Literature DB >> 33137154

Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection.

Ahmed A Ahmed1, Marga G A Goris1, Marije C Meijer1.   

Abstract

At least two real-time PCRs for the early diagnosis of leptospirosis have been described, evaluated and validated. However, at least one other report suggested adaptation and modification of primers and probes used in these assays since additional Leptospira species have been described and the primers and probe in use possess a serious mismatch to corresponding target sequence. In this study we developed a real-time PCR for detection of pathogenic Leptospira based on the lipL32 gene. The present method consists of generic primers and probes based on target sequence of 10 pathogenic Leptospira species including Leptospira interrogans. The hybridization, annealing and extension temperature (60°C) were optimized as the optimal temperature of the DNA polymerase enzyme which is used in the amplification reaction. The present assay has a high analytical sensitivity and specificity; the calculated diagnostic sensitivity and specificity were 93.0% and 98.3% respectively. Moreover, the present method includes an internal control which enables easy detection of false negative results and an optional extraction control which enables the estimation of the DNA extraction efficiency.

Entities:  

Year:  2020        PMID: 33137154      PMCID: PMC7605690          DOI: 10.1371/journal.pone.0241584

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Real-time PCR in its various forms and chemistries has been applied and adopted in many clinical laboratories as a robust diagnostic tool for detection of pathogens. Particularly, diagnosis of leptospirosis in the early acute phase can facilitate the treatment of an infected patient with a proper antibiotic at an appropriate time, which might prevent further complications including multi-organ failure. In addition, real-time PCR is a perfect tool which can be applied to identify the sources of the infection and related maintenance reservoirs. The diagnosis of leptospirosis in the early acute phase is not possible by serological methods such as ELISA, MAT, and rapid diagnostic tests (RDT’s), which mainly rely on detection of anti-leptospiral antibodies and hence only can be detected in late acute phase of the disease (more than 7 days after the onset of the disease) [1, 2]. Detection of DNA of pathogenic leptospires in patient samples is very successful during 1–5 days after the onset of the disease [3]. During the past decade, at least two real-time PCRs have been developed and validated for leptospirosis diagnosis [3-6]. Since continuously monitoring the performance of these particular molecular tests is required as part of the validation procedure of a diagnostic test [7], at least one other report suggested adaptation and modification of primers and probes used in these assays as many new species have been described and the primers and probes in use possess a serious mismatch to corresponding target sequence [8]. In fact, most of these PCRs targeting pathogenic Leptospira have been developed based on the genome sequence of one Leptospira species namely L. interrogans. Recently, new pathogenic species of the genus Leptospira have been described and the whole genome sequence of at least one strain representing each species have been published in the genome sequence database [9], which makes it possible to evaluate (in silico) the specificity of the molecular methods used for the detection of this pathogen. According to the OIE recommendation for diagnostic tests; evaluation, monitoring the performance and continuously checking the specificity and the sensitivity of a particular test are critical factors in the validation procedure [7]. In this study, we demonstrate the development and validation of a real-time PCR for detection of pathogenic leptospires according to the OIE criteria. The assay was optimized conforming to the standard real-time PCR protocol using hydrolysis probes (dual-labeled oligonucleotides) [10]. This assay has the ability to detect all pathogenic Leptospira species currently known with a high efficiency, sensitivity and specificity. The test has been optimized to accommodate multiplexing with other real-time PCR assays in use for other pathogenic micro-organisms. Alternatively it might be used as a single assay but with another real-time PCR test in the same time using the same thermocycler. Moreover, the assay was optimized including a synthetic template as an internal control (IC) to assure the quality of the system. Optionally, this template could be used to check the efficiency of the DNA extraction procedure as well.

Materials and methods

The development and validation of this real-time PCR was performed according to the OIE criteria for validation of a diagnostic method [7] and according to a standard real-time PCR protocol using hydrolysis probes [10].

Ethics statement

This research was exempted from ethical review of human subjects research by the Medical Ethics Review Committee of the Academic Medical Center, University of Amsterdam (W20_327#20.362).

Micro-organisms and DNAs preparation

In this study, 73 strains belonging to pathogenic, non-pathogenic and intermediate Leptospira species (Table 1) and 46 other micro-organisms (Table 2) were included and tested to evaluate the method described in this paper. Leptospira strains were derived from the reference collection of the National Leptospirosis Reference Centre (NRL), AMC, Amsterdam, the Netherlands. Genomic DNAs of other 46 micro-organisms were partly acquired from the Microbiology Department (AMC) and partly a gift from colleagues from other institutions.
Table 1

Leptospira strains used in the assay.

