.038; 95% CI, 1.911-25.932; P = 0.0034), lower peak temperature during hospitalization (adjusted HR, 0.203; 95% CI, 0.093-0.443; P<0.0001), and the presence of comorbidities, particularly hypertension or chronic diseases in the respiratory system (adjusted HR, 3.883; 95% CI, 1.468-10.273; P = 0.0063). Antivirus treatment with arbidol was associated with a lower likelihood of re-positive outcomes (adjusted HR, 0.178; 95% CI, 0.045-0.709; P = 0.0144).

Introduction

Coronavirus disease 2019 (COVID-19) was first reported in December 2019 in Wuhan, China, and was declared a pandemic by the World Health Organization (WHO) on March 11, 2020. According to national reports received by the WHO, 972,303 cases of COVID-19 had been diagnosed worldwide by April 3rd, and it affected more than 180 countries and caused 50,322 deaths [1]. The mortality of COVID-19 differed in studies (2.3%-4.3%) [2, 3], and it is less than that seen with the severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) [4]. However, the socioeconomic burden of SARS coronavirus 2 (SARS-CoV-2) far outweighs that of SARS and MERS. The basic reproduction number (R0) of SARS-CoV-2 was estimated to be between 2 and 3, suggesting that it is highly contagious [5]. Transmission from a carrier has been reported, and it is very important to screen and quarantine both infected patients and potential carriers [6].

Both SARS-CoV-2 and SARS-CoV belong to the Sarbecovirus subgenus, and their S glycoproteins have more than 80% amino acid sequence identity [7]. SARS-CoV-2 is a type of coronavirus derived from animals. It has been reported that SARS-CoV-2 has 86.9% genetic homology with bat SARS-like coronavirus. Beta-coronaviruses, including SARS-CoV-2 and MERS-coronavirus, can infect humans and result in severe pneumonia [8]. When we were treating patients with COVID-19 in Huangshi, we found that some patients had re-tested positive via nucleic acid detection after being discharged from the hospital. This is consistent with the results reported by Lan [9]. This phenomenon aroused our interest, and we called these patients “re-positive (RP) patients”. It has also been reported that other viral infections cause recurrent positive nucleic acid tests after treatment including human papillomavirus (HPV) and hepatitis C virus (HCV) [10, 11]. This could make the disease chronic or cause large-scale transmission to a susceptible population.

We diagnosed and treated patients with COVID-19 according to the Chinese management guidelines for COVID-19 (version 2.0–6.0) as the guidelines updated [12]. Patients with an absence of fever for at least 3 days, improvement in chest CT, clinical remission of respiratory symptoms, and two sequential oropharyngeal swab samples tested negative for SARS-CoV-2 RNA obtained at least 24 hours apart met the criteria for discharge. Every discharged patient needed to remain quarantined at the designated place for 14 days. All patients would receive oropharyngeal swab again at the end of the quarantine period.

In this study, a total of 368 patients of the Huangshi Hospital of Traditional Chinese Medicine (TCM) and Huangshi Hospital of Youse, 84.4% of 436 COVID-19 discharged patients in the Huangshi city zone before March 1st, were followed up to demonstrate the characteristics of RP patients.

Methods

Study design and participants

This was a retrospective cohort study of 368 patients aged 16 to 89 years with confirmed COVID-19 hospitalized at Huangshi Hospital of Traditional Chinese Medicine and Huangshi Hospital of Youse. All patients were diagnosed with COVID-19 according to the Chinese management guidelines for COVID-19 (version2.0–6.0). We followed up all discharge patients in these two hospitals between January 23th (the first admitted patient) and March 1st. The study was approved by the Research Ethics Commission of Huangshi Hospital of Traditional Chinese Medicine and Huangshi Hospital of Youse. The requirement for informed consent from study participants was waived by the Ethics Commission.

Data collection

We extracted epidemiological, demographic, clinical, laboratory, and treatment data from electronic medical records using a standardized data collection form (S1 File). All data were independently checked by 3 physicians (HW, MZ, and ZL). A researcher (JZ) evaluated any differences in interpretation between the 3 primary reviewers.

Laboratory procedures

1. RT-PCR of SARS-CoV-2

The oropharyngeal-swabs of patients were collected by well-trained medical staff. The samples were subsequently tested using quantitative reverse-transcription PCR to detect SARS-CoV-2 RNA. The open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) were the two target genes. Total nucleic acid was extracted within 2 h using the respiratory sample RNA isolation kit (Shanghai BioGerm Medical Biotechnology Co Ltd) according to the manufacturer’s instructions. The reaction mixture contained 5 μL of RNA template, 12 μL of reaction buffer, and 4 μL of reverse transcriptase mixture. Four microliters of probe primer solution were prepared for target gene amplification and tested using a 2019-nCoV nucleic acid detection kit according to the manufacturer’s protocol (Shanghai BioGerm Medical Biotechnology Co Ltd). The positive and negative control groups were set. PCR conditions consisted of reverse transcription at 50°C for 10 min, pre-denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing, extension, and collecting fluorescence signal at 55°C for 40 seconds. The RT-PCR cycle threshold values were collected. The Ct value correlates with the number of copies of the virus in an inversely proportional. A Ct value of less than 38 was defined as a positive test result. These diagnostic criteria were based on the recommendations of the National Institute for Viral Disease Control and Prevention (China). The sequences for the ORF1ab real-time RT-PCR were as follows: forward primer: CCCTGTGGGTTTTACACTTAA; reverse primer: ACGATTGTGCATCAGCTGA; probe: 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'. The sequences for the N gene were as follows: forward primer: GGGGAACTTCTCCTGCTAGAAT; reverse primer: CAGACATTTTGCTCTCAAGCTG; probe:5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3.

2. CT Scan

Every included patient received at least 2 chest CT scans: the first one at admission and the second one before discharge. Each RP patient underwent a further chest CT scan to evaluate any radiological abnormalities at re-admission. More CT scans were performed for some subjects if the physician thought it was necessary. Chest imaging results were reviewed separately by two radiologists (HX, a senior thoracic radiologist with 10 years’ experience, and WZ, a senior thoracic radiologist with 10 years’ experience) to assess image progression or absorption. Two evaluators independently assessed the chest CT features of the patient without access to clinical or laboratory findings. After separate evaluations, any disagreements were resolved by discussion and consensus.

3. Routine blood tests

Routine blood examinations included complete blood count, coagulation profile, serum biochemical tests, myocardial enzymes, and inflammation biomarkers. The results included white blood cell count(WBC), lymphocyte count(LY), neutrophil count(NE), platelet count(PLT), aspartate transaminase (AST), alanine transaminase (ALT), lactate dehydrogenase (LDH), C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), B-type brain natriuretic peptide (BNP), and activated partial thromboplastin time (APTT).

Definitions

Patients were considered to have a fever if their axillary temperature was raised to at least 37.3°C. Exposure history was based on records of exposure to people with confirmed SARS-CoV-2 infection or had visited Wuhan. The severity of COVID-19 infection was defined according to the Chinese management guidelines for COVID-19 (version 6.0). Chronic respiratory diseases in our study included previously diagnosed chronic obstructive pulmonary disease, asthma, and bronchiectasis. Chronic diseases in our study included hypertension, coronary heart disease, cancer, chronic renal disease, liver disease, hyperthyroidism, hypothyroidism, anemia, hyperlipidemia, arthrolithiasis and chronic respiratory diseases.

Clinical management

Supplemental oxygen would be given to those with oxygen saturation dropped below 93% or patients felt obvious chest tightness. Patients clinically suspected of having community-acquired pneumonia were administered empirical broad-spectrum antibiotics and/or oral oseltamivir. Different anti-SARS-CoV-2 therapies, such as arbidol, lopinavir/ritonavir, ribavirin, ganciclovir, chloroquine, and α-interferon (IFN) nebulization were prescribed to selected patients at the physicians’ discretion. As the role of glucocorticoids in COVID-19 treatment is controversial, their use was restricted to most patients given prednisone at a dose of 1 mg per kilogram of body weight for 1 week or less.

Statistical analysis

Descriptive analyses of the variables were represented by median (IQR, 1st and 3rd), or counts and percentages (%). The rate with 95% confidence intervals (CIs) of the recurrence of positive test after the first discharge for COVID-19 patients was based on the binomial distribution. Differences in the distributions of laboratory indices between admission and discharge of the same patients were reported using differences with 95% CIs and the P values of the Wilcoxon signed-rank test. Univariate and multivariable Cox proportional hazard ratio (HR) models were used to assess HRs and 95% CIs as well as the P values with Wald tests, between individual factors on the recurrence of positive SARS-Cov-2 RNA test in patients with COVID-19. Proportional assumptions for the Cox proportional hazard model were examined using scaled Schoenfeld residuals. A stepwise selection method was used to select independent risk factors that affect outcomes.

The sample size varied because of missing data. The analyses regarding different factors were based on non-missing data, and missing data were not imputed. All tests were two-sided, and a P value less than 0.05 was considered statistically significant. All statistical analyses were performed using R software, version 3.5.1 (R Foundation for Statistical Computing).

Results

Demographic and clinical characteristics of all included patients

Before the end of the follow-up period on March 15th, we screened all 413 patients discharged before March 1st in Huangshi Hospital of Traditional Chinese Medicine and Huangshi Hospital of Youse. Of the 413 patients, 22 died during hospitalization, 17 were transferred between two hospitals and 6 were transferred to other hospitals. These 22 dead patients and 6 transferred patients were excluded from the study. The second admission of 17 patients transferred between the two hospitals was also excluded in the analysis. Cough and chest tightness worsened in two discharged patients during the quarantine. They were re-tested for SARS-CoV-2 immediately and showed positive results. At the end of the quarantine, the remaining 366 discharged patients showed no obvious symptoms. 21 of them had positive SARS-CoV-2 RNA tests at the end of quarantine. A total of 23 RP patients were included in this study as a re-positive group and the remaining 345 patients were included as a non-RP control group (flow chart can be seen in S1 Fig).

The demographic and clinical characteristics of all included patients are shown in Table 1. The median age in our cohort was 51 years, and the number of men and women was equal (184 vs. 184). Most of these patients (96.17%) were mild to moderate cases and 14 (3.83%) were severe and critical cases. About 91 (24.73%) of them had visited Wuhan, and 107 (29.16%) had contacted Wuhan residents. Of the patients, 12.50% declared contact with confirmed COVID-19 patients. The median incubation period in our study was 5 days. Common symptoms were fever (82.07%), cough (80.71%), chest tightness (45.11%), and 46.59% had fever on admission. During hospitalization, 74.66% of patients developed fever, and most of them were not above 39.0°C. About 39.40% of the patients had comorbidities. Except for chronic respiratory diseases (n = 78, 21.20%), the most common comorbidities were hypertension (n = 68, 18.48%), diabetes (n = 32, 8.70%), and coronary heart disease (n = 15, 4.08%). The number of patients with one chronic disease was 84 (22.83%) and the number of patients with two or more chronic diseases was 32 (8.70%). Most patients received anti-viral therapy (arbidol, lopinavir/ritonavir, ribavirin, and ganciclovir).

Table 1

The demographic and clinical characteristics of all included patients.

	Total
No. of patients	368
Age, years	51.00(22.00, 40.00–62.00)
<65	296(80.43)
≥65	72(19.57)
Sex
Female	184(50.00)
Male	184(50.00)
Exposure to source of transmission within past 14 days
Recently visited Wuhan
No	277(75.27)
Yes	91(24.73)
Had contact with Wuhan residents
No	260(70.84)
Yes	107(29.16)
Had contact with the confirmed COVID-19 patients
No	322(87.50)
Yes	46(12.50)
Family gathering history
No	347(94.29)
Yes	21(5.71)
Incubation period, days	5.00(5.00, 3.00–8.00)
Length of hospitalization, days	17.00(7.00, 14.00–21.00)
Initial signs and symptoms
Fever	302(82.07)
Cough	297(80.71)
Sputum production	121(32.88)
Chest tightness	166(45.11)
Diarrhea	40(10.87)
Headache	62(16.85)
Nasal congestion	14(3.80)
Chills	30(8.15)
Sore throat	48(13.04)
Myalgia or arthralgia	28(7.61)
Fever on admission	171(46.59)
median (IQR), °C	37.10(1.00, 36.70–37.70)
<37.3°C	196(53.41)
37.3–38.0°C	124(33.79)
38.1–39.0°C	42(11.44)
>39.0°C	5(1.36)
Fever during hospitalization
Yes	274(74.66)
Peak temperature, median (IQR), °C	37.90(1.30, 37.20–38.50)
<37.3	93(25.34)
37.3–38.0	119(32.43)
38.1–39.0	117(31.88)
>39.0	38(10.35)
Severity
Mild-Moderate	352(96.17)
Severe	11(3.01)
Critical	3(0.82)
Comorbidities
Any	145(39.40)
Hypertension	68(18.48)
Diabetes	32(8.70)
Coronary heart disease	15(4.08)
Cancer	9(2.45)
Chronic renal disease	8(2.17)
Liver disease	14(3.80)
Chronic Respiratory diseases	78(21.20)
Other diseases	68(18.48)
Patients with one chronic disease	84(22.83)
Patients with two or more chronic diseases	32(8.70)
Treatment
Anti-virus, Arbidol	329(89.40)
Anti-virus, Lopinavir/Ritonavir	51(13.86)
Anti-virus, Ribavirin	86(23.37)
Anti-virus, Ganciclovir	34(9.24)
Anti-virus, Arbidol + Lopinavir / Ritonavir	48(13.04)
α-interferon nebulization	215(58.42)
Inhaled corticosteroid	36(9.78)
Systemic corticosteroid	56(15.22)

Data are described as number(%) or median (IQR, 1st and 3rd).