No.SpeciesSerovarStrainStatusResultReference
1L. alexanderiBannaA 31Pathogenic+[20]
2L. alexanderiManhao 3L 60Pathogenic+[20]
3L. alexanderiMenglaA85Pathogenic+[20]
4L. alexanderiManzhuangA23Pathogenic+[20]
5L. alstoniiPinchang80–412Pathogenic+[20]
6L. borgpeterseniiKisubaKisubaPathogenic+[20]
7L. borgpeterseniiHardjo typeBovisSponseleePathogenic+[20]
8L. borgpeterseniiBalcanica1627 BurgasPathogenic+[20]
9L. borgpeterseniiMiniSariPathogenic+[20]
10L. borgpeterseniiKisubaKisubaPathogenic+[20]
11L. borgpeterseniiHardjo type BovisL550Pathogenic+[21]
12L. borgpeterseniiPoiPoiPathogenic+[20]
13L. borgpeterseniiArboreaArboreaPathogenic+[20]
14L. borgpeterseniiMiniSariPathogenic+[20]
15L. borgpeterseniiBallumMus 127Pathogenic+[20]
16L. borgpeterseniiHamptoniHamptonPathogenic+[20]
17L. borgpeterseniiKwaleJuluPathogenic+[20]
18L. borgpeterseniiNigeriaVomPathogenic+[22]
19L. interrogansCopenhageniWijnbergPathogenic+[20]
20L. interrogansPyrogenesSalinemPathogenic+[20]
21L. interrogansHardjo type PrajitnoHardjoprajitnoPathogenic+[20]
22L. interrogansHawainLT 62–68Pathogenic+[20]
23L. interrogansWaskurinLT 63–68Pathogenic+[20]
24L. interrogansCopenhageniM 20Pathogenic+[20]
25L. interrogansKremastosKremastosPathogenic+[20]
26L. interrogansPomonaPomonaPathogenic+[20]
27L. interrogansLaiLaiPathogenic+[20]
28L. interrogansAustralisBallicoPathogenic+[20]
29L. interrogansBataviaeSwartPathogenic+[23]
30L. interrogansLoraLoraPathogenic+[20]
31L. interrogansIcterohaemorrhagiaeRGAPathogenic+[20]
32L. interrogansRecreo380Pathogenic+[20]
33L. interrogansLai type LangkawiLangkawiPathogenic+[24]
34L. kirschneriBim1051Pathogenic+[20]
35L. kirschneriGrippotyphosaMoskva VPathogenic+[20]
36L. kirschneriCynopteri3522 CPathogenic+[20]
37L. kirschneriGrip. type DuysterDuysterPathogenic+[20]
38L. kirschneriSokoineRM1Pathogenic+[25]
39L. kirschneriLambweLambwePathogenic+[20]
40L. kmetyiMalaysiaBejo-IsoTPathogenic+[26]
41L. mayottensisKenya200901122Pathogenic+[27]
42L. meyeriSofiaSofia 874Pathogenic+[20]
43L. noguchiiHuallagaM7Pathogenic+[20]
44L. noguchiiCarimagua9160Pathogenic+[20]
45L. noguchiiLouisianaLSU 1945Pathogenic+[20]
46L. santarosaiGuaricuraBov. GPathogenic+[20]
47L. santarosaiLuisM 6Pathogenic+[20]
48L. santarosaiSulzeraeLT 82Pathogenic+[20]
49L. santarosaiRiojaMR 12Pathogenic+[20]
50L. santarosaiHuanucoM 4Pathogenic+[28]
51L. santarosaiVarela1019Pathogenic+[20]
52L. weiliiRanarumICFPathogenic+[20]
53L. weiliiVughiaLT 89–68Pathogenic+[20]
54L. weiliiQingshuiL 105Pathogenic+[20]
55L. dzianensisundesignatedM12APathogenic+[29]
56L. barantoniiundesignatedFH4-C-A1Pathogenic+[29]
57L. putramalaysiaeundesignatedSSW20Pathogenic+[29]
58L. adleriundesignatedFH2-B-D1Pathogenic+[29]
59L. ellisiiundesignatedAT17-C-A5Pathogenic+[29]
60L. gomenensisundesignatedKG8-B22Pathogenic+[29]
61L. inadaiLyme10Intermediate-[20]
62L. licerasiaeVarillalVAR 010Intermediate-[30]
63L. wolffiiKhoratKhorat-H2TIntermediate-[31]
64L. broomiiHurstbridge type HB65399Intermediate-[32]
65L. faineiHurstbridgeBUT 6Intermediate-[33]
66L. idoniiUndesignatedEri-1TIntermediate-[34]
67L. biflexaPatocPatoc ISaprophytic-[20]
68L. biflexaAndamanaCH 11Saprophytic-[20]
69L. meyeriSemarangaVeldrat Sem. 173 Semarang173Saprophytic-[35]
70L. terpstraeHualinLT11-33Saprophytic-[20]
71L. vanthieliiHollandWaz HollandSaprophytic-[20]
72L. wolbachiiCodiceCDCSaprophytic-[20]
73L. yanagawaeSaopauloSao PauloSaprophytic-[20]

+ Positive PCR result,—Negative PCR result.

Table 2

Other micro-organisms tested in this study.

No.SpeciesPCR Result
1Acinetobacter calcoaceticus-
2Bartonella henselae-
3Bacillus subtilis-
4Bifidobacterium longum-
5Bordetella bronchiceptica-
6Borrelia burgdorferi-
7Brucella melitensis-
8Burkholderia cepacia-
9Campylobacter jejuni-
10Candida albicans-
11Candida dublinensis-
12Candida glabrata-
13Candida krusei-
14Candida parapsilosis-
15Corynebacterium diphteriae-
16Corynebacterium xerosis-
17Enterobacter aerogenes-
18Enterococcus faecalis-
19Enterococcus faecium-
20Escherichia coli-
21Helicobacter pylori-
22Klebsiella pneumoniae-
23Lactobacillus plantarum-
24Legionella pneumophila-
25Leishmania donovani-
26Leptonema illini-
27Listeria monocytogenes-
28Mycobacterium africanum-
29Mycobacterium bovis-
30Mycobacterium leprae-
31Mycobacterium tuberculosis-
32Neisseria gonorrhoeae-
33Pasteurella multocida-
34Plasmodium falciparum-
35Proteus mirabilis-
36Pseudomonas aeruginosa-
37Rickettsia akari-
38Salmonella enterica-
39Staphylococcus aureus-
40Streptococcus pneumoniae-
41Streptococcus sanguis-
42Trypanosoma cruzi-
43Toxoplasma gondii-
44Treponema pallidum-
45Turneriella parva-
46Yersinia enterocolitica-

- Negative PCR result.