Laboratory indices in COVID-19 patients from admission to discharge

Laboratory markers were tracked from admission to discharge (Table 2). Physicians increased or decreased the laboratory tests undertaken according to each patient’s condition, which resulted in fewer results for some patients. The number of subjects providing samples for each test is also listed in Table 2. When these patients were discharged from the hospital, their white blood cell count, lymphocyte count, and neutrophil and platelet counts were significantly elevated compared to the results upon admission. Biochemical indices, including AST and LDH, were significantly decreased at discharge. In addition, infection-related biomarkers such as CRP and ESR were also significantly decreased. There were no statistical differences in troponin I, B-type brain natriuretic peptide (BNP), and D-dimer levels between admission and discharge. APTT levels were significantly higher on admission and improved on discharge.

Table 2

Changes of laboratory indices of patients during hospitalization.

	On Admission		On Discharge		Median of the Difference (95% CI)	P
	No. of patients tested	Value, median (IQR, 1st and 3rd)	No. of patients tested	Value, median (IQR, 1st and 3rd)
WBC, ×109 per L	368	4.48 (1.91, 3.55–5.46)	345	5.40 (1.88, 4.45–6.33)	-0.86 (-1.11,-0.72)	<0.0001
LY,×109per L	368	1.17 (0.59, 0.89–1.48)	345	1.55 (0.69, 1.18–1.87)	-0.31 (-0.36,-0.26)	<0.0001
NE, ×109per L	368	2.66 (1.66, 1.92–3.58)	345	3.23 (1.53, 2.38–3.91)	-0.47 (-0.67,-0.31)	<0.0001
PLT, ×109per L	368	159.50 (70.00, 132.00–202.00)	345	235.00 (100.00, 192.00–292.00)	-72.00 (-78.13,-59.57)	<0.0001
AST, U/L	358	29.00 (15.00, 23.00–38.00)	308	24.00 (15.00, 19.00–34.00)	4.00 (2.46,9.27)	<0.0001
ALT, U/L	356	22.00 (19.00, 16.00–35.00)	307	31.00 (39.00, 19.00–58.00)	-6.00 (-15.52,-6.32)	<0.0001
Troponin I, ng/ml	134	0.01 (0.01, 0.01–0.02)	105	0.01 (0.01, 0.01–0.02)	0.00 (-0.00,0.01)	0.0993
BNP, pg/ml	71	20.40 (49.00, 10.00–59.00)	61	22.00 (35.44, 10.00–45.44)	0.00 (-3.99,70.60)	0.0667
CRP, mg/L	343	12.31 (20.17, 6.18–26.35)	291	1.64 (3.93 0.75–4.68)	8.91 (12.83,19.25)	<0.0001
ESR, mm/h	207	44.00 (40.00, 26.00–66.00)	111	36.00 (52.00, 20.00–72.00)	9.50 (2.84,14.08)	0.0029
D-Dimer, μg/mL	233	0.19 (0.25, 0.05–0.30)	176	0.20 (0.39, 0.11–0.50)	0.00 (-1.36,3.93)	0.2587
APTT, s	327	37.00 (8.30, 33.50–41.80)	205	33.40 (5.50, 31.10–36.60)	3.65 (3.00,4.78)	<0.0001

P values were calculated using the Wilcoxon signed-rank test.

Univariate analysis in patients with and without RP

The results of univariate analysis of the clinical characteristics between RP and non-RP patients are shown in Table 3. Decreased probability of fever during hospitalization(HR 0.22, 95% CI 0.09–0.51; P = 0.0005), lower temperature on admission (HR 0.51, 95% CI 0.28–0.93; P = 0.0291), and lower peak temperature (HR 0.24, 95% CI 0.11–0.49; P = 0.0001) were significantly associated with test-retest positivity. RP patients also showed a longer hospitalization time (HR 0.69, 95% CI 0.60–0.79; P <0.001).

Table 3

Univariate analysis of clinical characteristics among patients with and without RP.

	Non-RP group	RP group	HR (95% CI)	P value
	no. (%)(n = 345)	no. (%)(n = 23)
Age, median (IQR), years	50.00(23.00, 39.00–62.00)	51.00(16.00, 42.00–58.00)	1.00(0.97,1.03)	0.7759
<65	275(79.71)	21(91.30)	ref.
≥65	70(20.29)	2(8.70)	0.40(0.09,1.69)	0.2103
Sex
Female	168(48.70)	16(69.57)	ref.
Male	177(51.30)	7(30.43)	0.53(0.22,1.30)	0.1669
Exposure to source of transmission within past 14 days
Recently visited Wuhan
No	260(75.36)	17(73.91)	ref.
Yes	85(24.64)	6(26.09)	0.75(0.29,1.92)	0.5503
Had contact with Wuhan residents
No	244(70.72)	16(72.73)	ref.
Yes	101(29.28)	6(27.27)	0.67(0.26,1.71)	0.3993
Had contact with the confirmed COVID19 patients
No	304(88.12)	18(78.26)	ref.
Yes	41(11.88)	5(21.74)	2.03(0.74,5.53)	0.1682
Family gathering history
No	326(94.49)	21(91.30)	ref.
Yes	19(5.51)	2(8.70)	1.60(0.37,6.92)	0.5262
Incubation period, median (IQR), days	5.00(5.00, 3.00–8.00)	6.00(13.00, 0.50–13.50)	1.14(0.98,1.33)	0.0933
Length of Hospitalization, median (IQR), days	17.00(7.00, 14.00–21.00)	19.00(7.00, 15.00–22.00)	0.69(0.60,0.79)	<0.0001
Initial signs and symptoms
Fever	282(81.74)	20(86.96)	1.25(0.37,4.22)	0.7248
Cough	275(79.71)	22(95.65)	4.23(0.57,31.42)	0.1592
Sputum production	114(33.04)	7(30.43)	0.76(0.31,1.85)	0.5486
Chest tightness	153(44.35)	13(56.52)	1.35(0.59,3.12)	0.4797
Diarrhea	37(10.72)	3(13.04)	0.70(0.21,2.38)	0.5682
Fatigue	237(68.70)	14(60.87)	0.58(0.25,1.35)	0.2079
Headache	57(16.52)	5(21.74)	1.15(0.43,3.10)	0.7807
Nasal congestion	14(4.06)	0.00(0.00)	. . .	. . .
Chills	27(7.83)	3(13.04)	1.44(0.42,4.85)	0.5613
Sore throat	45(13.04)	3(13.04)	0.73(0.22,2.48)	0.6179
Myalgia or arthralgia	27(7.83)	1(4.35)	0.50(0.07,3.74)	0.5023
Fever on admission
Yes	162(47.09)	9(39.13)	0.52(0.22,1.22)	0.1339
median (IQR), °C	37.15(1.00, 36.70–37.70)	36.90(1.00, 36.50–37.50)	0.51(0.28,0.93)	0.0291
<37·3°C	182(52.91)	14(60.87)	ref.
37·3–38·0°C	115(33.43)	9(39.13)	0.78(0.33,1.82)	0.5646
38·1–39·0°C	42(12.21)	0.00(0.00)	. . .	. . .
>39·0°C	5(1.45)	0.00(0.00)	. . .	. . .
Fever during hospitalization
Yes	261(75.87)	13(56.52)	0.22(0.09,0.51)	0.0005
Peak temperature, median (IQR), °C	38.00(1.30, 37.30–38.60)	37.40(1.10, 36.90–38.00)	0.24(0.11,0.49)	0.0001
<37·3	83(24.13)	10(43.48)	ref.
37·3–38·0	110(31.98)	9(39.13)	0.40(0.16,1.00)	0.049
38·1–39·0	113(32.85)	4(17.39)	0.14(0.04,0.47)	0.0013
>39·0	38(11.05)	0.00(0.00)	. . .	. . .
Severity
Mild-Moderate	330(96.21)	22(95.65)	ref.
Sever	11(3.21)	0.00(0.00)	. . .	. . .
Critical	2(0.58)	1(4.35)	3.04(0.40,23.16)	0.2834
Comorbidities
Any	134(38.84)	11(47.83)	1.41(0.62,3.19)	0.4124
Hypertension	63(18.26)	5(21.74)	1.31(0.48,3.53)	0.5961
Diabetes	30(8.70)	2(8.70)	1.07(0.25,4.55)	0.9319
Coronary heart disease	14(4.06)	1(4.35)	0.93(0.12,6.92)	0.9425
Cerebrovascular disease	4(1.16)	1(4.35)	2.97(0.40,22.21)	0.2882
Cancer	9(2·61)	0(0·00)	. . .	. . .
Chronic renal disease	7(2.03)	1(4.35)	. . .	. . .
Liver disease	12(3.48)	2(8.70)	2.85(0.38,21.31)	0.3068
Chronic Respiratory diseases	74(21.45)	4(17.39)	1.81(0.42,7.77)	0.4247
Other diseases	63(18.26)	5(21.74)	0.68(0.23,2.00)	0.4839
Treatment in hospital
Arbidol	309(89.57)	20(86.96)	0.36(0.10,1.27)	0.1129
Lopinavir /Ritonavir	47(13.62)	4(17.39)	0.76(0.26,2.26)	0.6219
Ribavirin	77(22.32)	9(39.13)	1.72(0.74,3.99)	0.2056
Ganciclovir	29(8.41)	5(21.74)	1.96(0.72,5.36)	0.1903
Arbidol + Lopinavir/Ritonavir	45(13.04)	3(13.04)	0.55(0.16,1.88)	0.3420
α-interferon nebulization	203(58.84)	12(52.17)	0.56(0.24,1.29)	0.1721
Inhaled corticosteroid	35(10.14)	1(4.35)	0.62(0.21,1.84)	0.3852
Systemic corticosteroid	52(15.07)	4(17.39)	1.26(0.17,9.37)	0.8213

Data are described as number(%) or median (IQR, 1st and 3rd). P values were calculated using the Wilcoxon signed-rank test.

Laboratory tests of RP and non-RP patients at admission were also compared (Table 4). The data showed a significant association of lymphocyte count (HR 2.13, 95% CI 1.05–4.30; P = 0.0353), lower levels of AST (HR0.94, 95% CI 0.90–0.99; P = 0.0286), LDH (HR 0.99, 95% CI 0.98–1.00; P = 0.0105), CRP (HR 0.96, 95% CI 0.93–1.00; P = 0.0390), ESR (HR 0.97, 95% CI 0.95–1.00; P = 0.0317) and APTT on admission (HR 0.92, 95% CI 0.86–0.97; P = 0.0042) in RP subjects. The level of D-Dimer was higher in RP group (HR 1.02, 95% CI 1.01–1.04; P = 0.0003). No significant difference was observed between the RP and non-RP groups at discharge (S1 Table).

Table 4

Univariate analysis of laboratory indices on admission of RP and non-RP group.

	Non-RP group(n = 345)	RP group(n = 23)	HR (95% CI)	P
WBC, ×109 per L	4.44(1.93, 3.51–5.44)	5.25(1.68 4.42–6.10)	1.18(0.93,1.50)	0.1666
LY, ×109per L	1.16(0.58, 0.88–1.46)	1.37(0.55, 1.20–1.75)	2.13(1.05,4.30)	0.0353
Lymphocyte / White blood cell	0.27(0.14, 0.20–0.34)	0.27(0.09, 0.24–0.33)	4.87(0.09,274.96)	0.4415
NE, ×109per L	2.65(1.67, 1.90–3.57)	3.03(1.81, 2.41–4.22)	1.10(0.83,1.44)	0.5067
PLT, ×109per L	159.00(69.00, 132.00–201.00)	173.00 (74.00, 140.00–214.00)	1.00(1.00,1.01)	0.1753
AST, U/L	29.00(15.00, 23.00–38.00)	23.00(10.00, 20.00–30.00)	0.94(0.90,0.99)	0.0286
ALT, U/L	23.00(20.00, 16.00–36.00)	14.50(10.00, 13.00–23.00)	0.96(0.93,1.00)	0.0769
LDH, U/L	235.00(98.50, 193.50–292.00)	190.00 (46.00, 182.00–228.00)	0.99(0.98,1.00)	0.0105
Troponin I, ng/ml	0.01(0.01, 0.01–0.02)	0.01(0.02, 0.01–0.03)	. . .	. . .
BNP, pg/ml	20.40(55.00, 10.00–65.00)	24.65(31.81, 1.09–32.90)	0.99(0.96,1.01)	0.3597
CRP, mg/L	12.43(20.68, 6.43–27.11)	8.56(15.60, 5.22–20.82)	0.96(0.93,1.00)	0.0390
ESR, mm/h	44.00(39.00, 27.00–66.00)	32.50(32.00, 13.00–55.00)	0.97(0.95,1.00)	0.0317
D-Dimer, μg/mL	0.19(0.25, 0.05–0.30)	0.20(0.25, 0.10–0.35)	1.02(1.01,1.04)	0.0003
APTT, s	37.20(8.20, 33.70–41.90)	35.50(6.20 31.40–37.60)	0.92(0.87,0.97)	0.0042

Data are median (IQR, 1st and 3rd). P values were calculated using Wald tests.