+ Positive PCR result,—Negative PCR result. - Negative PCR result.

DNA extractions

Leptospira strains were propagated at 30°C in EMJH liquid media which is prepared according to Ellinghausen and McCullough [11] as modified by Johnson and Harris [12]. The number of bacteria per ml was estimated using a Helber bacteria counting chamber (Weber Scientific international, West Sussex BN15 8TN England). Genomic DNA of Leptospira strains from the culture medium and the internal control (IC) template were extracted using Qiagen mini kit (Germany). Genomic DNA of Leptospira strains in spiked blood, serum and urine were extracted using easyMAG automated system (bioMérieux, Marcy l’Etoile, France) according to the manufacturer’s recommendation. The quality and quantity of leptospiral DNA was estimated by measuring the absorbance of DNA using the spectrophotometer ND-1000 Nanodrop (3411 Silverside Rd, Bancroft Building, Wilmington, DE 19810, USA). Leptospira interrogans serovar Icterohaemorrhagiae strain Kantorowicz was used to optimize and evaluate this assay, and therefore a total genome size of 5 Mb was used to estimate the equivalent number of genome copies per μl of the purified leptospiral DNA [13]. All DNAs extracted from Leptospira strains (Table 1) were standardized to a concentration equivalent of 102 genome copies/μl. In order to check the efficiency of the extraction method, a concentration of 0.58 pg equivalent to 100 copies of IC DNA was added to the spiked blood, serum, urine and each clinical material prior to DNA isolation. DNA of all patient’s diagnostic materials used in this assay such as blood, serum and urine were isolated using the easyMAG automated system.

Real-time PCR assay

Primers and probes design and selection

Primers and probes were designed targeting lipL32 of pathogenic Leptospira; the lipL32 sequence of 97 strains belonging to 10 species of pathogenic Leptospira were retrieved from the sequence database [14], aligned and a consensus sequence was determined using Mega7 software [15]. Subsequently specific primer sets and probes were designed and modified using free available software (primer3) [16, 17]. The probes were modified at 5’ end and 3’ end with FAM as a reporter and BHQ1 as a quencher respectively. The sequences of the oligonucleotides, modification of the mismatching base pairs of the primers and probes, and the modification of the 5' end and 3' end of the probes are shown in Table 3.
Table 3

Sequences and modification of the primers, probes and synthetic DNA template IC used to optimize the assay.

Oligo IDSequenceTarget
LipgrF25’CGCTGAAATGGGAGTTCGTATGATTTCC3’lipL32
LipgrR25’GGCATTGATTTTTCTTCYGGGGTWGCC3’lipL32
LipgrP15’FAM AGGCGAAATCGGKGARCCAGGCGAYGG3’BHQ1lipL32
IntoF25’TAGAATCATTGAATCTATCACATCTCATG3’Internal Control
IntoR25’TTGAACTAAATGTAGACTAAAGATGATCG’3Internal Control
IntoP15’TxRd TTCACATTAACATTCAATAATCAATCATGAA3’BHQ2Internal Control
PlasintS15’CTATAGAATCATTGAATCTATCACATCTCATGTACTTCACATTAACATTCAATAATCAATCATGAATTAATTCAATTTCTGATATGAATCGATCATCTTTAGTCTACATTTAGTTCAATATATC3’Internal Control DNA template
The sensitivity and specificity of the selected primers and probes were tested in silico utilising BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). As a DNA template for the IC, a synthetic DNA sequence was designed, synthesized and cloned in cloning vector pUC57-Kan. A primer set and probe targeting the IC template sequence were designed specifically matching these synthetic DNA sequence. The IC probe was modified at 5’ and 3’ with TexRed fluorophore and BHQ2 quencher respectively (Table 3). All primers and probes were synthesized by a commercial facility (Sigma-Aldrich, United Kingdom). The IC DNA template was synthesized and cloned by a commercial facility (Thermo Fisher, Germany).

Optimization of the real-time PCR

The assay was optimized using LightCycler 480 Probes Master mix (Roche, Germany) according to the manufacturer’s recommendation. Two phases of assay optimization were performed. The initial phase was performed without including the IC system. The final optimization phase was performed after the initial one as the IC template, IC primers and probe were incorporated in the reaction mix. In order to achieve optimal performance and maximal PCR efficiency, the selected primers and probe were tested using different concentrations and within a selected range of annealing and hybridization temperatures. The test was performed employing the CFX96 real-time PCR detection system according to the manufacturer’s instructions (BioRad Laboratories, Inc, the Netherlands). The selected primers and probe (LipgrF2, LipgrR2 and LipgrP1) sequence are shown in Table 3. In order to get perfect matching and high specificity to all pathogenic Leptospira targeted by this assay, the reverse primer LipgrR2 was modified at nucleotide base 18 and 24 with bases Y(C+T) and W (A+T) respectively and the probe LipgrP1 was modified at base 13,16 and 25 with degenerated bases K (G+T), R (A+G) and Y (C+T) respectively. The concentration of the reagents and the cyclic amplification protocol were optimized according to the real-time PCR standard protocol. Briefly, 12.5 μl of 2x master mix (Roche, Germany), 0.4 μM of each leptospires forward and reverse primer (LipgrF2 and LipgrR2), 0.2μM of the leptospires probe (LipgrP1), 0.16 μM of each internal control primers (IntoF2 and IntoR2), 0.08 μM of internal control probe (IntoP2), 0.25 μl double-distilled DNase/RNase-free water and 0.29 pg (equivalent to 50 copies) of IC DNA template, and finally 10 μl of sample DNA template in a total volume of 25 μl were submitted to the amplification procedure. The amplification program consists of initial DNA denaturation and DNA polymerase activation at 95°C for 5 minutes, 45 cycles of two steps 95°C for 20 seconds as denaturation and 60°C for 30 seconds representing hybridization of the probes, annealing of the primers and the extension of forward and reverse primers.