Multivariate analysis of patients with and without RP

Multivariate Cox regression models showed that several risk factors related to increased likelihood of RP included higher lymphocyte/white blood cells on admission (adjusted HR 7.038, 95% CI, 1.910–25.932; P = 0.0034), lower peak temperature during hospitalization (adjusted HR 0.203, 95% CI 0.093–0.443; P <0.0001), and the presence of comorbidities, particularly hypertension or chronic diseases in the respiratory system (adjusted HR 3.883, 95% CI 1.468–10.273; P = 0.0063). This analysis showed that arbidol reduced the probability of re-positive outcomes (adjusted HR 0.178, 95% CI 0.045–0.709; P = 0.0144). The results of multivariate analysis are listed in Table 5.

Table 5

Multivariate analysis of patients with and without RP.

	HR (95% CI)	P value
Age, median (IQR), year(≥65 vs <65)	0.395(0.083,1.875)	0.2423
Sex(Male vs Female)	0.721(0.278,1.868)	0.5004
Comorbidities with Hypertension or Chronic respiratory disease (Yes vs no)	3.883(1.468,10.273)	0.0063
Peak temperature during hospitalization(°C)	0.203(0.093,0.443)	<0.0001
Lymphocyte/White blood cell on admission	7.038(1·910,25.932)	0.0034
Anti-virus, Arbidol (Yes vs no)	0.178(0.045,0.709)	0.0144

The Cox proportional hazard model was used to screen the important variables by stepwise regression based on re-positivity.

Clinical characteristics of RP patient re-admission

Considering the potential infectious risks of RP patients, all 23 RP patients were re-admitted to the hospital for observation and treatment. Their clinical characteristics are shown in Table 6. None of the RP patients who were hospitalized for the second time had fever. Three patients (13.04%) complained of cough and chest tightness. Another patient (4.55%) reported a slight sore throat on the second admission.

Table 6

Clinical characteristics of RP patients in re-admission.

	No. (%)
No. of patients	23
Age, median (IQR), year	51.00(16.00, 42.00–58.00)
<65	21(91.30)
≥65	2(8.70)
Sex
Female	16(69.57)
Male	7(30.43)
Initial signs and symptoms
Fever	0(0)
Cough	3(13.04)
Sputum production	0(0)
Chest tightness	3(13.04)
Diarrhea	0(0)
Headache	0(0)
Nasal congestion	0(0)
Chills	0(0)
Sore throat	1(4.55)
Myalgia or arthralgia	0(0)
Evaluation of chest CT on re-admission
No change	3(13.04)
Partially absorbed	13(56.52)
Completely absorbed	7(30.43)

Data are median (IQR, 1st and 3rd) or n (%).

Two radiologists independently assessed the chest CT scans of the re-positive patients. The images taken at re-admission were compared to those taken at the first discharge. No patient showed aggravated lung images: no obvious changes were seen in the lungs of 3 (13.04%) patients, 13 (56.52%) were partially absorbed, and 7 (30.43%) were almost completely absorbed.

RP patients showed no obvious abnormality in the laboratory measures, including routine blood tests, biochemical and inflammatory markers, and indicators of coagulation function (S2 Table). Fifteen RP patients tested for antibodies to SARS-CoV-2, all of them showed positive antibody responses (S3 Table).

Discussion

This retrospective cohort study identified the clinical features of RP COVID-19 patients in Huangshi, China. These patients had a lower peak temperature and presented with higher lymphocyte counts but lower levels of AST, LDH, CRP, and APTT, and more comorbidities of hypertension or chronic diseases in the respiratory system compared with patients without RP. There was no difference in demographics, epidemiological features, and treatment between the RP and non-RP groups by univariate analysis.

Since the RP patients were well quarantined in our study before re-admission and all RP patients who received antibody tests showed positive results, we considered that the incidence of re-infection with SARS-CoV-2 was low [13]. Therefore, we suspect that there are other reasons for the recurrent positive RNA tests. To the best of our knowledge, an accurate explanation for RP is lacking. In Singapore, the duration of SARS-CoV-2 viral shedding from nasopharyngeal aspirates was prolonged up to 24 days (median duration 12 days; range 1–24 days) after symptom onset and towards the end of this period, the virus was only intermittently detected [14]. Zhou and colleagues reported that detectable SARS-CoV-2 RNA persisted for a median of 20 days in survivors and that it was sustained until death [15]. There are several possible mechanisms such as intermittent viral shedding, false negatives during the initial discharge, residual viral presence, and viral distribution to explain the existence of RP patients [14, 16, 17]. We suggest that our RP patients may have a longer SARS-CoV-2 viral shedding time and/or intermittent viral shedding. However, we also noticed that one study from Hong Kong, researchers could not amplify active viruses from samples of re-positive patients [18]. Thus, it is also possible that the presence of re-positive patients was caused by broken virus fragments or dead viruses that were not completely cleared in the body.

At the same time, some researchers believe that the low efficiency of nasopharyngeal swab detection might result in the appearance of test-retest positivity [19]. According to the current study, the viral load of SARS-CoV-2 gradually decreases in the rehabilitation stage [20]. In our opinion, the occurrence of some RP patients is indeed partly related to this factor. Two of the RP patients in our study who were positive for SARS-CoV-2 RNA in the middle of 14 day-quarantine were more likely due to false-negative results before discharge. However, we believe that not all RP patients can be explained in this way. Kang et al. reported that 3.3% of the 8922 patients were re-positive in Korea, and these patients represented only minor symptoms [21]. According to the results of our and other published studies on RP, patients with RP have unique clinical characteristics.

RP patients showed lower peak temperatures and lower levels of CRP, ESR, and APTT. These findings suggest that RP patients might be in a weak state of the immune response. It is widely known that high fever and increased CRP levels are signs of an activated immune status. Interestingly, Wu and colleagues found that high fever was positively associated with the development of acute respiratory distress syndrome (ARDS) but negatively related to death [22]. An effective innate immune response is important in fighting viral infections, which relies heavily on interferon (IFN) type I responses. For SARS-CoV and MERS-CoV, the type I IFN response to viral infection is suppressed [23]. The RP patients in our study had lower peak temperatures, lower CRP levels, and reduced presence of fever, which indicates that they might have a reduced anti-viral immune response. Severe cases of COVID-19 tend to have lower lymphocyte counts and higher plasma levels of LDH and TNF-α [24, 25]. Biopsies of COVID-19 infected lung also showed a heightened inflammatory response in patients who died [26]. Furthermore, a cytokine storm has been reported in patients with SARS who die with significantly elevated levels of IL-18, IP-10, MIG, and MCP-1 [27]. It is postulated, therefore, that an overactive immune response drives disease progression.