Analytical specificity

The specificity of the assay was investigated using a panel of Leptospira strains representing pathogenic, intermediate and saprophytic species (Table 1) and other micro-organisms (Table 2). A concentration equivalent to 103 genome copies per reaction of each Leptospira strain was tested in duplicate.

Analytical sensitivity

The detection threshold of the PCR was estimated using L. interrogans serovar Icterohaemorrhagiae strain Kantorowicz combined with the IC DNA template. Serial dilutions (10-fold) of strain Kantorowicz genomic DNA starting at 1 × 104 copies per reaction down to 10 copies per reaction were used to construct a standard curve of the assay. To determine the lower concentration which can be detected by the assay, the last positive 10-fold dilution still giving a positive signal was subjected to subsequent 2-fold serial dilutions. Finally the end-point was set at the dilution in which the assay could detect the target in at least 95% of the replicates. As internal control for the clinical samples the concentration of the IC template was standardized to 50 copies per reaction. To assess the effects of the biological matrix on the analytical sensitivity, seronegative (MAT) and PCR negative blood (200 μl) and serum (200 μl) samples as well as PCR negative urine samples (1 ml) were each spiked with a 10-fold serial dilution of 9 x 105 leptospires of L. interrogans serovar Icterohaemorrhagiae strain Kantorowic. These samples were subjected to DNA extraction and subsequent amplification. The last positive 10-fold dilution still giving a positive signal was subjected to subsequent 2-fold serial dilutions, DNA extraction and subsequent amplification. PCR data was analyzed using CFX Manager Software (BioRad Laboratories, Inc, the Netherlands) and the regression mode analysis was selected to determine quantification cycle (Cq) values.

Diagnostic sensitivity (DSe), specificity (DSp) and confidence intervals (CI)

Diagnostic sensitivity, specificity and 95% confidence intervals (DSe, DSp and CI) were calculated using 249 clinical samples of Dutch human patients suspected of leptospirosis. One sample from each patient was tested in this lipL32 real-time PCR. These clinical samples were submitted to the National Leptospirosis Reference Laboratory (NRL), AMC, the Netherlands. NRL functions as a diagnostic reference center for leptospirosis in the Netherlands and is accredited according to ISO 15189. The standard procedures include MAT, ELISA, culture [2] and secY real-timePCR [3] to diagnose leptospirosis. Patients were considered having leptospirosis based on one or more of the following criteria: positive culture, positive PCR, single MAT titer with a pathogenic strain ≥1:160, single IgM-ELISA titer ≥1:160, seroconversion / ≥ four-fold titer rise MAT or IgM ELISA in paired samples taken at least 2 days apart [2]. Serum, EDTA blood and urine samples taken in the period May 2013 until October 2016 were tested. Either banked samples (stored at -20°C) were used or DNA extracted from these samples (DNA stored < 1 year at -20°C). All tests were performed in duplicate and the statistical analysis was performed according to standard literature [18, 19].

Results and discussion

Real-time PCR profile

LipL32 primer set LipgrF2/ LipgrR2 and probe LipgrP1 in combination with IC primer set IntoF2/ IntoR2 and probe IntoP1 were selected as they reacted with high sensitivity and specificity to their targets. The optimal concentration of the reaction reagents and the cyclic amplification conditions were mentioned earlier as “Real-time PCR assay” in the material and methods section.

Analytical specificity of the assay

In silico testing of primer LipgrF2/ LipgrR2 and probe LipgrP1 sequence using BLAST search, shows no identities between the primer set, the probe and genomic sequences of any organism other than pathogenic Leptospira. DNA from 73 Leptospira strains belonging to 17 pathogenic, 6 intermediate and 6 saprophytic Leptospira, as well as 46 other micro-organisms were tested (Tables 1 and 2). Primer set LipgrF2/ LipgrR2 and probe LipgrP1 specifically amplified genomic DNA isolated from pathogenic Leptospira species, 1000 genome copies per PCR reaction of all pathogenic strains gave positive results with an average Ct of 31 while they did not react with intermediate and saprophytic species (Table 1) and other micro-organisms (Table 2), indicating a high analytical specificity for pathogenic Leptospira.

Analytical sensitivity of the assay

The analytical sensitivity of the assay when using DNA extracted from L. interrogans strain Kantorowicz and IC template was one copy per reaction as the real-time PCR standard curve shows the following values (E = 101,6%, R2 = 0,99, Slope -3,28 and y-int = 41,26) (Fig 1). The regression mode of the analysis was selected in CFX Manager Software for the analysis and determination of the quantification cycle (Cq).
Fig 1

Limit of detection of the current real-time PCR assay using L. interrogans strain Kantorowicz DNA combined with IC DNA template.

The regression line is for data that are in the linear range. The equation of the line and R2 are displayed.

Limit of detection of the current real-time PCR assay using L. interrogans strain Kantorowicz DNA combined with IC DNA template.