In contrast, in children, who possess an immature immune system, the infection rate of SARS-CoV-2 is lower and the symptoms are milder compared to adults [28]. The recurrent positive group in our study with lower maximum temperature, lower incidence of fever, and lower LDH levels, indicating that these RP patients have a weaker response to SARS-CoV-2 akin to that seen in children.

In our study, multivariant analysis in our study showed that arbidol might reduce the recurrent SAR-CoV-2 positive rate. Indeed, arbidol has a direct antiviral effect during the early viral replication of SARS-CoV in vitro [29]. In addition, one retrospective cohort study has shown that combined arbidol and Lopinavir/ritonavir treatment shortens the duration of viral shedding compared to lopinavir/ritonavir alone [30].

We analyzed RP patients upon re-admission and found no obvious abnormality in their blood tests. There were no physical complaints, and chest CT showed no signs of deterioration compared with the previous scans. These data indicated that although the nucleic acid test was again positive, RP patients were clinically similar to those in continuous recovery.

Our study has some limitations. First, at the outset of the outbreak of COVID-19 in Hubei province, medical resources were lacking, and we could not repeat the RNA test every day to determine the dynamic changes in viral titer. We could not perform the antibody test in every patient. Second, measurement of serum levels of cytokines such as IL-2, IFN-,α and TNF-α that might help us understand the immune response in patients were not examined. Further studies are required to detail the infectivity and immune status of these patients.

In conclusion, the exact causes of recurrent positive test results for SARS-CoV-2 are still unknown. Due to its highly contagious nature, it is better for us to be cautious when discharging patients with the potential to shed the virus. To our knowledge, this is the first cohort study to describe the characteristics of RP patients with COVID-19. To prevent potential further transmission by these RP patients, it is reasonable to quarantine patients for at least 14 days after discharge and to re-test them again before contact with other people is allowed. Further research on RP patients will help us better understand the process of infection, clearance, and metabolism of SARS-CoV-2 in patients. It also helps us to better deal with the spread of COVID-19.

Univariate analysis of laboratory indices of patients with and without RP at discharge.

(DOC)

Click here for additional data file.

Laboratory indices of RP patients at re-admission.

(DOC)

Click here for additional data file.

Antibody results of 15 RP-patients.

(DOC)

Click here for additional data file.

Flow chart of the overview of this study.

(TIF)

Click here for additional data file.

(DOC)

Click here for additional data file.

(DOCX)

Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

29 Jul 2020

PONE-D-20-18154

Clinical characteristics of Re-positive recovering patients with COVID-19 in Huangshi, China: a retrospective cohort study

PLOS ONE

Dear Dr. Yao,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 12 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Wenbin Tan

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. Thank you for stating in the text of your manuscript "the requirement for informed consent from study participants was waived by the Ethics Commission". Please also add this information to your ethics statement in the online submission form.

4. Please revise your tables to replace p-values of 0.0000 with p-values of <0.0001.

5.We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially identifying or sensitive patient information) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

6. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files

Additional Editor Comments:

This manuscript reported some cases of re-positive COVID-19 patients after discharge. I have some comments as follows.

(1) The authors need to discuss whether re-positive patients after recovery was due to second infection or they were still contiguous? An antibody result will help to address this question.

(2) The term of "re-positive recovering (RPR) patients" is awkward; do you mean re-positive patients after recovery or discharge?

(3) Formats of all numbers in abstract, contents and tables need to change, for example, changing "P=0·0015" into "P=0.0015"

(4) in many tables, it was stated that median (IQR) was used; however, i am doubtful for that. Did you mean S.D. since there was only one digit presented? For IQRs, 1st and 3rd IQR are generally used. Please change all the values into median (IQR, 1st and 3rd) in all of the tables.

(5) in the discussion, authors stated that "... they might have a reduced anti-viral immune response." I disagree on it. These patients most likely were due to residual viral loads, second likely re-infection.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors report a retrospective cohort study to investigate the re-positive recovering patients in COVID 19 patients. They reported RPR included a younger age, higher level of lymphocytes on admission, shorter fever duration and more comorbidities of hypertension and chronic diseases in respiratory system. They claim RPR patients had a weaker and shorter inflammatory response.

This is a well thought of and properly presented study on a relevant clinical question.

However, on closer inspection, I have a few concerns:

1. A research from South Korea reported 292 re-positive COVID 19 cases, they determined the re-positive is due to the limits of test method, and the remnants of the virus was picked up in the test. What do you think about it?

2. Another research in Wuhan claim that the positive rate of virus with pharyngeal swabs in COVID 19 patients is only 32% (126/398). Viral load changes as the disease progresses, false negative result at discharge may affect the ratio of RPR in COVID 19 patients.

Reviewer #2: Zhou et al presented a study on COVID-19 RPR patients by using various laboratory techniques and statistical analysis. The manuscript is well written, but few typos and grammar issues exist. I have the following comments:

1. The introduction is very brief, it would be nice if authors can add more about SARS-CoV-2 in it.

2. Why only 383 patients were chosen for the study?

3. Line 86- If the patients were tested positive during the discharge period, why they kept in quarantine instead of continuing with the same treatment? Please explain.

4. What were the parameters taken while data collection as authors mentioned a data collection form, it would be beneficial for readers if authors can provide the sample form in the supplementary.

5. Among the comorbidities, most of the focus is on hypertension and chronic diseases in respiratory system; while as it would have been interesting to see RPR in the immunocompromised such as HIV positive patients. Authors have completely ignored this factor, however it will be an interesting inclusion.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Aijaz Ahmad

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

14 Sep 2020

Dear editor:

Thanks a lot for having reviewed our manuscript.   Now we have revised the manuscript according to the reviewers’ comments. Most of the revisions are in the manuscript. Some explanations regarding the revisions of our manuscript are as follows. During the revison, we found that a few patients were transfered between two hospitals and excluded them in new manuscript. Thank you very much for your comments. Your questions have played a very important role in improving this research.

Our manuscript was re-edited by Editage (www.editage.com) on your recommendation.

Answers to Editor:

(1)The authors need to discuss whether re-positive patients after recovery was due to second infection or they were still contiguous? An antibody result will help to address this question.

Reply：Thank you very much for your suggestion. We reviewed data and looked up the relevant information about the antibody results. Because our patients were followed-up earlier (Before March 1), only 15 re-positive patients in all 23 re-positive patients were tested for antibodies. All these 15 patients showed positive antibody results (2 patients with IgM positive, 15 patients with IgG positive; detailed information can be found in S3 Table). There is one article named “Humoral Immune Response to SARS-CoV-2 in Iceland” published in the New England Journal recently. Their results indicate that antiviral antibodies against SARS-CoV-2 did not decline within 4 months after diagnosis [1]. In rhesus macaques，researchers found out a relationship between a humoral immune response to SARS-CoV-2 infection and protection against reinfection by this virus [2]. To our knowledge, there was no article reported re-infection of SARS-Cov-2 in such a short time in the presence of positive antibody. Therefore, we speculate that the re-positive patients in this study are less likely to be caused by the second infection. According to your advice, we have added the antibody results and the discussion of re-infection in the manuscript.

(2) The term of "re-positive recovering (RPR) patients" is awkward; do you mean re-positive patients after recovery or discharge?

Reply：In our original vision, we wanted to describe the clinical characteristics of asymptomatic re-positive patient , so we defined such a description. However, we had to admit that this description is really awkward. After repeated discussions in our group， we replaced the term “re-positive recovering (RPR) patients” with “re-positive (RP) patients ” in new manuscript and two symptomatic re-positive patients were also included in study .

(3) Formats of all numbers in abstract, contents and tables need to change, for example, changing "P=0·0015" into "P=0.0015"

Reply：We have made improvements in accordance with your requirements.

(4)in many tables, it was stated that median (IQR) was used; however, i am doubtful for that. Did you mean S.D. since there was only one digit presented? For IQRs, 1st and 3rd IQR are generally used. Please change all the values into median (IQR, 1st and 3rd) in all of the tables.

Reply：Thanks for your advice. We have changed our values in tables as you mentioned.

(5) in the discussion, authors stated that "... they might have a reduced anti-viral immune response." I disagree on it. These patients most likely were due to residual viral loads, second likely re-infection.

Reply：Thank you for your question. One study from Hong Kong, researchers could not amplify active viruses from samples of re-positive patients [3]. Thus, it is possible that the presence of re-positive patients was likely to be caused by broken virus fragments or dead viruses that are not completely cleared in the body. And talking about re-infection, we considered the possibility was relatively low. Firstly，15 of 23 re-positive patients underwent antibody test, and all of them showed positive results. There was no article reported re-infection of SARS-Cov-2 in such a short time in the presence of positive antibody. Secondly, all patients were very strictly quarantined after discharge from hospital within 14 days. They had no chance to exposure to the source of the infection. So, we considered that the possibility of re-infection was relatively low. However, we think your opinion is very reasonable, and we had re-writen the discussion part, which put the first reason of re-positive results as residual viral loads.

Answers to Review 1

1.A research from South Korea reported 292 re-positive COVID 19 cases, they determined the re-positive is due to the limits of test method, and the remnants of the virus was picked up in the test. What do you think about it?

Reply：Thank you very much for this question. Your two comments on this article are very important. We had been thinking about the two questions you raised.

We had read the article you mentioned. It is a brief report based on the data given by South Korea Centers for Disease Control and Prevention. Most of the information mentioned in the article is consistent with the results of our article, such as most of the re-positive patients showed mild symptoms and were concentrated in relatively young age groups.

In fact, we were also very interested in what causes the re-positive results in recovered patients. Regrettably, it was strictly limited in management of covid-19 patients’ specimens here. We could not conduct specific studies on that by ourselves and can only learn from other researchers’ article. According to the current results，we believed that the author’s description of dead virus or virus fragments in re-positive patients was a highly likely. However, to confirm what caused this phenomenon in re-positive patients requires further research. We will continue to monitor related article.

2.Another research in Wuhan claim that the positive rate of virus with pharyngeal swabs in COVID 19 patients is only 32% (126/398). Viral load changes as the disease progresses, false negative result at discharge may affect the ratio of RPR in COVID 19 patients.

Reply：The question you raised is very important.

In the progression of covid-19 patients’ infection, their viral load had experienced a rapid increase in the early stage of the disease to a slow decrease in the recovery period. Pharyngeal swabs were not the best choice from the perspective of detection accuracy. But pharyngeal swabs had the advantages of convenient collection, it was the main method for specimen collection in the early stage. In order to maximize the reliability of results, we required that the nucleic acid collectors in each ward be a fixed number of experienced medical staff in Huangshi's covid-19 management. At the same time, we required that each patient underwent two independent nucleic acid tests before being discharged from the hospital, with an interval of more than 24 hours. Through these two methods, we tried our best to improve the accuracy of the nucleic acid results in the research. And thanks to your advice, we re-discussed the issue in our manuscript to make readers be aware of the possibility of false negative result.

Answers to Review 2:

1.The introduction is very brief, it would be nice if authors can add more about SARS-CoV-2 in it.

Reply：Thank you for your suggestion. We had added introduction of SARS-CoV-2 in article in revised manuscript.

2.Why only 383 patients were chosen for the study?

Reply：The number of patients we included in the study was not actually set by us. After we determined the deadline for follow-up, we screened all patients from the two participating units before the deadline. All eligible patients have been included in the study. In terms of proportion, 84.4% of the patients discharged from hospital before March 1st in Huangshi City have been included in this study, which is a good representative.

3. Line 86- If the patients were tested positive during the discharge period, why they kept in quarantine instead of continuing with the same treatment? Please explain.

Reply：We are sorry that our description in the article is not clear enough. All discharged patients will be quarantined for 14 days. After the quarantine period, everyone would undergo nucleic acid testing. Negative patients could go home, and positive patients will be admitted to the hospital to continue treatment. In the revised manuscript, we described this process more meticulously.

4. What were the parameters taken while data collection as authors mentioned a data collection form, it would be beneficial for readers if authors can provide the sample form in the supplementary.

Reply：We really appreciate your suggestion. In the revised manuscript, we provided sample form in supplementary file.

5.Among the comorbidities, most of the focus is on hypertension and chronic diseases in respiratory system; while as it would have been interesting to see RPR in the immunocompromised such as HIV positive patients. Authors have completely ignored this factor; however, it will be an interesting inclusion.

Reply：Thank you very much for the question. It is really important. We are also very interested in the re-positive performance of patients with abnormal immune status. In our study, all the patients when they admitted to hospital were inquired of detailed personal history, including HIV infection. Due to the limited conditions, not all the patients were screened for HIV test during hospitalization. According to your advice, we screened the data again and we found that none of the patients had a history of AIDS. Among all the patients, 63 of them underwent HIV antibody test due to possible blood transfusion, and all of their results were negative. Then we searched the literatures. The epidemiological study from Huangshi Center for Disease Control and Prevention showed that there were 1 518 HIV/AIDS cases reported from 2011 to 2017 in Huangshi city [4], while the total population of Huangshi is 2.69 million. The infection rate of HIV in Huangshi is relatively low. That could be the reason why HIV patients were rare in our study.

References:

1. Gudbjartsson DF, Norddahl GL, Melsted P, Gunnarsdottir K, Holm H, Eythorsson E, et al. Humoral Immune Response to SARS-CoV-2 in Iceland. N Engl J Med. United States; 2020;

2. Deng W, Bao L, Liu J, Xiao C, Liu J, Xue J, et al. Primary exposure to SARS-CoV-2 protects against reinfection in rhesus macaques. Science. 2020;369:818–23.