The regression line is for data that are in the linear range. The equation of the line and R2 are displayed. The analytical sensitivity for the spiked serum, blood and urine with L. interrogans strain Kantorowicz were estimated as 2, 3 and 5 leptospires per reaction respectively using the protocol mentioned above.

Efficiency of the extraction method

When using 100 copies of the IC DNA template to estimate the efficiency of the extraction method, we observed 68.3% recovery in serum, 44.7% in blood and 30.0% in urine. Although the estimation of the extraction efficiency is beyond the scope of this study our results show that the IC is useful to evaluate the extraction method.

Diagnostic sensitivity and specificity

Clinical blood samples from 71 laboratory-confirmed leptospirosis patients and 178 negative patients (suspected of leptospirosis) were enrolled as a prospective consecutive cohort to determine the diagnostic sensitivity (DSe) and specificity (DSp); 66 of the confirmed cases and 3 of the 178 negative cases had a positive lipL32 real-time PCR result. Therefore the DSe and DSp of the PCR are 93.0% (CI 83.6–97.4%) and 98.3% (CI 94.8–99.6%) respectively. Sensitivity and specificity of particular real-time PCR assays mainly rely on primers and probe design, their selection criteria and their optimal parameters. Moreover, optimizing the concentrations of all reagents involved in the amplification reaction and optimizing the reaction conditions ensure a sensitive, specific and efficient assay. At least one report illustrated that primers and probes used in two validated PCRs for detection of pathogenic leptospires required modification since serious mismatching in these oligos was reported which resulted in at least one pathogenic species of Leptospira which could not be detected [8]. In this assay, the PCR successfully detected all pathogenic Leptospira but not saprophytic and intermediate leptospires as well as other microorganism tested so far. This high analytical specificity indicates that the primers and probe set used in this study perfectly matches the target sequences of pathogenic leptospires and excludes saprophytic and intermediate leptospires as well as other microorganism sequences. Moreover, the oligo set was designed according to a standard procedure and their optimal annealing and hybridization temperature was adjusted to the optimal temperature for DNA polymerase activity (60°C) permitting a high reaction sensitivity. The assay shows a high analytical sensitivity combined with a high real-time PCR reaction efficiency since one copy of genomic DNA can be detected from pure targeted DNA. However, testing spiked biological materials such as serum, blood and urine with Leptospira resulted in an analytical sensitivity of 2, 3 and 5 genomic copies, respectively. The efficiency of the extraction method used to isolate the DNA and the existence of inhibitors may explain the slight differences in the analytical sensitivity value between pure DNA and spiked materials. The diagnostic sensitivity and specificity were calculated as 93.0% and 98.3%, respectively. Calculation of these values mainly rely on the reference standard, in this study diagnostic culturing, serology and secY real-time PCR were considered as reference standard according to the standard procedures of NRL. As quality control, IC was used in this assay to check the performance of the reaction procedure per individual sample and single reaction tube or plate well and to investigate the presence of inhibitors in the clinical samples. Moreover it can be used to check the efficiency of the extraction method. In conclusion, a real-time PCR with high specificity and specificity was developed. This PCR includes the internal control as one of the quality control parameters of this assay and an optional extraction control in case of using a manual and not automated controlled extraction method. The present assay has several advantages over currently in use PCR methods. First it has the capability to detect all known Leptospira pathogenic species since the generic primer and probe set used in this assay reacts positively with all mentioned pathogenic species. Secondly the ability to monitor false negative results that may be generated during DNA extraction or during the reaction since the method incorporates the synthetic internal control. Thirdly the hybridization, annealing and amplification temperature (60°C) have been optimized to the optimal temperature of the DNA polymerase enzyme. This allows multiplexing with other PCRs to detect other pathogens in one tube or to run the test in the same plate but in different wells using the standard cyclic programme. 6 May 2020 PONE-D-20-04275 Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection PLOS ONE Dear Dr. Ahmed, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ACADEMIC EDITOR: Statistical evaluation is needed to validate the obtained data. We would appreciate receiving your revised manuscript by Jun 20 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Kalimuthusamy Natarajaseenivasan Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2.  Thank you for including your ethics statement: "Procedures for collecting patients’ data and use of clinical specimens for laboratory service improvement falls under the umbrella of the ‘National Coordination Infectious Disease Control’ (Landelijke Coördinatie Infectieziektebestrijding, LCI), ‘Centre for Infectious Disease Control’ (Centrum Infectieziektebestrijding, Cib), which is a formal body of the Netherlands Ministry of Health and resides in the National Institute for Public Health and Environment (RIVM) in Bilthoven, the Netherlands and thus were conducted in compliance with the regulation, policies and principles of the Dutch Public Health Service Policy. The procedure includes the processing of anonymous data from patients upon receipt of written informed consent." a.) Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study. b.) Please amend your current ethics statement to confirm that your named institutional review board or ethics committee specifically approved this study. Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”). For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research. 3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ Additional Editor Comments (if provided): [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: I Don't Know ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1. Page 9, line 127- 128: The basic source of Internal control (IC) is missing. What are the criteria adopted for designing of IC? In which cloning vector used? Is any previous references are available? 