3. Kang H, Wang Y, Tong Z, Liu X. Retest positive for SARS-CoV-2 RNA of “recovered” patients with COVID-19: Persistence, sampling issues, or re-infection? J Med Virol. 2020;

4. Fu Xiong, Ruiqing Xie, Xianzhou Ke ZQ. AIDS epidemic and epidemic characteristics in Huangshi, 2011- 2017. China Trop Med [Internet]. China Tropical Medicine; 2018;18:906. Available from: http://www.cntropmed.com/CN/abstract/article_13504.shtml

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

13 Oct 2020

PONE-D-20-18154R1

Clinical characteristics of re-positive COVID-19 patients in Huangshi, China: a retrospective cohort study

PLOS ONE

Dear Dr. Yao,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 27 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Wenbin Tan

Academic Editor

PLOS ONE

As the reviewer commented below, the ethical statements addressing the patients cohorts from both institutions are very important. It must be clarified.

Reviewer #3: 1. In this study. 383 patients in Huangshi hospital of Traditional Chinese Medicine (TCM) and Huangshi hospital of Youse was included, but the Ethics Statement showed that the study was approved only by the Research Ethics Commission of Huangshi Hospital of Traditional Chinese Medicine. It should has another Ethics Statement from Huangshi hospital of Youse. Please provide the Ethics statement to address this issue.

2. In this study, all patients were diagnosed with COVID-19 according to the Chinese management guideline for COVID-19 (version 6.0). This guideline was published in the Feb. 18th 2020, how could all patients be diagnosed according to this guideline? Some patients must be diagnosed with covid-19 before the guideline being published.

3. Two patients, whose cough and chest tightness worsened during quarantine after they were discharged, were considered as non-recovering patients who were not included in our study. But why they were considered as non-recovering patients, not the re-positive recovering (RPR) patients? They were negative when they were discharged from the hospital.

4. About 30·68% of them had comorbidities. The most common comorbidities were hypertension (n=72，18·8%) followed by diabetes (n=33,8·62%) and coronary heart disease(n=16, 4·18%). How many patients had chronic disease? And how many patients who had two comorbidities at least For example patients had hypertension and diabetes together.

5. Multivariate analysis showed that the arbidol reduced the probability of repositive outcome. But it did`t give the criteria for the use of drugs. Who had received the arbidol and who hadn't?

6. In Multivariate analysis, there showed “a younger age (adjusted HR 0·075, 95% CI 0·009-0·657; P =0·0193),” “the arbidol reduced the probability of repositive outcome (adjusted HR 0·048, 95% CI:0·010-0·231; P =0·0002).”, but in DISCUSSION, “There was no difference in demographics, epidemiological features and treatment between the RPR and non-RPR groups by univariate analysis.” Please clarify.

**********

20 Oct 2020

Dear editor:

Thanks a lot for having reviewed our manuscript.   Now we have revised the manuscript according to the reviewers’ comments. Most of the revisions are in the manuscript. Some explanations regarding the revisions of our manuscript are as follows. Just as we communicated in the E-mail on Oct 15, comments of 3 and 6 from the reviewer # 3 were ignored here.

Answers to Review #3

1.In this study. 383 patients in Huangshi hospital of Traditional Chinese Medicine (TCM) and Huangshi hospital of Youse was included, but the Ethics Statement showed that the study was approved only by the Research Ethics Commission of Huangshi Hospital of Traditional Chinese Medicine. It should has another Ethics Statement from Huangshi hospital of Youse. Please provide the Ethics statement to address this issue.

Reply：Thank you very much for reminding. In fact, this study was approved by the ethics committees of two hospitals at the beginning of the study. We have modified the inaccurate description in the manuscript and provided the ethics committee approval documents issued by these two hospitals (form Line 103 to Line 104).

2.In this study, all patients were diagnosed with COVID-19 according to the Chinese management guideline for COVID-19 (version 6.0). This guideline was published in the Feb. 18th 2020, how could all patients be diagnosed according to this guideline? Some patients must be diagnosed with covid-19 before the guideline being published.

Reply：Our description here is not rigorous. We had made corrections in the manuscript (On Line 83 and Line 101).

3. Two patients, whose cough and chest tightness worsened during quarantine after they were discharged, were considered as non-recovering patients who were not included in our study. But why they were considered as non-recovering patients, not the re-positive recovering (RPR) patients? They were negative when they were discharged from the hospital.

Reply：This issue had been corrected in revised manuscript. Just as we communicated in the E-mail on Oct 15, this comment was ignored here.

4. About 30·68% of them had comorbidities. The most common comorbidities were hypertension (n=72，18·8%) followed by diabetes (n=33,8·62%) and coronary heart disease(n=16, 4·18%). How many patients had chronic disease? And how many patients who had two comorbidities at least For example patients had hypertension and diabetes together.

Reply：Your comments are very valuable. We had added a description about this in Table 1and manuscript (From Line 170 to Line 172, Line 234 to Line 235).

5. Multivariate analysis showed that the arbidol reduced the probability of repositive outcome. But it did`t give the criteria for the use of drugs. Who had received the arbidol and who hadn't?

Reply：This question is very good. However, at the beginning of the year, in response to the unprepared attack of COVID-19, we did not have an accurate understanding of the therapeutic value of Abidol, or whether it was more effective in certain groups of people. You could find that our guideline has been updated from the 2st edition to the 6th edition within a few months, and our understanding of covid-19 has been improving and changing until now. Therefore, in this article, we have not stipulated what kind of patients should or should not use Arbidol. Each doctor in charge chose combination of drugs based on his or her professional knowledge.

6. In Multivariate analysis, there showed “a younger age (adjusted HR 0·075, 95% CI 0·009-0·657; P =0·0193),” “the arbidol reduced the probability of repositive outcome (adjusted HR 0·048, 95% CI:0·010-0·231; P =0·0002).”, but in DISCUSSION, “There was no difference in demographics, epidemiological features and treatment between the RPR and non-RPR groups by univariate analysis.” Please clarify.

Reply：This issue had been corrected in revised manuscript. Just as we communicated in the E-mail on Oct 15, this comment was ignored here.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

23 Oct 2020

Clinical characteristics of re-positive COVID-19 patients in Huangshi, China: a retrospective cohort study

PONE-D-20-18154R2

Dear Dr. Yao,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Wenbin Tan, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

27 Oct 2020

PONE-D-20-18154R2

Clinical characteristics of re-positive COVID-19 patients in Huangshi, China: a retrospective cohort study

Dear Dr. Yao:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Wenbin Tan

Academic Editor

PLOS ONE