2. Page 10, line 136 & 150: Initially it is mentioned that optimization of real time PCR using light cycler 480 probes Master mix (Roche, Germany), later in line 150 2X master mix (Applied Biosystem). Which is exactly used in this study? Kindly modify accordingly 3. Page 11, Line 161 -172: In analytical specificity, 103 genome copies were used. This is equal to 1000 organisms/reaction. Whereas in analytical sensitivity serial dilution (10 fold) of DNA used. Here exact counting of organism is practically difficult. So author may incorporate Initial concentration of DNA/ copy number used for dilution needs to be mentioned, which is missing. Standard curve normalization w.r.t 103 genome copies needs to be incorporated along with the double dilution as well. 4. Page 12, line 175: What is the spiked leptospiral (L.interrogans strain Kantorowic) load used in the first dilution of this study? 5. Page 12, Line 186 -189: Mentioned as “positive PCR. Which type of PCR is missing? Also authors are requested to analyze the data from each case inclusion criteria and draw their positive and negative results obtained from this study. I believe these data may provide certain clues where/in which case(s) the diagnostic efficiency are increased. These findings would helpful for the selection of appropriate sample and its day of collection after onset of disease. 6. Line 105 -106: Mentioned as all leptospiral DNA concentration equivalent to 103 genome/µl. whereas in line 154, 10µl of DNA template was used for the amplification. This is approximately equal to 10,000 copies. In line 163, 103 genome copies per reaction were used. These three statements are having contradicted interpretation and confuse the readers. Authors are requested to modify accordingly. 7. Page 13, line 203-204: any organism other than leptospira; modify other than “pathogenic” leptospira. 8. Line 107 & 172 -173: 100 copies of IC DNA was spiked in clinical specimens for determination of efficiency of extraction. Whether authors are achieved same 100 copies in the extraction? This is missing. Line 172 -173: The concentration of IC template was optimized as 50 copies/reaction. In line 214, considering the above statement, IC template should be two copies/reaction, but it is mentioned one copy reaction. Kindly clarify the statement. 9. Page 14, Line 223 -224: Clinical sample ratios (Positives & Negatives) are statically insignificant. More negative samples were enrolled in the study. Reviewer #2: The study seems to be a good effort to design generic primers and probes for the diagnosis leptospirosis in the early phase and the manuscript is well written. However, there are few concerns that needs to be addressed. It would be more significant if the statistical methods used to calculate the Diagnostic sensitivity (DSe), specificity (DSp) and confidence intervals (CI) are explained in detail. Moreover, there are few grammatical and spelling errors that needs to be corrected. For instance in Line 17 and 43- ‘target sequence’ has been written as ‘targets sequence’; Line 35 and 227- the word ‘rely’ has been spelt as ‘relay’; Line 89- the word result is spelt twice as ‘PCR result Result”; Line 208- ‘with an average Ct of’ is written as ‘with on average a Ct of’; Line 257- ‘set use in this assay’ should be changed to ‘set used in this assay’; Line 259- change ‘may generated’ to ‘may be generated’, etc ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: VEDHAGIRI KUMARESAN Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Point wise comments to authors PONE-D-20-04275.docx Click here for additional data file. 21 Jul 2020 1. Page 9, line 127- 128: The basic source of Internal control (IC) is missing. What are the criteria adopted for designing of IC? In which cloning vector used? Is any previous references are available? Answer: This is synthetic DNA, we will change in the text “artificial” to “synthetic”. The criteria are that the sequence of the synthetic DNA does not react with the used target primers sequences and that the primers used to amplify the IC should have an annealing temperature equalling 60 °C as for the target primers. The cloning vector is pUC57-Kan. We have added this information to the manuscript. There is no previous reference available, the IC is designed for the first time described in this manuscript. 2. Page 10, line 136 & 150: Initially it is mentioned that optimization of real time PCR using light cycler 480 probes Master mix (Roche, Germany), later in line 150 2X master mix (Applied Biosystem). Which is exactly used in this study? Kindly modify accordingly. Answer: Thank you for this remark, we used Roche, Germany for both and we have modified the text accordingly. 3. Page 11, Line 161 -172: In analytical specificity, 103 genome copies were used. This is equal to 1000 organisms/reaction. Whereas in analytical sensitivity serial dilution (10 fold) of DNA used. Here exact counting of organism is practically difficult. So author may incorporate Initial concentration of DNA/ copy number used for dilution needs to be mentioned, which is missing. Standard curve normalization w.r.t 103 genome copies needs to be incorporated along with the double dilution as well. Answer: Initial concentration of DNA has been added to the MS (i.e. strain Kantorowicz genomic DNA starting at 1 × 104 copies per reaction). The standard curve with 10-fold dilution is added to the manuscript as Figure 1. We did not perform a standard curve with doubling dilution, though the limit of detection is mentioned already in the text. 4. Page 12, line 175: What is the spiked leptospiral (L.interrogans strain Kantorowicz) load used in the first dilution of this study? Answer: The load of the strain Kantorowicz species L. interrogans (9x105 copies) of used in the first dilution has been added to the text as well as the volumes of blood, serum and urine. 5. Page 12, Line 186 -189: Mentioned as “positive PCR. Which type of PCR is missing? Also authors are requested to analyze the data from each case inclusion criteria and draw their positive and negative results obtained from this study. I believe these data may provide certain clues where/in which case(s) the diagnostic efficiency are increased. These findings would helpful for the selection of appropriate sample and its day of collection after onset of disease. Answer 1: The PCR is the secY real-time PCR mentioned in Reference 3, we made it more clear in the manuscript. Answer 2: Thank you for your suggestion to analyse the data from each case based on the inclusion criteria, in order to provide possible clues for increased diagnostic efficiency. In our opinion, we might not able to provide these clues. Our case definition is based on the overall results from each patient (serology, culture and secY real-time PCR). We encourage clinicians to submit the appropriate samples according to the days post onset, i.e. 1-10 DPO serum (for serology and PCR), EDTA blood (for PCR) and heparinised blood (for culture), >10 DPO serum (for serology). Urine and CSF can be send at any time point for PCR. However there are limitations to prepare such an analysis as you suggested since the reality is that we often get sub-optimal samples. In this study we also choose to include from each patient only one specimen to perform lipL32 real-time PCR, while the secY real-time PCR is performed on all submitted samples from the patient eligible for PCR (i.e. serum/EDTA blood taken 1-10 DPO, urine and CSF at any timepoint). In earlier studies it is shown that PCR on blood samples is most useful during the first 10 days of disease (Esteves LM et al. 2018. Diagnosis of Human Leptospirosis in a Clinical Setting: Real-Time PCR High Resolution Melting Analysis for Detection of Leptospira at the Onset of Disease. Sci Rep. 2018;8(1); Ahmed A et al 2009. Development and validation of a real-time PCR for detection of pathogenic leptospira species in clinical materials. PLoS One. 2009;4(9)). 6. Line 105 -106: Mentioned as all leptospiral DNA concentration equivalent to 103 genome/µl. whereas in line 154, 10µl of DNA template was used for the amplification. This is approximately equal to 10,000 copies. In line 163, 103 genome copies per reaction were used. These three statements are having contradicted interpretation and confuse the readers. Authors are requested to modify accordingly. Answer: Thank you for this observation, this is now modified to a concentration equivalent to 102 genome/µl in line 105-106. 7. Page 13, line 203-204: any organism other than leptospira; modify other than “pathogenic” leptospira. Answer: this is adapted 8. Line 107 & 172 -173: 100 copies of IC DNA was spiked in clinical specimens for determination of efficiency of extraction. Whether authors are achieved same 100 copies in the extraction? This is missing. Line 172 -173: The concentration of IC template was optimized as 50 copies/reaction. In line 214, considering the above statement, IC template should be two copies/reaction, but it is mentioned one copy reaction. Kindly clarify the statement. Answer: We have added an extra paragraph “Efficiency of the extraction method” showing the results of the recovery efficiency when we use 100 copies of IC. In Line 172-173 we wrote the optimal concentration of IC template was 50 copies/reaction. This is implemented when testing clinical samples as well as spiked material. We have rewritten these lines to make it more clear that there is no relation between the 50 copies/reaction used for the clinical samples and spiked material and the 100 copies/reaction used to estimate the extraction efficiency. 9. Page 14, Line 223 -224: Clinical sample ratios (Positives & Negatives) are statically insignificant. More negative samples were enrolled in the study. Answer Indeed, more negative patients are enrolled in this study. This reflects the pattern of submitted samples to our diagnostic laboratory, so therefore this is a representative population for the Dutch situation. Points of reviewer#2: Regarding the statistical method: We have adapted the text, we added the number of cases with a positive lipL32 real-time PCR result for both laboratory confirmed leptospirosis cases and negative cases. We feel this is sufficient for the reader to get insight which proportion of the laboratory confirmed leptospirosis cases as well as negative cases have a positive / negative lipL32 real-time PCR result. We had made already reference to the website < http://vassarstats.net/>, we used as a tool for the statistical computation: Clinical Research Calculators/Calculator 1. Here the 95% confidence intervals for proportions are calculated according to the efficient-score method (corrected for continuity) described by Robert Newcombe, based on the procedure outlined by E. B. Wilson in 1927. We have adapted the grammar and spelling errors according to the remarks. Points of Academic Editor: This is addressed above, see reviewer#2, regarding the statistical method. Submitted filename: Rebuttal letter with Point wise comments to authors.docx Click here for additional data file. 17 Sep 2020 PONE-D-20-04275R1 Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection PLOS ONE Dear Dr. Ahmed, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by October 15, 2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Kalimuthusamy Natarajaseenivasan Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Dear authors Authors have addressed all the points raised during preliminary review, however, few incorporation are suggested and requested to include in the final version accordingly. Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: VEDHAGIRI KUMARESAN Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Point wise comments to authors for revision PONE-D-20-04275R1.docx Click here for additional data file. 24 Sep 2020 Dear Dr. Kalimuthusamy Natarajaseenivasan, Thank you very much for the opportunity to adapt our manuscript ‘Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection’ with the last suggestions. Please find below our response. Yours sincerely, A.A. Ahmed PhD • Page 11; line 170 -171 (Authors are requested to incorporate ): To assess the effects of biological matrix...........sero negative (MAT) and PCR negative blood and serum samples & PCR negative urine samples were spiked with L. interrogans serovar Icterohaemorrhagiae strain Kantorowicz. We have incorporated as requested • Page 14; Line 227 -229: Efficiency of extraction method- Although the spiking was done with 10 fold dilution of 9 X105 leptospires. However, the result mentioned about 100 copies IC only. Kindly clarify/ modify accordingly. To clarify: in Material and Methods, page 8 line 100-102 we describe how the efficiency of the extraction method is performed and indeed we used an equivalent of 100 copies of IC DNA and not the 10 fold dilution of 9 X105 leptospires. • Page14: Line 234: Among 71 positive samples, how many paired samples incorporated in this study from the banked samples? There were no paired samples included in the 71 positive samples. • As mentioned in the line 189, the paired samples should be collected at least 2 days apart. Kindly change the word into 2 weeks. (Refer WHO guidelines). (https://www.who.int/zoonoses/diseases/Leptospirosissurveillance.pdf?ua=1) Thank you for your remark. Indeed, the WHO guidelines mention to collect paired samples at least 2 weeks apart. However in our laboratory (National Leptospirosis Reference Laboratory (NRL)) we found that a titre rise can even be observed in samples 2 days apart. This is described in the reference [2], already cited in line 185. To clarify, we have cited this reference again at the end of line 189. Submitted filename: Response to Reviewers.docx Click here for additional data file. 19 Oct 2020 Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection PONE-D-20-04275R2 Dear Dr. Ahmed, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Kalimuthusamy Natarajaseenivasan Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 22 Oct 2020 PONE-D-20-04275R2 Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection Dear Dr. Ahmed: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Kalimuthusamy Natarajaseenivasan Academic Editor PLOS ONE
  30 in total

1.  Real time quantitative PCR.

Authors:  C A Heid; J Stevens; K J Livak; P M Williams
Journal:  Genome Res       Date:  1996-10       Impact factor: 9.043

2.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

3.  [Classification of Leptospira isolated in Peru].

Authors:  S Masedo Agirre; Iu G Chernukha
Journal:  Zh Mikrobiol Epidemiol Immunobiol       Date:  1979-02

4.  Leptospira idonii sp. nov., isolated from environmental water.

Authors:  Mitsumasa Saito; Sharon Y A M Villanueva; Yoshiaki Kawamura; Ken-Ichiro Iida; Junko Tomida; Takaaki Kanemaru; Eri Kohno; Satoshi Miyahara; Akiko Umeda; Kazunobu Amako; Nina G Gloriani; Shin-Ichi Yoshida
Journal:  Int J Syst Evol Microbiol       Date:  2012-11-30       Impact factor: 2.747

5.  Leptospira kmetyi sp. nov., isolated from an environmental source in Malaysia.

Authors:  Andrew T Slack; Siti Khairani-Bejo; Meegan L Symonds; Michael F Dohnt; Renee L Galloway; Arnold G Steigerwalt; Abdul R Bahaman; Scott Craig; Bruce J Harrower; Lee D Smythe
Journal:  Int J Syst Evol Microbiol       Date:  2009-04       Impact factor: 2.747

6.  Leptospira broomii sp. nov., isolated from humans with leptospirosis.

Authors:  Paul N Levett; Roger E Morey; Renee L Galloway; Arnold G Steigerwalt
Journal:  Int J Syst Evol Microbiol       Date:  2006-03       Impact factor: 2.747

7.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

8.  Diagnostic accuracy of real-time PCR assays targeting 16S rRNA and lipL32 genes for human leptospirosis in Thailand: a case-control study.

Authors:  Janjira Thaipadungpanit; Janjira Thaipadunpanit; Wirongrong Chierakul; Vanaporn Wuthiekanun; Direk Limmathurotsakul; Premjit Amornchai; Siriphan Boonslip; Lee D Smythe; Roongrueng Limpaiboon; Alex R Hoffmaster; Nicholas P J Day; Sharon J Peacock
Journal:  PLoS One       Date:  2011-01-24       Impact factor: 3.240

9.  Soluble ST2 levels are associated with bleeding in patients with severe Leptospirosis.

Authors:  Jiri F P Wagenaar; M Hussein Gasem; Marga G A Goris; Mariska Leeflang; Rudy A Hartskeerl; Tom van der Poll; Cornelis van 't Veer; Eric C M van Gorp
Journal:  PLoS Negl Trop Dis       Date:  2009-06-02

10.  Conservation of the S10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus Leptospira.

Authors:  Berta Victoria; Ahmed Ahmed; Richard L Zuerner; Niyaz Ahmed; Dieter M Bulach; Javier Quinteiro; Rudy A Hartskeerl
Journal:  PLoS One       Date:  2008-07-16       Impact factor: 3.240

View more
  4 in total

1.  Diagnostic Investigation of 100 Cases of Abortion in Sheep in Uruguay: 2015-2021.

Authors:  Matías A Dorsch; María E Francia; Leandro R Tana; Fabiana C González; Andrés Cabrera; Lucía Calleros; Margarita Sanguinetti; Maila Barcellos; Leticia Zarantonelli; Camila Ciuffo; Leticia Maya; Matías Castells; Santiago Mirazo; Caroline da Silva Silveira; Ana Rabaza; Rubén D Caffarena; Benjamín Doncel Díaz; Virginia Aráoz; Carolina Matto; Joaquín I Armendano; Sofía Salada; Martín Fraga; Sergio Fierro; Federico Giannitti
Journal:  Front Vet Sci       Date:  2022-05-19

2.  The leptospiral LipL21 and LipL41 proteins exhibit a broad spectrum of interactions with host cell components.

Authors: 
Journal:  Virulence       Date:  2021-12       Impact factor: 5.882

3.  Enzyme immunoassays (EIA) for serodiagnosis of human leptospirosis: specific IgG3/IgG1 isotyping may further inform diagnosis of acute disease.

Authors:  Elsa Fortes-Gabriel; Mariana Soares Guedes; Advait Shetty; Charles Klazer Gomes; Teresa Carreira; Maria Luísa Vieira; Lisa Esteves; Luísa Mota-Vieira; Maria Gomes-Solecki
Journal:  PLoS Negl Trop Dis       Date:  2022-02-23

4.  Comparison of Two Leptospira Type Strains of Serovar Grippotyphosa in Microscopic Agglutination Test (MAT) Diagnostics for the Detection of Infections with Leptospires in Horses, Dogs and Pigs.

Authors:  Katrin Strutzberg-Minder; Astrid Ullerich; Karen Dohmann; Jan Boehmer; Marga Goris
Journal:  Vet Sci       Date:  2022-08-29
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.